Search result for sequence:
TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGTGGTGATTTAAGTCAGCGGTGAAAGTTTGTGGCTCAACCATAAAATTGCCGTTGAAACTGGGTTACTTGAGTGTGTTTGAGGTAGGCGGAATGCGTGG
common ontology terms
term enrichment score
TermScore
homo sapiens0.618852
feces0.555600
adult0.422475
united states of america0.279807
china0.165318
control0.153212
child0.137694
city0.111554
state of colorado0.095541
canis lupus familiaris0.085227
caecum0.080429
rectum0.079840
dog0.077670
infant0.076190
kingdom of spain0.075235
biopsy0.071887
jiangsu province0.070000
obsolete_juvenile stage0.068796
kingdom of denmark0.060606
farm0.052174
biopsy site0.051903
msw0.051680
heterosexual0.051680
LOWER IN crohn's disease0.051282
denver0.051020
research facility0.050740
rural community0.050590
united kingdom0.049751
diarrhea0.049140
age0.047676
colon0.046296
female0.044248
metabolic syndrome0.041667
india0.041667
colombia0.041522
LOWER IN ulcerative colitis0.041451
africa0.041237
state of michigan0.040000
rat0.039604
israel0.039216
gallus gallus0.038835
chicken0.038835
commonwealth of virginia0.038835
australia0.037037
homosexual0.031496
gay0.031496
msm0.031496
state of oklahoma0.031496
LOWER IN rural community0.031414
nanchang city prefecture0.031250
age 19-240.031250
himalayas0.031250
oslo0.031250
age 30-400.031250
commonwealth of pennsylvania0.031250
south korea0.031250
LOWER IN child0.031250
LOWER IN duodenum0.031088
nepal0.030769
ileum0.030303
sus scrofa0.030075
pig0.030075
hospital0.029412
kingdom of norway0.028571
water0.023669
metabolic syndrome x0.021053
sea urchin0.021053
eagle harbor0.021053
pancreatitis0.021053
acute pancreatitis0.021053
age 200.021053
free range chicken0.021053
tharu0.021053
agrarian0.021053
age 17-290.021053
sigmoid colon0.021053
children0.021053
age one year0.021053
guangzhou city prefecture0.021053
central african republic0.021053
bangui0.021053
LOWER IN exocrine pancreatic insufficiency0.021053
thailand0.021053
hmong0.021053
atherosclerosis0.021053
age 8-120.021053
lima0.021053
shantytown0.021053
age 60-790.021053
age 30-500.021053
age >940.021053
LOWER IN age one month0.021053
age 13-140.021053
age 130.021053
LOWER IN small village0.021053
LOWER IN age 3-60.021053
LOWER IN age 30-500.021053
LOWER IN age 60-790.021053
age 50-60 years0.021053
nanning city prefecture0.021053
Fraction of dbbact annotations with this term covered by the query
TermScore
biopsy0.800000
biopsy site0.750000
metabolic syndrome0.666667
homosexual0.666667
gay0.666667
msm0.666667
msw0.666667
heterosexual0.666667
state of oklahoma0.666667
india0.666667
colombia0.600000
LOWER IN rural community0.600000
LOWER IN ulcerative colitis0.571429
rectum0.555556
LOWER IN crohn's disease0.555556
homo sapiens0.500000
metabolic syndrome x0.500000
resistant starch type 4 diet0.500000
sea urchin0.500000
eagle harbor0.500000
equine grass sickness0.500000
nanchang city prefecture0.500000
pancreatitis0.500000
acute pancreatitis0.500000
africa0.500000
LOWER IN stunted growth0.500000
age 200.500000
free range chicken0.500000
age 19-240.500000
himalayas0.500000
tharu0.500000
agrarian0.500000
LOWER IN chepang0.500000
LOWER IN forager0.500000
denver0.500000
age 17-290.500000
oslo0.500000
age 30-400.500000
commonwealth of pennsylvania0.500000
inflammatory bowel disease0.500000
kingdom of denmark0.500000
mild0.500000
LOWER IN severe0.500000
south korea0.500000
new york county0.500000
LOWER IN chronic fatigue syndrome0.500000
LOWER IN milk0.500000
sigmoid colon0.500000
children0.500000
LOWER IN endospore enriched fraction0.500000
LOWER IN lysis0.500000
age one year0.500000
daycare0.500000
age 1-5 years0.500000
stroke0.500000
guangzhou city prefecture0.500000
salmonella gastroenteritis0.500000
schizophrenia0.500000
native american0.500000
arapaho0.500000
cheyenne0.500000
iowa0.500000
central african republic0.500000
bangui0.500000
LOWER IN exocrine pancreatic insufficiency0.500000
LOWER IN enzyme supplementation0.500000
LOWER IN egypt0.500000
