Search result for sequence:
TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGTTACTGTAAGTCAGCGGTGAAATTTAGGTGCTTAACACCTACCGTGCCGTTGATACTGCAGAGCTGGAATTAGGATGCTGTTGGCGGAATGTGTA
common ontology terms
term enrichment score
TermScore
rural community0.328767
zoological garden0.258065
monkey0.258065
ethiopia0.222222
gorilla gorilla0.222222
chlorocebus aethiops0.210526
chuquisaca department0.210526
state of tennessee0.200000
LOWER IN city0.190476
india0.190476
age 5-13 years0.190476
LOWER IN united states of america0.173913
bolivia0.173913
child0.133333
gorilla0.117647
karen0.117647
myanmar0.117647
LOWER IN hmong0.117647
macaque0.117647
pan troglodytes0.117647
chimpanzee0.117647
grivet monkey0.117647
vervet monkey0.117647
tunapuco0.117647
LOWER IN state of oklahoma0.117647
chlorocebus djamdjamensis0.117647
bale monkey0.117647
new delhi0.117647
africa0.117647
central african republic0.117647
LOWER IN madagascar0.117647
bangui0.117647
LOWER IN antananarivo0.117647
LOWER IN arm0.117647
LOWER IN forearm0.117647
LOWER IN mouth mucosa0.117647
thailand0.111111
macaca mulatta0.111111
amerindian0.111111
venezuela0.111111
peru0.111111
LOWER IN china0.105263
hunter gatherer0.105263
LOWER IN age < 1 year0.105263
small village0.105263
small intestine0.105263
LOWER IN infant0.100000
LOWER IN skin0.095238
french republic0.090909
LOWER IN mouth0.090909
feces0.084649
duodenum0.083333
homo sapiens0.081336
LOWER IN feces0.066667
adult0.042553
united states of america0.010471
Fraction of dbbact annotations with this term covered by the query
TermScore
gorilla gorilla0.666667
gorilla0.500000
karen0.500000
myanmar0.500000
LOWER IN hmong0.500000
macaque0.500000
pan troglodytes0.500000
chimpanzee0.500000
chlorocebus aethiops0.500000
grivet monkey0.500000
vervet monkey0.500000
tunapuco0.500000
LOWER IN state of oklahoma0.500000
chlorocebus djamdjamensis0.500000
bale monkey0.500000
new delhi0.500000
africa0.500000
central african republic0.500000
LOWER IN madagascar0.500000
bangui0.500000
LOWER IN antananarivo0.500000
chuquisaca department0.500000
LOWER IN arm0.500000
LOWER IN forearm0.500000
LOWER IN mouth mucosa0.500000
rural community0.428571
thailand0.333333
macaca mulatta0.333333
amerindian0.333333
venezuela0.333333
LOWER IN city0.333333
india0.333333
peru0.333333
age 5-13 years0.333333
zoological garden0.250000
monkey0.250000
LOWER IN china0.250000
ethiopia0.250000
hunter gatherer0.250000
LOWER IN united states of america0.250000
LOWER IN age < 1 year0.250000
small village0.250000
small intestine0.250000
bolivia0.250000
state of tennessee0.200000
LOWER IN infant0.200000
LOWER IN skin0.166667
french republic0.142857
LOWER IN mouth0.142857
duodenum0.111111
child0.100000
LOWER IN feces0.066667
feces0.044335
homo sapiens0.044025
adult0.025316
united states of america0.005376
Fraction of annotations for the query sequences containing the term
TermScore
feces0.933333
homo sapiens0.533333
zoological garden0.266667
monkey0.266667
rural community0.266667
united states of america0.200000
state of tennessee0.200000
ethiopia0.200000
child0.200000
gorilla gorilla0.133333
chlorocebus aethiops0.133333
LOWER IN city0.133333
LOWER IN united states of america0.133333
adult0.133333
india0.133333
age 5-13 years0.133333
bolivia0.133333
chuquisaca department0.133333
french republic0.066667
gorilla0.066667
thailand0.066667
karen0.066667
myanmar0.066667
LOWER IN hmong0.066667
LOWER IN china0.066667
macaca mulatta0.066667
macaque0.066667
pan troglodytes0.066667
chimpanzee0.066667
grivet monkey0.066667
hunter gatherer0.066667
amerindian0.066667
venezuela0.066667
vervet monkey0.066667
LOWER IN infant0.066667
LOWER IN age < 1 year0.066667
peru0.066667
small village0.066667
tunapuco0.066667
LOWER IN state of oklahoma0.066667
chlorocebus djamdjamensis0.066667
bale monkey0.066667
new delhi0.066667
small intestine0.066667
duodenum0.066667
LOWER IN feces0.066667
africa0.066667
central african republic0.066667
LOWER IN madagascar0.066667
bangui0.066667
LOWER IN antananarivo0.066667
LOWER IN skin0.066667
LOWER IN arm0.066667
LOWER IN forearm0.066667
LOWER IN mouth mucosa0.066667
LOWER IN mouth0.066667
Exp. ID User ID Description Date Region Flag Sequences
406amnoncommon feces, zoological garden, french republic, gorilla gorilla, monkey, gorilla2018-11-21v4No1 / 239
400amnonlower in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in karen myanmar compared to hmong china in homo sapiens feces thailand rural community )2018-11-18v4No1 / 329
399amnoncommon feces, united states of america, zoological garden, state of tennessee, gorilla gorilla2018-11-16v4No1 / 395
399amnoncommon feces, united states of america, zoological garden, state of tennessee, macaca mulatta, macaque2018-11-16v4No1 / 404
399amnoncommon pan troglodytes, chimpanzee, zoological garden, feces, united states of america, state of tennessee2018-11-16v4No1 / 407
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, grivet monkey2018-01-16v4No1 / 440
371amnonhigher in amerindians compared to western visitors ( high in hunter gatherer amerindian venezuela compared to city united states of america in feces homo sapiens )2018-09-06v4No1 / 443
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, vervet monkey2018-01-16v4No1 / 446
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
276amnon high in peru small village tunapuco rural community compared to united states of america city state of oklahoma in feces homo sapiens adult 2018-01-22v4No1 / 469
274amnoncommon monkey, chlorocebus djamdjamensis, bale monkey, ethiopia, feces2018-01-16v4No1 / 489
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
425amnon high in central african republic bangui compared to madagascar antananarivo in homo sapiens feces africa child 2018-12-08v4No1 / 564
517amnon high in feces compared to skin arm forearm in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 606
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 752

Problems / suggestions? Please email info AT dbbact DOT org