Search result for sequence:
TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGTGGTTTCTTAAGTCAGCGGTGAAAGTTTGTGGCTTAACCATAAAATTGCCATTGATACTGGGAGACTTGAGTATGTTTGAGGTAGGCGGAATGCGTGG
common ontology terms
term enrichment score
TermScore
greylag goose0.333333
goose0.250000
left colon0.250000
anser0.222222
LOWER IN heterosexual0.222222
LOWER IN msw0.222222
amsterdam0.222222
right colon0.222222
homosexual0.200000
msm0.200000
LOWER IN jejunum0.181818
belgium0.166667
kingdom of the netherlands0.166667
qinghai province0.153846
LOWER IN duodenum0.117647
crohn's disease0.111111
sus scrofa0.100000
pig0.100000
LOWER IN ileum0.090909
united kingdom0.071429
caecum0.043478
male0.041667
feces0.017192
homo sapiens0.013652
china0.010582
adult0.010526
LOWER IN control0.010309
Fraction of dbbact annotations with this term covered by the query
TermScore
greylag goose0.500000
goose0.250000
left colon0.250000
anser0.200000
LOWER IN heterosexual0.200000
LOWER IN msw0.200000
amsterdam0.200000
right colon0.200000
homosexual0.166667
msm0.166667
LOWER IN jejunum0.142857
belgium0.125000
kingdom of the netherlands0.125000
qinghai province0.111111
LOWER IN duodenum0.076923
crohn's disease0.071429
sus scrofa0.062500
pig0.062500
LOWER IN ileum0.055556
united kingdom0.041667
caecum0.023810
male0.022727
feces0.008696
homo sapiens0.006920
china0.005405
adult0.005376
LOWER IN control0.005263
Fraction of annotations for the query sequences containing the term
TermScore
feces0.750000
homo sapiens0.500000
crohn's disease0.250000
LOWER IN control0.250000
belgium0.250000
qinghai province0.250000
anser0.250000
goose0.250000
greylag goose0.250000
china0.250000
homosexual0.250000
msm0.250000
LOWER IN heterosexual0.250000
LOWER IN msw0.250000
adult0.250000
male0.250000
kingdom of the netherlands0.250000
amsterdam0.250000
caecum0.250000
left colon0.250000
right colon0.250000
LOWER IN duodenum0.250000
LOWER IN jejunum0.250000
LOWER IN ileum0.250000
sus scrofa0.250000
pig0.250000
united kingdom0.250000

Problems / suggestions? Please email info AT dbbact DOT org