raji0.500000
thailand0.500000
hmong0.500000
azerbaijan0.500000
atherosclerosis0.500000
jiangsu province0.500000
age 8-120.500000
LOWER IN child0.500000
LOWER IN inflammatory bowel disease0.500000
aardvark0.500000
orycteropus afer0.500000
age 3-60.500000
lima0.500000
shantytown0.500000
age 60-790.500000
gangcha region0.500000
LOWER IN gannan tibetan autonomous prefecture0.500000
age 30-500.500000
hypopharynx0.500000
LOWER IN age 1 week0.500000
irritable bowel syndrome0.500000
age >940.500000
glasgow0.500000
LOWER IN age one month0.500000
cron diet0.500000
age 13-140.500000
LOWER IN karen0.500000
LOWER IN myanmar0.500000
age 130.500000
toronto0.500000
dnbs induced colitis0.500000
age<17 years0.500000
LOWER IN peru0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.838710
homo sapiens0.811828
united states of america0.419355
adult0.381720
china0.177419
control0.139785
child0.080645
city0.064516
state of colorado0.053763
caecum0.048387
canis lupus familiaris0.048387
kingdom of spain0.043011
research facility0.043011
rectum0.043011
infant0.043011
dog0.043011
biopsy0.037634
obsolete_juvenile stage0.037634
jiangsu province0.037634
farm0.032258
kingdom of denmark0.032258
diarrhea0.026882
united kingdom0.026882
rural community0.026882
denver0.026882
msw0.026882
heterosexual0.026882
biopsy site0.026882
colon0.026882
female0.026882
LOWER IN crohn's disease0.026882
age0.026882
metabolic syndrome0.021505
gallus gallus0.021505
chicken0.021505
israel0.021505
state of michigan0.021505
commonwealth of virginia0.021505
africa0.021505
colombia0.021505
australia0.021505
LOWER IN ulcerative colitis0.021505
rat0.021505
india0.021505
nanchang city prefecture0.016129
age 19-240.016129
himalayas0.016129
nepal0.016129
homosexual0.016129
gay0.016129
msm0.016129
hospital0.016129
kingdom of norway0.016129
oslo0.016129
age 30-400.016129
commonwealth of pennsylvania0.016129
south korea0.016129
state of oklahoma0.016129
LOWER IN duodenum0.016129
LOWER IN child0.016129
LOWER IN control0.016129
LOWER IN rural community0.016129
water0.016129
sus scrofa0.016129
pig0.016129
ileum0.016129
metabolic syndrome x0.010753
broiler chicken0.010753
age 6 weeks0.010753
sea urchin0.010753
lytechinus variegatus0.010753
eagle harbor0.010753
state of florida0.010753
systemic lupus erythematosus0.010753
pancreatitis0.010753
acute pancreatitis0.010753
state of arizona0.010753
age 200.010753
free range chicken0.010753
age 8 weeks0.010753
tharu0.010753
agrarian0.010753
state of ohio0.010753
age 17-290.010753
crohn's disease0.010753
ulcerative colitis0.010753
felis catus0.010753
cat0.010753
terminal ileum0.010753
sigmoid colon0.010753
children0.010753
age one year0.010753
guangzhou city prefecture0.010753
tibet autonomous region0.010753
tibetan plateau0.010753
central african republic0.010753
bangui0.010753
LOWER IN exocrine pancreatic insufficiency0.010753
italy0.010753
high bmi0.010753
Exp. ID User ID Description Date Region Flag Sequences
487amnonhigher in metabolic syndrome patients following resistant starch diet compared to control flour diet ( high in resistant starch type 4 diet starch diet diet compared to control diet in homo sapiens feces united states of america metabolic syndrome metabolic syndrome x )2019-02-24v4No1 / 6
495amnonhighfreq gallus gallus, chicken, caecum, broiler chicken, kingdom of spain, farm, age 6 weeks2019-03-03v4No1 / 6
207amnoncommon in people hospitalized with diarrhea (common homo sapiens, israel, feces, diarrhea)2017-10-05v4No1 / 7
351amnoncommon sea urchin, lytechinus variegatus, research facility, eagle harbor, state of florida, united states of america, digestive system2018-07-30v4No1 / 11
448amnonhighfreq equus caballus, horse, feces, united kingdom, farm, equine grass sickness, disease2019-01-08v4No1 / 16
289amnonhighfreq homo sapiens, feces, adult, united states of america, state of michigan2018-02-01v4No1 / 17
368amnonhighfreq feces, homo sapiens, commonwealth of virginia, united states of america, adult, systemic lupus erythematosus2018-09-03v4No1 / 17
