Search result for sequence:
TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGTTTGTTAAGTCAGTGGTGAAAGTTTGCGGCTCAACCGTAAAATTGCCATTGAAACTGGCGAACTTGAGTACAGTAGAGGTAGGCGGAATTCGTGG
common ontology terms
term enrichment score
TermScore
snake0.480000
snake farm0.400000
adula0.400000
ictalurus punctatus0.266667
channel catfish0.266667
state of alabama0.250000
hunan province0.222222
fresh water0.204878
state of florida0.204082
spring water0.200000
aquatic biome0.200000
mississippi river0.166667
fishpond0.148148
osteopilus septentrionalis0.148148
elaphe carinata0.142857
king ratsnake0.142857
naja atra0.142857
chinese cobra0.142857
ptyas mucosa0.142857
oriental ratsnake0.142857
deinagkistrodon acutus0.142857
pit viper0.142857
tadpole0.133333
frog0.129032
digestive system0.115385
river0.100000
LOWER IN adult0.095238
catfish0.076923
LOWER IN amerindian0.076923
LOWER IN hunter gatherer0.076923
LOWER IN venezuela0.076923
location 30.076923
location 20.076923
location 40.076923
freshwater sediment metagenome0.076923
pond0.076923
tilapia0.076923
southern united states0.076923
aquatic snake0.076923
LOWER IN terrestrial snake0.076923
particles0.076923
united states of america0.075188
particle0.074074
intestine0.071429
LOWER IN pond0.071429
LOWER IN free floating0.071429
pond water0.068966
free floating0.068966
state of minnesota0.066667
LOWER IN fresh water0.066667
research facility0.065728
farm0.064516
water0.064516
LOWER IN water0.057143
fish0.054054
city0.047619
sediment0.042553
skin0.039216
china0.035928
feces0.017143
homo sapiens0.009756
Fraction of dbbact annotations with this term covered by the query
TermScore
ictalurus punctatus0.666667
channel catfish0.666667
snake0.666667
fishpond0.666667
osteopilus septentrionalis0.666667
catfish0.500000
snake farm0.500000
adula0.500000
elaphe carinata0.500000
king ratsnake0.500000
naja atra0.500000
chinese cobra0.500000
ptyas mucosa0.500000
oriental ratsnake0.500000
state of alabama0.500000
deinagkistrodon acutus0.500000
pit viper0.500000
LOWER IN amerindian0.500000
LOWER IN hunter gatherer0.500000
LOWER IN venezuela0.500000
spring water0.500000
location 30.500000
location 20.500000
location 40.500000
aquatic biome0.500000
freshwater sediment metagenome0.500000
pond0.500000
tilapia0.500000
southern united states0.500000
aquatic snake0.500000
LOWER IN terrestrial snake0.500000
particles0.500000
tadpole0.333333
particle0.333333
frog0.285714
LOWER IN pond0.250000
mississippi river0.250000
LOWER IN free floating0.250000
pond water0.200000
state of florida0.200000
free floating0.200000
state of minnesota0.166667
hunan province0.166667
LOWER IN fresh water0.166667
fresh water0.157895
LOWER IN adult0.111111
digestive system0.107143
LOWER IN water0.090909
river0.083333
fish0.076923
city0.055556
intestine0.050000
sediment0.043478
united states of america0.040000
water0.040000
research facility0.037037
skin0.037037
farm0.035714
china0.018868
feces0.008772
homo sapiens0.005525
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.625000
snake0.375000
feces0.375000
china0.375000
snake farm0.333333
farm0.333333
adula0.333333
hunan province0.333333
research facility0.291667
fresh water0.291667
state of florida0.208333
ictalurus punctatus0.166667
channel catfish0.166667
state of alabama0.166667
water0.166667
digestive system0.125000
intestine0.125000
spring water0.125000
river0.125000
mississippi river0.125000
aquatic biome0.125000
elaphe carinata0.083333
king ratsnake0.083333
naja atra0.083333
chinese cobra0.083333
ptyas mucosa0.083333
oriental ratsnake0.083333
deinagkistrodon acutus0.083333
pit viper0.083333
fishpond0.083333
frog0.083333
osteopilus septentrionalis0.083333
tadpole0.083333
LOWER IN adult0.083333
catfish0.041667
state of minnesota0.041667
fish0.041667
LOWER IN pond0.041667
LOWER IN water0.041667
LOWER IN fresh water0.041667
pond water0.041667
homo sapiens0.041667
city0.041667
LOWER IN amerindian0.041667
LOWER IN hunter gatherer0.041667
