Search result for sequence:
TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGTTTGTTAAGTCAGTGGTGAAAGTTTGCGGCTCAACCGTAAAATTGCCATTGAAACTGGCGAACTTGAGTACAGTAGAGGTAGGCGGAATTCGTGG
common ontology terms
term enrichment score
TermScore
snake0.521739
snake farm0.432432
adula0.432432
ictalurus punctatus0.296296
channel catfish0.296296
state of alabama0.275862
hunan province0.231884
aquatic biome0.222222
mississippi river0.181818
fishpond0.166667
osteopilus septentrionalis0.166667
elaphe carinata0.160000
king ratsnake0.160000
naja atra0.160000
chinese cobra0.160000
ptyas mucosa0.160000
oriental ratsnake0.160000
deinagkistrodon acutus0.160000
pit viper0.160000
tadpole0.148148
frog0.142857
fresh water0.140351
digestive system0.125000
state of florida0.117647
river0.105263
LOWER IN adult0.105263
catfish0.086957
LOWER IN amerindian0.086957
LOWER IN hunter gatherer0.086957
LOWER IN venezuela0.086957
freshwater sediment metagenome0.086957
pond0.086957
tilapia0.086957
southern united states0.086957
aquatic snake0.086957
LOWER IN terrestrial snake0.086957
particles0.086957
intestine0.083333
particle0.083333
LOWER IN pond0.080000
pond water0.080000
LOWER IN free floating0.080000
farm0.078049
state of minnesota0.076923
free floating0.076923
LOWER IN fresh water0.074074
research facility0.073394
united states of america0.070263
fish0.062500
LOWER IN water0.062500
city0.052632
sediment0.045455
skin0.043478
china0.041812
water0.029412
feces0.018721
homo sapiens0.010638
Fraction of dbbact annotations with this term covered by the query
TermScore
ictalurus punctatus0.666667
channel catfish0.666667
snake0.666667
fishpond0.666667
osteopilus septentrionalis0.666667
catfish0.500000
snake farm0.500000
adula0.500000
elaphe carinata0.500000
king ratsnake0.500000
naja atra0.500000
chinese cobra0.500000
ptyas mucosa0.500000
oriental ratsnake0.500000
state of alabama0.500000
deinagkistrodon acutus0.500000
pit viper0.500000
LOWER IN amerindian0.500000
LOWER IN hunter gatherer0.500000
LOWER IN venezuela0.500000
aquatic biome0.500000
freshwater sediment metagenome0.500000
pond0.500000
tilapia0.500000
southern united states0.500000
aquatic snake0.500000
LOWER IN terrestrial snake0.500000
particles0.500000
tadpole0.333333
particle0.333333
frog0.285714
LOWER IN pond0.250000
pond water0.250000
mississippi river0.250000
LOWER IN free floating0.250000
state of minnesota0.200000
free floating0.200000
hunan province0.166667
LOWER IN fresh water0.166667
state of florida0.153846
LOWER IN adult0.117647
digestive system0.111111
fresh water0.111111
fish0.090909
LOWER IN water0.090909
river0.083333
intestine0.058824
city0.058824
farm0.043478
sediment0.043478
research facility0.041237
skin0.040000
united states of america0.037433
china0.021978
water0.021277
feces0.009569
homo sapiens0.005988
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.571429
snake0.428571
feces0.428571
china0.428571
snake farm0.380952
farm0.380952
adula0.380952
hunan province0.380952
research facility0.333333
ictalurus punctatus0.190476
channel catfish0.190476
state of alabama0.190476
fresh water0.190476
digestive system0.142857
intestine0.142857
river0.142857
mississippi river0.142857
aquatic biome0.142857
elaphe carinata0.095238
king ratsnake0.095238
naja atra0.095238
chinese cobra0.095238
ptyas mucosa0.095238
oriental ratsnake0.095238
deinagkistrodon acutus0.095238
pit viper0.095238
fishpond0.095238
frog0.095238
osteopilus septentrionalis0.095238
state of florida0.095238
tadpole0.095238
LOWER IN adult0.095238
catfish0.047619
state of minnesota0.047619
fish0.047619
LOWER IN pond0.047619
LOWER IN water0.047619
LOWER IN fresh water0.047619