428amnonhighfreq homo sapiens, adult, feces, china, nanchang city prefecture, pancreatitis, acute pancreatitis2018-12-09v4No1 / 17
207amnonhigh freq. in people hospitalized with diarrhea (highfreq homo sapiens, israel, feces, diarrhea)2017-10-05v4No1 / 18
215amnonhighfreq homo sapiens, feces, united states of america2017-10-23v4No1 / 18
368amnonhighfreq feces, homo sapiens, commonwealth of virginia, united states of america, adult, control2018-09-03v4No1 / 18
425amnonlower in kids with stunted growth compared to non-stunted ( high in control compared to stunted growth in homo sapiens feces africa child )2018-12-08v4No1 / 18
430amnonhighfreq homo sapiens, adult, united states of america, state of arizona, city, age 20, feces2018-12-15v4No1 / 18
495amnonhighfreq gallus gallus, chicken, caecum, kingdom of spain, farm, free range chicken, age 8 weeks2019-03-03v4No1 / 18
438amnonhighfreq homo sapiens, feces, china, age 19-242018-12-30v4No1 / 19
449amnonhighfreq homo sapiens, feces, colombia2019-01-09v4No1 / 19
477amnonhigher in agrarian tharu population compared to foraging chepang population ( high in tharu agrarian compared to chepang forager in homo sapiens feces adult himalayas nepal rural community )2019-01-28v4No1 / 19
516amnonhighfreq adult, state of ohio, united states of america, feces, homo sapiens2019-05-29v4No1 / 19
344amnonhigh freq. in feces of homosexual males (highfreq homo sapiens, feces, united states of america, state of colorado, denver, homosexual, gay, msm)2018-05-31v4No1 / 20
390amnonhighfreq homo sapiens, feces, diarrhea, australia, hospital2018-11-04v4No1 / 20
484amnonhighfreq feces, adult, age 17-29, united states of america, state of michigan, homo sapiens2019-02-13v4No1 / 20
122amnonhighfreq homo sapiens, feces, united kingdom2017-04-13v4No1 / 21
249amnonhighfreq homo sapiens, feces, united states of america2017-11-22v4No1 / 21
330amnonhighfreq homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-13v4No1 / 21
393amnonhighfreq homo sapiens, feces, united states of america, adult, state of colorado, city, msw, heterosexual2018-11-06v4No1 / 21
395amnonhighfreq homo sapiens, feces, united states of america, commonwealth of pennsylvania, child, inflammatory bowel disease, crohn's disease, ulcerative colitis2018-11-14v4No1 / 22
467amnonhighfreq homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 22
502amnonhighfreq homo sapiens, feces, adult, united states of america, control2019-03-12v4No1 / 22
132amnonhighfreq homo sapiens, feces, united states of america2017-04-16v4No1 / 23
344amnonhigh freq. in feces of heterosexuals (highfreq homo sapiens, feces, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 23
428amnoncommon homo sapiens, adult, feces, china, nanchang city prefecture, pancreatitis, acute pancreatitis2018-12-09v4No1 / 25
436amnonhighfreq felis catus, cat, feces, united states of america, state of colorado2018-12-25v4No1 / 25
410amnonlower in biopsies of severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to ulcerative colitis severe in homo sapiens child united states of america biopsy biopsy site rectum )2018-11-22v4No1 / 26
131amnonhighfreq homo sapiens, feces, south korea2017-04-16v4No1 / 27
12amnon high in control compared to chronic fatigue syndrome in homo sapiens feces new york county 2016-11-02v4No1 / 35
24amnondisappears on transition to cow milk ( high in breast milk compared to milk in homo sapiens feces infant )2016-12-01v4No1 / 35
51amnoncommon homo sapiens, biopsy site, biopsy, united states of america2017-01-19v4No1 / 38
390amnoncommon homo sapiens, feces, diarrhea, australia, hospital2018-11-04v4No1 / 38
19amnoncommon in biopsies of children (IBD study) (common rectum, terminal ileum, sigmoid colon, caecum, colon, biopsy, children, homo sapiens, united states of america)2016-11-14v4No1 / 40