LOWER IN venezuela0.041667
location 30.041667
location 20.041667
location 40.041667
particle0.041667
free floating0.041667
sediment0.041667
freshwater sediment metagenome0.041667
pond0.041667
tilapia0.041667
skin0.041667
southern united states0.041667
aquatic snake0.041667
LOWER IN terrestrial snake0.041667
particles0.041667
LOWER IN free floating0.041667
Exp. ID User ID Description Date Region Flag Sequences
255amnoncommon catfish, digestive system, united states of america, state of minnesota, research facility, ictalurus punctatus, channel catfish2017-11-24v4No1 / 8
530amnondominant snake, feces, snake farm, farm, adula, hunan province, elaphe carinata, king ratsnake, china2019-07-21v4No1 / 10
530amnondominant snake, feces, snake farm, farm, adula, hunan province, naja atra, chinese cobra, china2019-07-21v4No1 / 13
530amnondominant snake, feces, snake farm, farm, adula, hunan province, ptyas mucosa, oriental ratsnake, china2019-07-21v4No1 / 14
481amnondominant united states of america, state of alabama, research facility, channel catfish, ictalurus punctatus, intestine2019-02-12v4No1 / 17
530amnondominant snake, deinagkistrodon acutus, pit viper, feces, snake farm, farm, adula, hunan province, china2019-07-21v4No1 / 28
530amnoncommon snake, feces, snake farm, farm, adula, hunan province, elaphe carinata, king ratsnake, china2019-07-21v4No1 / 63
530amnoncommon snake, feces, snake farm, farm, adula, hunan province, ptyas mucosa, oriental ratsnake, china2019-07-21v4No1 / 86
530amnoncommon snake, feces, snake farm, farm, adula, hunan province, naja atra, chinese cobra, china2019-07-21v4No1 / 90
481amnonhigher in channel catfish intestine compared to the growing pond water ( high in fish ictalurus punctatus channel catfish intestine compared to pond water fresh water in united states of america state of alabama research facility )2019-02-12v4No1 / 118
481amnoncommon united states of america, state of alabama, research facility, channel catfish, ictalurus punctatus, intestine2019-02-12v4No1 / 151
530amnoncommon snake, deinagkistrodon acutus, pit viper, feces, snake farm, farm, adula, hunan province, china2019-07-21v4No1 / 178
481amnoncommon united states of america, state of alabama, research facility, water, fresh water, pond water, fishpond2019-02-12v4No1 / 210
322amnon high in tadpole compared to adult in frog osteopilus septentrionalis united states of america state of florida research facility digestive system 2018-04-23v4No1 / 320
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-06v4No1 / 417
612amnoncommon state of florida, united states of america, spring water, water, fresh water, location 32020-04-22v4No1 / 420
612amnoncommon state of florida, united states of america, spring water, water, fresh water, location 22020-04-22v4No1 / 596
471amnon high in tadpole compared to adult in digestive system frog osteopilus septentrionalis research facility united states of america state of florida 2019-01-14v4No1 / 648
612amnoncommon state of florida, united states of america, spring water, water, fresh water, location 42020-04-22v4No1 / 655
103amnoncommon river, united states of america, mississippi river, fresh water, aquatic biome, particle2017-04-05v4No1 / 909
103amnoncommon river, united states of america, mississippi river, fresh water, aquatic biome, free floating2017-04-05v4No1 / 909
257amnoncommon in tilapia pond sediment (common sediment, freshwater sediment metagenome, pond, fishpond, tilapia, china)2017-11-26v4No1 / 1179
536amnon high in aquatic snake compared to terrestrial snake in snake skin united states of america southern united states 2019-07-28v4No1 / 1772
103amnonhigher in particle bound fraction compared to free floating bacteria in mississippi river ( high in particles compared to free floating in river united states of america mississippi river fresh water aquatic biome )2017-04-05v4No1 / 3559

Problems / suggestions? Please email info AT dbbact DOT org