Search result for sequence:
TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGTTTATTAAGTTAGTGGTTAAATATTTGAGCTAAACTCAATTGTGCCATTAATACTGGTAAACTGGAGTACAGACGAGGTAGGCGGAATAAGTTAA
common ontology terms
term enrichment score
TermScore
homo sapiens0.592770
feces0.474790
adult0.415437
united states of america0.236822
child0.184805
china0.153033
control0.132836
city0.116505
kingdom of spain0.102784
obsolete_juvenile stage0.095563
caecum0.092486
rural community0.086022
female0.079909
jiangsu province0.078431
infant0.076923
LOWER IN ulcerative colitis0.073529
free range chicken0.071942
age0.065466
gallus gallus0.064935
chicken0.064935
LOWER IN crohn's disease0.057971
ileum0.057279
rectum0.056738
colon0.051836
state of oklahoma0.044944
age 5-13 years0.044944
LOWER IN rural community0.044776
africa0.044444
thailand0.044444
india0.044444
biopsy0.043956
kingdom of denmark0.043478
state of colorado0.043011
kingdom of norway0.042553
united kingdom0.042105
farm0.040984
diet0.039216
state of california0.038095
animal product diet0.030303
heterosexual0.030303
msw0.030303
himalayas0.030075
tharu0.030075
agrarian0.030075
guangzhou city prefecture0.030075
commonwealth of pennsylvania0.030075
central african republic0.030075
bangui0.030075
hmong0.030075
age 19-240.030075
age 60-790.030075
age 30-500.030075
age >940.030075
oslo0.030075
age 30-400.030075
cron diet0.030075
age 130.030075
LOWER IN small village0.030075
LOWER IN age < 1 year0.030075
LOWER IN age 30-500.030075
LOWER IN age 60-790.030075
age 50-60 years0.030075
nanning city prefecture0.030075
mongolian sheep0.030075
oryctolagus cuniculus0.030075
chuquisaca department0.030075
colombia0.029851
LOWER IN infant0.029851
age 6 weeks0.029630
age 8 weeks0.029630
nepal0.029630
tibet autonomous region0.029630
LOWER IN hiv infection0.029630
LOWER IN child0.029630
caloric restriction diet0.029630
state of michigan0.029412
finland0.029412
south korea0.029197
biopsy site0.029197
juvenile organism0.029197
bolivia0.029197
commonwealth of virginia0.028777
hospital0.028369
tibetan plateau0.028369
ovis aries0.028369
diarrhea0.027972
australia0.025157
research facility0.017699
LOWER IN control0.015873
LOWER IN chepang0.015267
LOWER IN forager0.015267
native american0.015267
cheyenne0.015267
arapaho0.015267
LOWER IN american0.015267
LOWER IN plant based diet0.015267
LOWER IN premature birth0.015267
LOWER IN endospore enriched fraction0.015267
LOWER IN lysis0.015267
daycare0.015267
Fraction of dbbact annotations with this term covered by the query
TermScore
LOWER IN ulcerative colitis0.714286
state of oklahoma0.666667
animal product diet0.666667
age 5-13 years0.666667
heterosexual0.666667
msw0.666667
LOWER IN rural community0.600000
rural community0.571429
free range chicken0.500000
himalayas0.500000
tharu0.500000
agrarian0.500000
LOWER IN chepang0.500000
LOWER IN forager0.500000
native american0.500000
cheyenne0.500000
arapaho0.500000
LOWER IN american0.500000
LOWER IN plant based diet0.500000
LOWER IN premature birth0.500000
LOWER IN endospore enriched fraction0.500000
LOWER IN lysis0.500000
daycare0.500000
age 1-5 years0.500000
stroke0.500000
guangzhou city prefecture0.500000
salmonella gastroenteritis0.500000
commonwealth of pennsylvania0.500000
age 17-290.500000
africa0.500000
central african republic0.500000
bangui0.500000
quito0.500000
denver0.500000
age 200.500000
LOWER IN egypt0.500000
nanchang city prefecture0.500000
thailand0.500000
hmong0.500000
azerbaijan0.500000
age 19-240.500000
age 8-120.500000
age one month0.500000
LOWER IN age one week0.500000
LOWER IN inflammatory bowel disease0.500000
age 3-60.500000
mild0.500000
LOWER IN severe0.500000
age 60-790.500000
gangcha region0.500000
LOWER IN gannan tibetan autonomous prefecture0.500000
age 30-500.500000
irritable bowel syndrome0.500000
age >940.500000
oslo0.500000
age 30-400.500000
myanmar0.500000
karen0.500000
cron diet0.500000
age 13-140.500000
LOWER IN karen0.500000
LOWER IN myanmar0.500000
age 130.500000
toronto0.500000
LOWER IN plant diet0.500000
age<17 years0.500000
LOWER IN peru0.500000
LOWER IN small village0.500000