401amnonlower in endospore enriched (lysis resistant) replicates ( high in control compared to endospore enriched fraction lysis in homo sapiens feces united states of america adult )2018-11-18v4No1 / 41
36amnoncommon homo sapiens, feces, sichuan province2016-12-06v4No1 / 44
273amnoncommon feces, homo sapiens, kingdom of denmark, infant, age one year2018-01-14v4No1 / 46
482amnoncommon homo sapiens, feces, colombia, medellin metropolitan area, child, daycare, age 1-5 years2019-02-12v4No1 / 47
333amnoncommon in stroke patient feces (common feces, homo sapiens, china, stroke, adult, guangzhou city prefecture)2018-05-15v4No1 / 53
292amnoncommon homo sapiens, china, adult, feces, crohn's disease2018-02-05v4No1 / 55
390amnoncommon homo sapiens, feces, diarrhea, australia, hospital, salmonella gastroenteritis2018-11-04v4No1 / 55
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, systemic lupus erythematosus2018-09-03v4No1 / 56
333amnoncommon in healthy controls feces (common homo sapiens, feces, china, guangzhou city prefecture, adult, control)2018-05-15v4No1 / 61
380amnoncommon tibet autonomous region, feces, homo sapiens, tibetan plateau, adult2018-10-03v4No1 / 63
502amnoncommon homo sapiens, feces, adult, united states of america, schizophrenia2019-03-12v4No1 / 63
242amnoncommon in native-americans (common homo sapiens, feces, united states of america, state of oklahoma, native american, arapaho, cheyenne)2017-11-14v4No1 / 65
51amnon high in control compared to hiv infection in homo sapiens feces united states of america 2017-01-19v4No1 / 69
72amnoncommon canis lupus familiaris, feces, united states of america, iowa2017-02-25v4No1 / 69
477amnoncommon homo sapiens, feces, adult, nepal, himalayas, rural community, tharu, agrarian2019-01-28v4No1 / 74
395amnoncommon homo sapiens, feces, united states of america, commonwealth of pennsylvania, control2018-11-14v4No1 / 75
484amnoncommon feces, united states of america, adult, state of michigan, age 17-29, homo sapiens2019-02-13v4No1 / 76
516amnoncommon adult, state of ohio, united states of america, feces, homo sapiens2019-05-29v4No1 / 77
301amnon high in colon rectum compared to duodenum ileum in canis lupus familiaris dog united states of america 2018-03-05v4No1 / 79
401amnoncommon homo sapiens, feces, united states of america, adult2018-11-18v4No1 / 79
404amnoncommon homo sapiens, feces, colombia, city, adult2018-11-20v4No1 / 79
425amnoncommon homo sapiens, feces, africa, child, central african republic, bangui2018-12-08v4No1 / 79
292amnoncommon homo sapiens, china, adult, feces, control2018-02-05v4No1 / 81
344amnoncommon in feces of heterosexuals (common homo sapiens, feces, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 82
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, control2018-09-03v4No1 / 82
502amnoncommon homo sapiens, feces, adult, united states of america, control2019-03-12v4No1 / 83
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msw, heterosexual2018-11-06v4No1 / 84
150amnonhigh in healthy dogs compared to EPI dogs recieving enzyme supplementation ( high in control compared to exocrine pancreatic insufficiency enzyme supplementation in canis lupus familiaris dog feces united states of america )2017-04-26v4No1 / 85
247amnoncommon homo sapiens, italy, feces, obesity, high bmi2017-11-21v4No1 / 85
249amnoncommon homo sapiens, feces, united states of america2017-11-22v4No1 / 86
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, control2018-11-06v4No1 / 86
344amnoncommon in feces of homosexual males (common homo sapiens, feces, united states of america, state of colorado, denver, homosexual, gay, msm)2018-05-31v4No1 / 87
430amnoncommon homo sapiens, adult, united states of america, state of arizona, city, age 20, feces2018-12-15v4No1 / 87
62amnon high in united states of america compared to egypt in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 88
477amnoncommon homo sapiens, feces, himalayas, nepal, rural community, raji2019-01-29v4No1 / 88
