Search result for sequence:
TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGTTACTGTAAGTCAGCGGTGAAATTTAGGTGCTTAACACCTACCGTGCCGTTGATACTGCAGAGCTGGAATTAGGATGCTGTTGGCGGAATGTGTA
common ontology terms
term enrichment score
TermScore
rural community0.303797
zoological garden0.242424
monkey0.242424
ethiopia0.206897
gorilla gorilla0.200000
chlorocebus aethiops0.190476
chuquisaca department0.190476
state of tennessee0.187500
male0.173913
LOWER IN city0.173913
age 5-13 years0.173913
india0.166667
gay0.160000
LOWER IN united states of america0.160000
bolivia0.160000
homosexual0.148148
msm0.148148
child0.127660
hiv infection0.121212
gorilla0.105263
karen0.105263
myanmar0.105263
LOWER IN hmong0.105263
macaque0.105263
pan troglodytes0.105263
chimpanzee0.105263
grivet monkey0.105263
vervet monkey0.105263
tunapuco0.105263
LOWER IN state of oklahoma0.105263
chlorocebus djamdjamensis0.105263
bale monkey0.105263
new delhi0.105263
africa0.105263
central african republic0.105263
LOWER IN madagascar0.105263
bangui0.105263
LOWER IN antananarivo0.105263
LOWER IN arm0.105263
LOWER IN forearm0.105263
kingdom of spain0.102564
LOWER IN sweden0.100000
thailand0.100000
macaca mulatta0.100000
amerindian0.100000
venezuela0.100000
peru0.100000
LOWER IN mouth mucosa0.100000
LOWER IN china0.095238
hunter gatherer0.095238
LOWER IN age < 1 year0.095238
small village0.095238
LOWER IN heterosexual0.095238
LOWER IN msw0.095238
small intestine0.095238
feces0.091064
LOWER IN infant0.090909
homo sapiens0.088594
LOWER IN skin0.086957
french republic0.083333
LOWER IN mouth0.083333
sweden0.076923
duodenum0.076923
LOWER IN feces0.062500
adult0.062016
united states of america0.010381
Fraction of dbbact annotations with this term covered by the query
TermScore
gorilla gorilla0.666667
gorilla0.500000
karen0.500000
myanmar0.500000
LOWER IN hmong0.500000
macaque0.500000
pan troglodytes0.500000
chimpanzee0.500000
chlorocebus aethiops0.500000
grivet monkey0.500000
vervet monkey0.500000
tunapuco0.500000
LOWER IN state of oklahoma0.500000
chlorocebus djamdjamensis0.500000
bale monkey0.500000
new delhi0.500000
africa0.500000
central african republic0.500000
LOWER IN madagascar0.500000
bangui0.500000
LOWER IN antananarivo0.500000
chuquisaca department0.500000
LOWER IN arm0.500000
LOWER IN forearm0.500000
rural community0.428571
LOWER IN sweden0.333333
male0.333333
thailand0.333333
macaca mulatta0.333333
amerindian0.333333
venezuela0.333333
LOWER IN city0.333333
peru0.333333
age 5-13 years0.333333
LOWER IN mouth mucosa0.333333
india0.285714
gay0.250000
zoological garden0.250000
monkey0.250000
LOWER IN china0.250000
ethiopia0.250000
hunter gatherer0.250000
LOWER IN united states of america0.250000
LOWER IN age < 1 year0.250000
small village0.250000
LOWER IN heterosexual0.250000
LOWER IN msw0.250000
small intestine0.250000
bolivia0.250000
homosexual0.200000
msm0.200000
state of tennessee0.200000
LOWER IN infant0.200000
LOWER IN skin0.166667
french republic0.142857
LOWER IN mouth0.142857
hiv infection0.125000
sweden0.111111
duodenum0.111111
child0.100000
kingdom of spain0.090909
LOWER IN feces0.066667
homo sapiens0.047904
feces0.047847
adult0.035714
united states of america0.005348
Fraction of annotations for the query sequences containing the term
TermScore
feces0.941176
homo sapiens0.588235
adult0.235294
zoological garden0.235294
monkey0.235294
rural community0.235294
united states of america0.176471
state of tennessee0.176471
ethiopia0.176471
child0.176471
