Search result for sequence:
TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGTTACTGTAAGTCAGCGGTGAAATTTAGGTGCTTAACACCTACCGTGCCGTTGATACTGCAGAGCTGGAATTAGGATGCTGTTGGCGGAATGTGTA
common ontology terms
term enrichment score
TermScore
zoological garden0.395604
rural community0.228571
gorilla gorilla0.214286
pan troglodytes0.206897
chimpanzee0.206897
monkey0.205128
ethiopia0.171429
state of tennessee0.157895
macaque0.153846
lincoln park zoo0.148148
macaca mulatta0.148148
chlorocebus aethiops0.148148
chuquisaca department0.148148
LOWER IN nouabale-ndoki national park0.148148
LOWER IN republic of congo0.148148
chicago0.137931
age 5-13 years0.137931
LOWER IN city0.133333
india0.133333
gay0.129032
bolivia0.129032
LOWER IN united states of america0.125000
msm0.114286
homosexual0.114286
feces0.107620
child0.104348
hiv infection0.097561
male0.097561
LOWER IN wild0.093023
kingdom of spain0.081633
como zoo0.080000
white-faced saki0.080000
pithecia pithecia0.080000
gorilla0.080000
karen0.080000
myanmar0.080000
LOWER IN hmong0.080000
grivet monkey0.080000
vervet monkey0.080000
tunapuco0.080000
LOWER IN state of oklahoma0.080000
chlorocebus djamdjamensis0.080000
bale monkey0.080000
new delhi0.080000
central african republic0.080000
LOWER IN madagascar0.080000
bangui0.080000
LOWER IN antananarivo0.080000
LOWER IN arm0.080000
LOWER IN forearm0.080000
LOWER IN pan troglodytes troglodytes0.080000
gorilla gorilla gorilla0.080000
homo sapiens0.079840
LOWER IN sweden0.076923
amerindian0.076923
venezuela0.076923
peru0.076923
africa0.076923
LOWER IN mouth mucosa0.076923
thailand0.074074
LOWER IN china0.074074
hunter gatherer0.074074
small village0.074074
small intestine0.074074
LOWER IN infant0.071429
LOWER IN age < 1 year0.071429
LOWER IN msw0.071429
LOWER IN heterosexual0.071429
state of minnesota0.068966
LOWER IN skin0.068966
french republic0.066667
LOWER IN mouth0.066667
duodenum0.062500
sweden0.060606
adult0.051613
LOWER IN feces0.051282
united states of america0.037875
research facility0.015267
Fraction of dbbact annotations with this term covered by the query
TermScore
macaque0.666667
gorilla gorilla0.600000
como zoo0.500000
white-faced saki0.500000
pithecia pithecia0.500000
gorilla0.500000
karen0.500000
myanmar0.500000
LOWER IN hmong0.500000
lincoln park zoo0.500000
pan troglodytes0.500000
chimpanzee0.500000
macaca mulatta0.500000
chlorocebus aethiops0.500000
grivet monkey0.500000
vervet monkey0.500000
tunapuco0.500000
LOWER IN state of oklahoma0.500000
chlorocebus djamdjamensis0.500000
bale monkey0.500000
new delhi0.500000
central african republic0.500000
LOWER IN madagascar0.500000
bangui0.500000
LOWER IN antananarivo0.500000
chuquisaca department0.500000
LOWER IN arm0.500000
LOWER IN forearm0.500000
LOWER IN nouabale-ndoki national park0.500000
LOWER IN republic of congo0.500000
LOWER IN pan troglodytes troglodytes0.500000
gorilla gorilla gorilla0.500000
zoological garden0.400000
LOWER IN sweden0.333333
rural community0.333333
chicago0.333333
amerindian0.333333
venezuela0.333333
peru0.333333
africa0.333333
age 5-13 years0.333333
LOWER IN mouth mucosa0.333333
LOWER IN city0.285714
india0.285714
gay0.250000
monkey0.250000
thailand0.250000
LOWER IN china0.250000
ethiopia0.250000
hunter gatherer0.250000
small village0.250000
small intestine0.250000
bolivia0.250000
LOWER IN united states of america0.222222
state of tennessee0.200000
LOWER IN infant0.200000
LOWER IN age < 1 year0.200000
LOWER IN msw0.200000
LOWER IN heterosexual0.200000
msm0.166667
homosexual0.166667
state of minnesota0.166667
LOWER IN skin0.166667
french republic0.142857
LOWER IN mouth0.142857
hiv infection0.111111
male0.111111
duodenum0.111111
sweden0.100000
LOWER IN wild0.100000
child0.086957
kingdom of spain0.076923
LOWER IN feces0.062500
feces0.057018
homo sapiens0.043956
adult0.030303
united states of america0.019900
research facility0.009259
Fraction of annotations for the query sequences containing the term
TermScore
feces0.956522
homo sapiens0.434783
united states of america0.391304
zoological garden0.391304
adult0.173913
monkey0.173913
rural community0.173913
gorilla gorilla0.130435
pan troglodytes0.130435
chimpanzee0.130435
state of tennessee0.130435
ethiopia0.130435
child0.130435
hiv infection0.086957
male0.086957
msm0.086957
gay0.086957
homosexual0.086957
kingdom of spain0.086957
lincoln park zoo0.086957
chicago0.086957
macaca mulatta0.086957
macaque0.086957
chlorocebus aethiops0.086957