LOWER IN tunapuco0.500000
estonia0.500000
LOWER IN russia0.500000
india0.500000
age 1-3 years0.500000
LOWER IN age < 1 year0.500000
low income0.500000
LOWER IN sewer0.500000
LOWER IN wastewater treatment plant0.500000
spondyloarthritis0.500000
spondylitis0.500000
age 12 weeks0.500000
gastric carcinoma0.500000
stomach neoplasm0.500000
canada0.500000
atherosclerosis0.500000
shantytown0.500000
lima0.500000
LOWER IN el salado0.500000
LOWER IN age 30-500.500000
LOWER IN age 60-790.500000
LOWER IN age >940.500000
soldiers0.500000
age 50-60 years0.500000
nanning city prefecture0.500000
nephrolithiasis0.500000
age 1-20.500000
LOWER IN age 0-10.500000
LOWER IN nepal0.500000
LOWER IN himalayas0.500000
mongolian sheep0.500000
cecum0.500000
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.906977
feces0.868217
adult0.426357
united states of america0.379845
china0.193798
control0.147287
child0.116279
city0.069767
caecum0.062016
kingdom of spain0.062016
female0.054264
obsolete_juvenile stage0.054264
rural community0.046512
jiangsu province0.046512
infant0.046512
gallus gallus0.038760
chicken0.038760
farm0.038760
free range chicken0.038760
LOWER IN ulcerative colitis0.038760
age0.038760
colon0.031008
ileum0.031008
LOWER IN crohn's disease0.031008
rectum0.031008
state of oklahoma0.023256
diet0.023256
kingdom of norway0.023256
state of california0.023256
africa0.023256
age 5-13 years0.023256
state of colorado0.023256
thailand0.023256
biopsy0.023256
kingdom of denmark0.023256
united kingdom0.023256
LOWER IN rural community0.023256
india0.023256
age 6 weeks0.015504
age 8 weeks0.015504
himalayas0.015504
nepal0.015504
tharu0.015504
agrarian0.015504
animal product diet0.015504
australia0.015504
hospital0.015504
diarrhea0.015504
commonwealth of virginia0.015504
colombia0.015504
guangzhou city prefecture0.015504
south korea0.015504
tibet autonomous region0.015504
tibetan plateau0.015504
LOWER IN hiv infection0.015504
commonwealth of pennsylvania0.015504
state of michigan0.015504
central african republic0.015504
bangui0.015504
heterosexual0.015504
msw0.015504
hmong0.015504
biopsy site0.015504
age 19-240.015504
LOWER IN child0.015504
age 60-790.015504
age 30-500.015504
age >940.015504
oslo0.015504
age 30-400.015504
cron diet0.015504
caloric restriction diet0.015504
age 130.015504
juvenile organism0.015504
finland0.015504
LOWER IN infant0.015504
LOWER IN small village0.015504
LOWER IN age < 1 year0.015504
LOWER IN control0.015504
LOWER IN age 30-500.015504
LOWER IN age 60-790.015504
age 50-60 years0.015504
nanning city prefecture0.015504
mongolian sheep0.015504
ovis aries0.015504
oryctolagus cuniculus0.015504
research facility0.015504
bolivia0.015504
chuquisaca department0.015504
LOWER IN chepang0.007752
LOWER IN forager0.007752
native american0.007752
cheyenne0.007752
arapaho0.007752
LOWER IN american0.007752
LOWER IN plant based diet0.007752
vagina0.007752
pregnancy0.007752
LOWER IN premature birth0.007752
LOWER IN systemic lupus erythematosus0.007752
Exp. ID User ID Description Date Region Flag Sequences
495amnonhighfreq gallus gallus, chicken, caecum, kingdom of spain, farm, free range chicken, age 6 weeks2019-03-03v4No1 / 16
495amnonhighfreq gallus gallus, chicken, caecum, kingdom of spain, farm, free range chicken, age 8 weeks2019-03-03v4No1 / 18
477amnonhigher in agrarian tharu population compared to foraging chepang population ( high in tharu agrarian compared to chepang forager in homo sapiens feces adult himalayas nepal rural community )2019-01-28v4No1 / 19
242amnonhigher in native-americans compared to non native-american ( high in native american cheyenne arapaho compared to american in homo sapiens feces united states of america state of oklahoma )2017-11-14v4No1 / 23
63amnon high in animal product diet diet compared to plant based diet in homo sapiens united states of america feces 2017-04-12v4No1 / 32
191amnonlower in preterm birth vaginal samples ( high in control compared to premature birth in homo sapiens vagina female united states of america pregnancy )2017-09-05v4No1 / 37