kingdom of spain0.117647
homosexual0.117647
gay0.117647
msm0.117647
male0.117647
hiv infection0.117647
gorilla gorilla0.117647
chlorocebus aethiops0.117647
LOWER IN city0.117647
LOWER IN united states of america0.117647
india0.117647
age 5-13 years0.117647
bolivia0.117647
chuquisaca department0.117647
LOWER IN sweden0.058824
french republic0.058824
gorilla0.058824
thailand0.058824
karen0.058824
myanmar0.058824
LOWER IN hmong0.058824
LOWER IN china0.058824
macaca mulatta0.058824
macaque0.058824
pan troglodytes0.058824
chimpanzee0.058824
grivet monkey0.058824
hunter gatherer0.058824
amerindian0.058824
venezuela0.058824
vervet monkey0.058824
LOWER IN infant0.058824
LOWER IN age < 1 year0.058824
peru0.058824
small village0.058824
tunapuco0.058824
LOWER IN state of oklahoma0.058824
chlorocebus djamdjamensis0.058824
bale monkey0.058824
LOWER IN heterosexual0.058824
LOWER IN msw0.058824
sweden0.058824
new delhi0.058824
small intestine0.058824
duodenum0.058824
LOWER IN feces0.058824
africa0.058824
central african republic0.058824
LOWER IN madagascar0.058824
bangui0.058824
LOWER IN antananarivo0.058824
LOWER IN skin0.058824
LOWER IN arm0.058824
LOWER IN forearm0.058824
LOWER IN mouth mucosa0.058824
LOWER IN mouth0.058824
Exp. ID User ID Description Date Region Flag Sequences
578amnon high in kingdom of spain compared to sweden in homosexual gay msm male adult hiv infection feces homo sapiens 2020-01-14v3No1 / 133
406amnoncommon feces, zoological garden, french republic, gorilla gorilla, monkey, gorilla2018-11-21v4No1 / 239
400amnonlower in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in karen myanmar compared to hmong china in homo sapiens feces thailand rural community )2018-11-18v4No1 / 329
399amnoncommon feces, united states of america, zoological garden, state of tennessee, gorilla gorilla2018-11-16v4No1 / 395
399amnoncommon feces, united states of america, zoological garden, state of tennessee, macaca mulatta, macaque2018-11-16v4No1 / 404
399amnoncommon pan troglodytes, chimpanzee, zoological garden, feces, united states of america, state of tennessee2018-11-16v4No1 / 407
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, grivet monkey2018-01-16v4No1 / 440
371amnonhigher in amerindians compared to western visitors ( high in hunter gatherer amerindian venezuela compared to city united states of america in feces homo sapiens )2018-09-06v4No1 / 443
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, vervet monkey2018-01-16v4No1 / 446
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
276amnon high in peru small village tunapuco rural community compared to united states of america city state of oklahoma in feces homo sapiens adult 2018-01-22v4No1 / 469
274amnoncommon monkey, chlorocebus djamdjamensis, bale monkey, ethiopia, feces2018-01-16v4No1 / 489
578amnonhigher in gay (msm) individuals compared to heterosexual (msw) ( high in gay msm homosexual compared to heterosexual msw in male adult sweden kingdom of spain hiv infection feces homo sapiens )2020-01-14v3No1 / 519
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
425amnon high in central african republic bangui compared to madagascar antananarivo in homo sapiens feces africa child 2018-12-08v4No1 / 564
517amnon high in feces compared to skin arm forearm in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 606
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 752

Problems / suggestions? Please email info AT dbbact DOT org