487amnoncommon homo sapiens, feces, united states of america, metabolic syndrome, metabolic syndrome x2019-02-24v4No1 / 88
293amnoncommon homo sapiens, feces, adult, united states of america, american diet2018-02-07v4No1 / 89
303amnoncommon homo sapiens, feces, germany, adult2018-03-12v4No1 / 93
428amnoncommon homo sapiens, adult, feces, china, nanchang city prefecture, control2018-12-09v4No1 / 93
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msm, gay, homosexual2018-11-06v4No1 / 94
488amnoncommon canis lupus familiaris, dog, feces, italy, control2019-02-25v4No1 / 94
400amnoncommon in feces of european american females (common homo sapiens, feces, united states of america, adult, female)2018-11-18v4No1 / 95
400amnoncommon in hmong (chinese) females from thailand (common homo sapiens, feces, adult, female, thailand, hmong, china)2018-11-18v4No1 / 95
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 97
409amnoncommon homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v4No1 / 97
455amnoncommon homo sapiens, adult, canada, atherosclerosis, saliva2019-01-10v4No1 / 100
438amnoncommon homo sapiens, feces, china, age 19-242018-12-30v4No1 / 101
477amnoncommon homo sapiens, feces, adult, united states of america2019-01-28v4No1 / 103
284amnoncommon homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 105
301amnoncommon canis lupus familiaris, dog, united states of america, colon2018-03-05v4No1 / 105
344amnonlower in gay (msm) individuals compared to heterosexual (msw) ( high in heterosexual msw compared to gay msm homosexual in homo sapiens feces united states of america state of colorado denver )2018-05-31v4No1 / 106
438amnoncommon homo sapiens, feces, china, jiangsu province, child, age 8-122018-12-30v4No1 / 106
215amnoncommon homo sapiens, feces, united states of america2017-10-23v4No1 / 107
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child inflammatory bowel disease crohn's disease ulcerative colitis in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 107
406amnoncommon feces, zoological garden, south africa, aardvark, orycteropus afer2018-11-21v4No1 / 107
399amnoncommon feces, united states of america, canis lupus familiaris, dog2018-11-16v4No1 / 108
409amnoncommon homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 108
436amnoncommon felis catus, cat, feces, united states of america, state of colorado2018-12-25v4No1 / 108
289amnoncommon homo sapiens, feces, adult, united states of america, state of michigan2018-02-01v4No1 / 109
438amnoncommon homo sapiens, feces, china, jiangsu province, child, age 3-62018-12-30v4No1 / 109
53amnoncommon homo sapiens, feces, lima, city, shantytown2017-01-21v4No1 / 110
276amnoncommon feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v4No1 / 110
438amnoncommon feces, homo sapiens, china, age 60-79, adult, jiangsu province2018-12-30v4No1 / 111
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 114
438amnoncommon feces, homo sapiens, china, jiangsu province, age 30-50, adult2018-12-30v4No1 / 115
301amnoncommon canis lupus familiaris, dog, united states of america, rectum2018-03-05v4No1 / 116
48amnonhigher in 3 months compared to 1 week in infant hypopharynx ( high in age age 3 months compared to age 1 week in homo sapiens kingdom of denmark hypopharynx infant )2017-01-19v4No1 / 117
239amnoncommon homo sapiens, feces, united states of america2017-11-08v4No1 / 117
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 118
410amnonlower in feces compared to rectal biopsies in children with treatment naive uc ( high in rectum biopsy biopsy site compared to feces in homo sapiens child united states of america ulcerative colitis )2018-11-22v4No1 / 118
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
438amnoncommon feces, homo sapiens, china, age >94, jiangsu province, adult2018-12-30v4No1 / 121
449amnoncommon homo sapiens, feces, colombia2019-01-09v4No1 / 124