water0.047619
pond water0.047619
homo sapiens0.047619
city0.047619
LOWER IN amerindian0.047619
LOWER IN hunter gatherer0.047619
LOWER IN venezuela0.047619
particle0.047619
free floating0.047619
sediment0.047619
freshwater sediment metagenome0.047619
pond0.047619
tilapia0.047619
skin0.047619
southern united states0.047619
aquatic snake0.047619
LOWER IN terrestrial snake0.047619
particles0.047619
LOWER IN free floating0.047619
Exp. ID User ID Description Date Region Flag Sequences
255amnoncommon catfish, digestive system, united states of america, state of minnesota, research facility, ictalurus punctatus, channel catfish2017-11-24v4No1 / 8
530amnonhighfreq snake, feces, snake farm, farm, adula, hunan province, elaphe carinata, king ratsnake, china2019-07-21v4No1 / 10
530amnonhighfreq snake, feces, snake farm, farm, adula, hunan province, naja atra, chinese cobra, china2019-07-21v4No1 / 13
530amnonhighfreq snake, feces, snake farm, farm, adula, hunan province, ptyas mucosa, oriental ratsnake, china2019-07-21v4No1 / 14
481amnonhighfreq united states of america, state of alabama, research facility, channel catfish, ictalurus punctatus, intestine2019-02-12v4No1 / 17
530amnonhighfreq snake, deinagkistrodon acutus, pit viper, feces, snake farm, farm, adula, hunan province, china2019-07-21v4No1 / 28
530amnoncommon snake, feces, snake farm, farm, adula, hunan province, elaphe carinata, king ratsnake, china2019-07-21v4No1 / 63
530amnoncommon snake, feces, snake farm, farm, adula, hunan province, ptyas mucosa, oriental ratsnake, china2019-07-21v4No1 / 86
530amnoncommon snake, feces, snake farm, farm, adula, hunan province, naja atra, chinese cobra, china2019-07-21v4No1 / 90
481amnonhigher in channel catfish intestine compared to the growing pond water ( high in fish ictalurus punctatus channel catfish intestine compared to pond water fresh water in united states of america state of alabama research facility )2019-02-12v4No1 / 118
481amnoncommon united states of america, state of alabama, research facility, channel catfish, ictalurus punctatus, intestine2019-02-12v4No1 / 151
530amnoncommon snake, deinagkistrodon acutus, pit viper, feces, snake farm, farm, adula, hunan province, china2019-07-21v4No1 / 178
481amnoncommon united states of america, state of alabama, research facility, water, fresh water, pond water, fishpond2019-02-12v4No1 / 210
322amnon high in tadpole compared to adult in frog osteopilus septentrionalis united states of america state of florida research facility digestive system 2018-04-23v4No1 / 320
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-06v4No1 / 417
471amnon high in tadpole compared to adult in digestive system frog osteopilus septentrionalis research facility united states of america state of florida 2019-01-14v4No1 / 648
103amnoncommon river, united states of america, mississippi river, fresh water, aquatic biome, particle2017-04-05v4No1 / 909
103amnoncommon river, united states of america, mississippi river, fresh water, aquatic biome, free floating2017-04-05v4No1 / 909
257amnoncommon in tilapia pond sediment (common sediment, freshwater sediment metagenome, pond, fishpond, tilapia, china)2017-11-26v4No1 / 1179
536amnon high in aquatic snake compared to terrestrial snake in snake skin united states of america southern united states 2019-07-28v4No1 / 1772
103amnonhigher in particle bound fraction compared to free floating bacteria in mississippi river ( high in particles compared to free floating in river united states of america mississippi river fresh water aquatic biome )2017-04-05v4No1 / 3559

Problems / suggestions? Please email info AT dbbact DOT org