LOWER IN city0.086957
LOWER IN united states of america0.086957
india0.086957
age 5-13 years0.086957
bolivia0.086957
chuquisaca department0.086957
LOWER IN nouabale-ndoki national park0.086957
LOWER IN republic of congo0.086957
LOWER IN wild0.086957
LOWER IN sweden0.043478
state of minnesota0.043478
como zoo0.043478
white-faced saki0.043478
pithecia pithecia0.043478
french republic0.043478
gorilla0.043478
thailand0.043478
karen0.043478
myanmar0.043478
LOWER IN hmong0.043478
LOWER IN china0.043478
research facility0.043478
grivet monkey0.043478
hunter gatherer0.043478
amerindian0.043478
venezuela0.043478
vervet monkey0.043478
LOWER IN infant0.043478
LOWER IN age < 1 year0.043478
peru0.043478
small village0.043478
tunapuco0.043478
LOWER IN state of oklahoma0.043478
chlorocebus djamdjamensis0.043478
bale monkey0.043478
sweden0.043478
LOWER IN msw0.043478
LOWER IN heterosexual0.043478
new delhi0.043478
small intestine0.043478
duodenum0.043478
LOWER IN feces0.043478
africa0.043478
central african republic0.043478
LOWER IN madagascar0.043478
bangui0.043478
LOWER IN antananarivo0.043478
LOWER IN skin0.043478
LOWER IN arm0.043478
LOWER IN forearm0.043478
LOWER IN mouth mucosa0.043478
LOWER IN mouth0.043478
LOWER IN pan troglodytes troglodytes0.043478
gorilla gorilla gorilla0.043478
Exp. ID User ID Description Date Region Flag Sequences
578amnon high in kingdom of spain compared to sweden in homo sapiens feces hiv infection adult male msm gay homosexual 2020-01-14v3No1 / 133
625amnoncommon state of minnesota, como zoo, united states of america, white-faced saki, pithecia pithecia, zoological garden, feces2020-05-16v4No1 / 179
406amnoncommon feces, zoological garden, french republic, gorilla gorilla, monkey, gorilla2018-11-21v4No1 / 239
400amnonlower in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in karen myanmar compared to hmong china in homo sapiens feces thailand rural community )2018-11-18v4No1 / 329
620amnoncommon lincoln park zoo, chicago, united states of america, pan troglodytes, chimpanzee, zoological garden, feces2020-05-06v4No1 / 358
620amnoncommon lincoln park zoo, united states of america, chicago, zoological garden, feces, gorilla gorilla2020-05-06v4No1 / 384
399amnoncommon feces, united states of america, zoological garden, state of tennessee, gorilla gorilla2018-11-16v4No1 / 395
399amnoncommon feces, united states of america, zoological garden, state of tennessee, macaca mulatta, macaque2018-11-16v4No1 / 404
399amnoncommon pan troglodytes, chimpanzee, zoological garden, feces, united states of america, state of tennessee2018-11-16v4No1 / 407
592amnoncommon feces, united states of america, research facility, macaca mulatta, macaque2020-02-18v1No1 / 423
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, grivet monkey2018-01-16v4No1 / 440
371amnonhigher in amerindians compared to western visitors ( high in hunter gatherer amerindian venezuela compared to city united states of america in feces homo sapiens )2018-09-06v4No1 / 443
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, vervet monkey2018-01-16v4No1 / 446
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
276amnon high in peru small village tunapuco rural community compared to united states of america city state of oklahoma in feces homo sapiens adult 2018-01-22v4No1 / 469
274amnoncommon monkey, chlorocebus djamdjamensis, bale monkey, ethiopia, feces2018-01-16v4No1 / 489
578amnonhigher in gay (msm) individuals compared to heterosexual (msw) ( high in homosexual msm gay compared to msw heterosexual in homo sapiens feces hiv infection kingdom of spain sweden adult male )2020-01-14v3No1 / 519
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
425amnon high in central african republic bangui compared to madagascar antananarivo in homo sapiens feces africa child 2018-12-08v4No1 / 564
517amnon high in feces compared to skin arm forearm in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 606
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 752
620amnon high in united states of america zoological garden pan troglodytes compared to nouabale-ndoki national park republic of congo wild pan troglodytes troglodytes in chimpanzee feces 2020-05-06v4No1 / 964
620amnon high in united states of america zoological garden compared to nouabale-ndoki national park wild republic of congo in gorilla gorilla gorilla feces 2020-05-06v4No1 / 1019

Problems / suggestions? Please email info AT dbbact DOT org