390amnoncommon homo sapiens, feces, australia, hospital, diarrhea2018-11-04v4No1 / 38
368amnon high in control compared to systemic lupus erythematosus in feces homo sapiens commonwealth of virginia united states of america adult 2018-09-03v4No1 / 39
401amnonlower in endospore enriched (lysis resistant) replicates ( high in control compared to endospore enriched fraction lysis in homo sapiens feces united states of america adult )2018-11-18v4No1 / 41
51amnoncommon feces, homo sapiens, united states of america2017-01-19v4No1 / 42
482amnoncommon homo sapiens, feces, colombia, medellin metropolitan area, child, daycare, age 1-5 years2019-02-12v4No1 / 47
333amnoncommon in stroke patient feces (common feces, homo sapiens, stroke, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 53
131amnon high in female compared to male in homo sapiens feces south korea 2017-04-16v4No1 / 55
390amnoncommon homo sapiens, feces, australia, hospital, salmonella gastroenteritis, diarrhea2018-11-04v4No1 / 55
333amnoncommon in healthy controls feces (common homo sapiens, feces, guangzhou city prefecture, adult, control, china)2018-05-15v4No1 / 61
380amnoncommon tibet autonomous region, feces, homo sapiens, tibetan plateau, adult2018-10-03v4No1 / 63
194amnon high in colon ileum compared to feces in homo sapiens kingdom of norway 2017-09-07v4No1 / 67
51amnon high in control compared to hiv infection in homo sapiens feces united states of america 2017-01-19v4No1 / 69
22amnon high in control compared to hiv infection in united states of america feces homo sapiens 2016-11-28v4No1 / 70
394amnon high in control compared to ulcerative colitis in homo sapiens feces adult united states of america state of california 2018-11-06v4No1 / 71
477amnoncommon homo sapiens, feces, adult, nepal, himalayas, rural community, tharu, agrarian2019-01-28v4No1 / 74
395amnoncommon homo sapiens, feces, united states of america, commonwealth of pennsylvania, control2018-11-14v4No1 / 75
74amnoncommon united states of america, feces, homo sapiens2017-02-27v4No1 / 76
484amnoncommon feces, united states of america, adult, state of michigan, age 17-29, homo sapiens2019-02-13v4No1 / 76
516amnoncommon homo sapiens, feces, united states of america, state of ohio, adult2019-05-29v4No1 / 77
401amnoncommon homo sapiens, feces, united states of america, adult2018-11-18v4No1 / 79
425amnoncommon homo sapiens, feces, africa, child, central african republic, bangui2018-12-08v4No1 / 79
562amnoncommon age 5-13 years, child, ecuador, quito, feces2019-11-05v4No1 / 82
344amnoncommon in feces of heterosexuals (common homo sapiens, feces, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 82
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, control2018-09-03v4No1 / 82
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msw, heterosexual2018-11-06v4No1 / 84
247amnoncommon homo sapiens, italy, feces, high bmi, obesity2017-11-21v4No1 / 85
249amnoncommon homo sapiens, feces, united states of america2017-11-22v4No1 / 86
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, control2018-11-06v4No1 / 86
430amnoncommon homo sapiens, adult, united states of america, state of arizona, city, age 20, feces2018-12-15v4No1 / 87
62amnon high in united states of america compared to egypt in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 88
293amnoncommon homo sapiens, feces, adult, united states of america, american diet2018-02-07v4No1 / 89
428amnoncommon homo sapiens, adult, feces, nanchang city prefecture, control, china2018-12-09v4No1 / 93
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msm, gay, homosexual2018-11-06v4No1 / 94
400amnoncommon in feces of european american females (common homo sapiens, feces, united states of america, adult, female)2018-11-18v4No1 / 95
400amnoncommon in hmong (chinese) females from thailand (common homo sapiens, feces, adult, female, thailand, hmong, china)2018-11-18v4No1 / 95
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 97
409amnoncommon homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v4No1 / 97
438amnoncommon homo sapiens, feces, age 19-24, china2018-12-30v4No1 / 101
