Search result for sequence:
TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGTGGTTTCTTAAGTCAGCGGTGAAAGTTTGTGGCTTAACCATAAAATTGCCATTGATACTGGGAGACTTGAGTATGTTTGAGGTAGGCGGAATGCGTGG
common ontology terms
term enrichment score
TermScore
greylag goose0.333333
china0.333333
goose0.285714
anser0.250000
amsterdam0.250000
left colon0.250000
LOWER IN heterosexual0.222222
LOWER IN msw0.222222
right colon0.222222
LOWER IN jejunum0.222222
homosexual0.200000
msm0.200000
kingdom of the netherlands0.200000
qinghai province0.181818
belgium0.166667
LOWER IN duodenum0.133333
crohn's disease0.125000
LOWER IN ileum0.100000
sus scrofa0.100000
pig0.100000
united kingdom0.074074
male0.054054
caecum0.050000
feces0.018868
homo sapiens0.014545
adult0.011299
LOWER IN control0.010582
Fraction of dbbact annotations with this term covered by the query
TermScore
greylag goose0.500000
china0.500000
goose0.333333
anser0.250000
amsterdam0.250000
left colon0.250000
LOWER IN heterosexual0.200000
LOWER IN msw0.200000
right colon0.200000
LOWER IN jejunum0.200000
homosexual0.166667
msm0.166667
kingdom of the netherlands0.166667
qinghai province0.142857
belgium0.125000
LOWER IN duodenum0.090909
crohn's disease0.083333
LOWER IN ileum0.062500
sus scrofa0.062500
pig0.062500
united kingdom0.043478
male0.030303
caecum0.027778
feces0.009554
homo sapiens0.007380
adult0.005780
LOWER IN control0.005405
Fraction of annotations for the query sequences containing the term
TermScore
feces0.750000
homo sapiens0.500000
crohn's disease0.250000
LOWER IN control0.250000
belgium0.250000
qinghai province0.250000
anser0.250000
goose0.250000
greylag goose0.250000
china0.250000
homosexual0.250000
msm0.250000
LOWER IN heterosexual0.250000
LOWER IN msw0.250000
adult0.250000
male0.250000
kingdom of the netherlands0.250000
amsterdam0.250000
caecum0.250000
left colon0.250000
right colon0.250000
LOWER IN duodenum0.250000
LOWER IN jejunum0.250000
LOWER IN ileum0.250000
sus scrofa0.250000
pig0.250000
united kingdom0.250000

Problems / suggestions? Please email info AT dbbact DOT org