73amnonhigh in healthy adult controls compared to children with Crohn's disease ( high in control adult compared to crohn's disease obsolete_juvenile stage child in glasgow feces homo sapiens )2017-02-26v4No1 / 125
150amnonhigh in healthy dogs compared to EPI dogs without treatment ( high in control compared to exocrine pancreatic insufficiency in canis lupus familiaris dog feces united states of america )2017-04-26v4No1 / 126
273amnon high in age age 1 week compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 127
131amnoncommon homo sapiens, feces, south korea2017-04-16v4No1 / 128
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-13v4No1 / 130
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
438amnoncommon homo sapiens, feces, china, jiangsu province, age 13-142018-12-30v4No1 / 134
400amnonhigher in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in hmong china compared to karen myanmar in homo sapiens feces thailand rural community )2018-11-18v4No1 / 135
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, finland2017-09-12v4No1 / 136
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 137
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 138
63amnonpositively correlated with bmi ( high in body mass index high bmi compared to low bmi in homo sapiens united states of america feces )2017-04-11v4No1 / 139
132amnoncommon homo sapiens, feces, united states of america2017-04-16v4No1 / 145
330amnon high in adult age 30-40 compared to infant age 1 year in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 145
358amnonhigher in dnbs induced colitis compared to controls in rat feces ( high in colitis dnbs induced colitis compared to control in rattus rat research facility wistar rat czech republic feces )2018-08-19v4No1 / 154
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 157
292amnon high in control compared to crohn's disease ulcerative colitis in homo sapiens china adult feces 2018-02-05v4No1 / 161
290amnoncommon homo sapiens, feces, china, adult, city2018-02-01v4No1 / 162
297amnoncommon homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 162
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
438amnonlower in kindergarten compared to primary and middle school kids ( high in age 8-12 age 13-14 compared to age 3-6 in homo sapiens feces china )2018-12-30v4No1 / 168
241amnonlower in babies from russia compared to estonia ( high in estonia compared to russia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 169
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 170
399amnon high in control compared to ulcerative colitis in feces united states of america homo sapiens 2018-11-16v4No1 / 180
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 183
495amnoncommon gallus gallus, chicken, caecum, kingdom of spain, farm, free range chicken, age 8 weeks2019-03-03v4No1 / 189
352amnon high in feces compared to small intestine duodenum in homo sapiens india new delhi 2018-07-30v4No1 / 190
312amnoncommon feces, homo sapiens, french republic, adult, spondylitis, spondyloarthritis2018-04-09v4No1 / 197
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
150amnoncommon canis lupus familiaris, dog, feces, united states of america2017-04-26v4No1 / 208
495amnoncommon gallus gallus, chicken, caecum, broiler chicken, kingdom of spain, farm, age 6 weeks2019-03-03v4No1 / 210
520amnonhigher in gastric cancer compared to paired normal tissue ( high in stomach neoplasm gastric carcinoma compared to control in adult stomach zhejiang province china homo sapiens )2019-06-26v3No1 / 214
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon homo sapiens, feces, china, adult, small village, rural community2018-02-01v4No1 / 218
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 227
331amnon high in dry season compared to wet season in feces monkey theropithecus gelada ethiopia 2018-05-13v4No1 / 232
53amnon high in shantytown lima compared to el salado small village in homo sapiens feces city 2017-01-21v4No1 / 237