477amnoncommon homo sapiens, feces, adult, united states of america2019-01-28v4No1 / 103
284amnoncommon homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 105
438amnoncommon homo sapiens, feces, jiangsu province, child, age 8-12, china2018-12-30v4No1 / 106
215amnoncommon homo sapiens, feces, united states of america2017-10-23v4No1 / 107
273amnon high in age age one month compared to age one week in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 107
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child ulcerative colitis inflammatory bowel disease crohn's disease in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 107
409amnoncommon homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 108
289amnoncommon homo sapiens, feces, adult, united states of america, state of michigan2018-02-01v4No1 / 109
438amnoncommon homo sapiens, feces, jiangsu province, child, age 3-6, china2018-12-30v4No1 / 109
276amnoncommon feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v4No1 / 110
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to severe ulcerative colitis in homo sapiens child united states of america feces )2018-11-22v4No1 / 110
438amnoncommon feces, homo sapiens, age 60-79, adult, jiangsu province, china2018-12-30v4No1 / 111
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 114
438amnoncommon feces, homo sapiens, jiangsu province, age 30-50, adult, china2018-12-30v4No1 / 115
239amnoncommon homo sapiens, feces, united states of america2017-11-08v4No1 / 117
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 118
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
438amnoncommon feces, homo sapiens, age >94, jiangsu province, adult, china2018-12-30v4No1 / 121
449amnoncommon homo sapiens, feces, colombia2019-01-09v4No1 / 124
131amnoncommon homo sapiens, feces, south korea2017-04-16v4No1 / 128
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-13v4No1 / 130
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
438amnoncommon homo sapiens, feces, jiangsu province, age 13-14, china2018-12-30v4No1 / 134
400amnonhigher in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in hmong china compared to karen myanmar in homo sapiens feces thailand rural community )2018-11-18v4No1 / 135
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, finland2017-09-12v4No1 / 136
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 137
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 138
132amnoncommon homo sapiens, feces, united states of america2017-04-16v4No1 / 145
330amnon high in adult age 30-40 compared to infant age 1 year in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 145
74amnonHigher in animal product diet compared to plant diet ( high in diet animal product diet compared to plant diet in homo sapiens feces united states of america )2017-02-27v4No1 / 149
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 157
292amnon high in control compared to crohn's disease ulcerative colitis in homo sapiens adult feces china 2018-02-05v4No1 / 161
290amnoncommon homo sapiens, feces, adult, city, china2018-02-01v4No1 / 162
297amnoncommon homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 162
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
241amnonlower in babies from russia compared to estonia ( high in estonia compared to russia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 169
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 170
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in homo sapiens feces infant )2017-11-13v4No1 / 173
399amnon high in control compared to ulcerative colitis in feces united states of america homo sapiens 2018-11-16v4No1 / 180
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 183
53amnonlower in sewer and wastewater treatment plant influent compared to feces in south america ( high in feces homo sapiens compared to sewer wastewater treatment plant in south america city low income )2017-01-21v4No1 / 188
495amnoncommon gallus gallus, chicken, caecum, kingdom of spain, farm, free range chicken, age 8 weeks2019-03-03v4No1 / 189
312amnoncommon feces, homo sapiens, french republic, adult, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
495amnoncommon gallus gallus, chicken, caecum, kingdom of spain, farm, free range chicken, age 12 weeks2019-03-03v4No1 / 214
520amnonhigher in gastric cancer compared to paired normal tissue ( high in gastric carcinoma stomach neoplasm compared to control in homo sapiens zhejiang province stomach adult china )2019-06-26v3No1 / 214
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon homo sapiens, feces, adult, small village, rural community, china2018-02-01v4No1 / 218
566amnoncommon adult, homo sapiens, china, feces2019-11-24v4No1 / 221
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 227
53amnon high in shantytown lima compared to el salado small village in homo sapiens feces city 2017-01-21v4No1 / 237
438amnonhigher in students and soldiers age 19-24 compared to older adults ( high in age 19-24 soldiers compared to adult age 30-50 age 60-79 age >94 in homo sapiens feces china )2018-12-30v4No1 / 238
286amnoncommon in feces of individuals with kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, nephrolithiasis, china)2018-01-27v4No1 / 239
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces infant india )2016-12-19v4No1 / 253
286amnoncommon in feces of individuals without kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, control, china)2018-01-27v4No1 / 281
495amnoncommon gallus gallus, chicken, caecum, kingdom of spain, farm, free range chicken, age 6 weeks2019-03-03v4No1 / 290
477amnon high in united states of america compared to nepal himalayas rural community in homo sapiens feces adult 2019-01-28v4No1 / 295
299amnon high in mouth neoplasm cancer compared to control in saliva adult homo sapiens china 2018-02-27v4No1 / 319
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
111amnoncommon mongolian sheep, ovis aries, rectum, ileum, cecum, colon, china2017-04-09v4No1 / 330
190amnon high in wet season compared to dry season in homo sapiens tanzania hadza hunter gatherer feces 2017-09-04v4No1 / 341
400amnonlower in people from thailand compared to 2nd generation immigrants to usa ( high in united states of america compared to thailand rural community in homo sapiens feces )2018-11-18v4No1 / 343
122amnonnegatively correlated with bmi ( high in body mass index low bmi compared to high bmi in homo sapiens feces united kingdom )2017-04-13v4No1 / 345
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
293amnonhigher in caloric restriction (CRON) diet compared to american diet ( high in cron diet caloric restriction diet diet compared to american diet in homo sapiens adult feces united states of america )2018-02-07v4No1 / 381
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-06v4No1 / 417
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
111amnon high in rectum caecum ileum colon compared to rumen ruminant reticulum omasum in mongolian sheep ovis aries china 2017-04-09v4No1 / 464
438amnonhigher in centenarians compared to adults ( high in age >94 compared to age 30-50 age 60-79 in homo sapiens feces china )2018-12-30v4No1 / 474
438amnon high in age 30-50 age 60-79 adult compared to age 3-6 age 8-12 child in homo sapiens feces china 2018-12-30v4No1 / 486
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
425amnon high in central african republic bangui compared to madagascar antananarivo in homo sapiens feces africa child 2018-12-08v4No1 / 564
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 567
399amnoncommon feces, united states of america, oryctolagus cuniculus, rabbit, research facility2018-11-16v4No1 / 577
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in kingdom of spain water estuary estuary water bilbao 2019-03-20v4No1 / 592
517amnon high in feces compared to skin arm forearm in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 606
25amnoncommon oryctolagus cuniculus, caecum, rex rabbit, sichuan province, research facility2016-12-01v4No1 / 669
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 752

Problems / suggestions? Please email info AT dbbact DOT org