438amnonhigher in students and soldiers age 19-24 compared to older adults ( high in age 19-24 soldiers compared to adult age 30-50 age 60-79 age >94 in homo sapiens feces china )2018-12-30v4No1 / 238
286amnoncommon in feces of individuals with kidney stones (common homo sapiens, feces, adult, age 50-60 years, china, nanning city prefecture, nephrolithiasis)2018-01-27v4No1 / 239
161amnoncommon in barn swallows in colorado (common hirundo rustica, feces, united states of america, colorado, barn swallow)2017-07-12v4No1 / 245
351amnoncommon sea urchin, lytechinus variegatus, coelomic fluid, research facility, eagle harbor, state of florida, united states of america2018-07-30v4No1 / 249
429amnoncommon rat, rattus norvegicus, dahl salt-sensitive, feces, israel, research facility, salt rich diet, salt2018-12-13v4No1 / 249
219amnoncommon in mother mice feces (common mus musculus, mouse, feces, c57bl/6, research facility, south korea, female)2017-10-24v4No1 / 250
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces india infant )2016-12-19v4No1 / 253
286amnoncommon in feces of individuals without kidney stones (common homo sapiens, feces, adult, age 50-60 years, china, nanning city prefecture, control)2018-01-27v4No1 / 281
477amnon high in united states of america compared to nepal himalayas rural community in homo sapiens feces adult 2019-01-28v4No1 / 295
510amnoncommon kingdom of spain, water, bilbao, estuary, estuary water, fresh water, salinity <5 ppt2019-03-20v4No1 / 317
299amnon high in cancer mouth neoplasm compared to control in saliva adult homo sapiens china 2018-02-27v4No1 / 319
429amnoncommon rat, rattus norvegicus, dahl salt-sensitive, feces, israel, research facility, control diet2018-12-13v4No1 / 327
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
400amnonlower in people from thailand compared to 2nd generation immigrants to usa ( high in united states of america compared to thailand rural community in homo sapiens feces )2018-11-18v4No1 / 343
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
160amnoncommon in river water upstream of WTP effluent in autumn in china (common river, china, water, autumn)2017-07-12v4No1 / 376
256amnoncommon sus scrofa, pig, united kingdom, duodenum, jejunum, ileum2017-11-26v4No1 / 380
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
186amnoncommon rattus, rat, sprague dawley, research facility, caecum, united states of america2017-08-23v4No1 / 407
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-06v4No1 / 417
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
111amnon high in rectum caecum ileum colon compared to rumen ruminant reticulum omasum in mongolian sheep china ovis aries 2017-04-09v4No1 / 464
160amnoncommon in wastewater treatment plant effluent in autumn in china (common china, autumn, wastewater treatment plant, effluent)2017-07-12v4No1 / 469
438amnonhigher in centenarians compared to adults ( high in age >94 compared to age 30-50 age 60-79 in homo sapiens feces china )2018-12-30v4No1 / 474
438amnon high in age 30-50 age 60-79 adult compared to age 3-6 age 8-12 child in homo sapiens feces china 2018-12-30v4No1 / 486
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
425amnon high in central african republic bangui compared to madagascar antananarivo in homo sapiens feces africa child 2018-12-08v4No1 / 564
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 567
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in kingdom of spain water bilbao estuary estuary water 2019-03-20v4No1 / 592
264amnoncommon oryctolagus cuniculus, rex rabbit, china, caecum, research facility, jiangsu province2017-12-11v4No1 / 622
521amnonlower in pre-weaned pigs compared to weaned older timepoints ( high in corn and soybean diet age 4-7 weeks weaned compared to age 2-4 weeks suckling preweaned in jiangxi province farm china feces sus scrofa pig )2019-07-02v3No1 / 681
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 836

Problems / suggestions? Please email info AT dbbact DOT org