Search result for sequence:
TACGGAGGATTCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGTTTGATAAGTTAGAGGTGAAATCCCGGGGCTTAACTCCGGAACTGCCTCTAATACTGTTAGACTAGAGAGTAGTTGCGGTAGGCGGAATGTATGG
common ontology terms
term enrichment score
TermScore
homo sapiens0.649565
feces0.530142
adult0.495630
united states of america0.249377
control0.150823
child0.148649
china0.135227
city0.123894
infant0.100000
obsolete_juvenile stage0.097561
jiangsu province0.090909
female0.087591
kingdom of denmark0.083333
age0.080645
age 50-60 years0.059701
nanning city prefecture0.059701
guangzhou city prefecture0.059701
india0.059701
LOWER IN crohn's disease0.059259
diarrhea0.059113
kingdom of norway0.056338
kingdom of spain0.055556
heterosexual0.045977
msw0.045977
LOWER IN rural community0.045802
age >940.045455
age one year0.045455
oslo0.045455
age 30-400.045455
stroke0.045455
commonwealth of pennsylvania0.045455
state of michigan0.045113
LOWER IN ulcerative colitis0.045113
rural community0.045113
biopsy0.044944
state of colorado0.044444
finland0.043956
commonwealth of virginia0.042553
united kingdom0.042553
age 19-240.030769
new delhi0.030769
toronto0.030769
age 130.030769
LOWER IN small village0.030769
LOWER IN age < 1 year0.030769
LOWER IN age 30-500.030769
LOWER IN age 60-790.030769
bilbao0.030769
estuary0.030769
estuary water0.030769
salinity <5 ppt0.030769
LOWER IN infant0.030534
metabolic syndrome0.030303
state of oklahoma0.030303
south korea0.029851
biopsy site0.029851
small intestine0.029851
juvenile organism0.029851
rectum0.029630
LOWER IN male0.029197
hospital0.028986
duodenum0.028169
LOWER IN adult0.028169
state of california0.027397
australia0.025641
LOWER IN control0.025316
fresh water0.025316
water0.018692
age 30-50 years0.015625
LOWER IN age 50-80 years0.015625
LOWER IN endospore enriched fraction0.015625
LOWER IN lysis0.015625
myrmecophaga tridactyla0.015625
giant anteater0.015625
salmonella gastroenteritis0.015625
schizophrenia0.015625
equine grass sickness0.015625
age 17-290.015625
denver0.015625
LOWER IN nephrolithiasis0.015625
state of arizona0.015625
age 200.015625
LOWER IN egypt0.015625
nanchang city prefecture0.015625
azerbaijan0.015625
age 8-120.015625
age one month0.015625
LOWER IN age one week0.015625
LOWER IN inflammatory bowel disease0.015625
age 3-60.015625
mild0.015625
LOWER IN severe0.015625
age 60-790.015625
gangcha region0.015625
LOWER IN gannan tibetan autonomous prefecture0.015625
age 30-500.015625
irritable bowel syndrome0.015625
cron diet0.015625
age 13-140.015625
thailand0.015625
Fraction of dbbact annotations with this term covered by the query
TermScore
heterosexual0.666667
msw0.666667
LOWER IN rural community0.600000
adult0.507692
age >940.500000
age one year0.500000
oslo0.500000
age 30-400.500000
age 50-60 years0.500000
nanning city prefecture0.500000
guangzhou city prefecture0.500000
stroke0.500000
commonwealth of pennsylvania0.500000
age 30-50 years0.500000
LOWER IN age 50-80 years0.500000
LOWER IN endospore enriched fraction0.500000
LOWER IN lysis0.500000
myrmecophaga tridactyla0.500000
giant anteater0.500000
salmonella gastroenteritis0.500000
schizophrenia0.500000
equine grass sickness0.500000
age 17-290.500000
denver0.500000
LOWER IN nephrolithiasis0.500000
state of arizona0.500000
age 200.500000
child0.500000
LOWER IN egypt0.500000
nanchang city prefecture0.500000
azerbaijan0.500000
age 19-240.500000
age 8-120.500000
age one month0.500000
LOWER IN age one week0.500000
LOWER IN inflammatory bowel disease0.500000
age 3-60.500000
mild0.500000
LOWER IN severe0.500000
age 60-790.500000
gangcha region0.500000
LOWER IN gannan tibetan autonomous prefecture0.500000
age 30-500.500000
irritable bowel syndrome0.500000
india0.500000
new delhi0.500000
toronto0.500000
cron diet0.500000
age 13-140.500000
thailand0.500000
hmong0.500000
LOWER IN karen0.500000
LOWER IN myanmar0.500000
age 130.500000
LOWER IN india0.500000
glasgow0.500000
age<17 years0.500000
LOWER IN peru0.500000
LOWER IN small village0.500000
LOWER IN tunapuco0.500000
estonia0.500000
LOWER IN russia0.500000
age 1-3 years0.500000
LOWER IN age < 1 year0.500000
spondylitis0.500000
spondyloarthritis0.500000
atherosclerosis0.500000
shantytown0.500000
lima0.500000
LOWER IN el salado0.500000
LOWER IN age 30-500.500000
LOWER IN age 60-790.500000
LOWER IN age >940.500000
soldiers0.500000
nephrolithiasis0.500000
age 1-20.500000
LOWER IN age 0-10.500000
LOWER IN nepal0.500000
LOWER IN himalayas0.500000
central america0.500000
alouatta palliata0.500000
mantled howler monkey0.500000
dry forest0.500000
LOWER IN tropical moist broadleaf forest biome0.500000
bilbao0.500000
estuary0.500000
estuary water0.500000
salinity <5 ppt0.500000
LOWER IN thailand0.500000
LOWER IN amerindian0.500000
LOWER IN hunter gatherer0.500000
LOWER IN venezuela0.500000
terminal ileum0.500000
sigmoid colon0.500000
children0.500000
LOWER IN age one month0.500000
africa0.500000
central african republic0.500000
LOWER IN madagascar0.500000
bangui0.500000
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.952381
feces0.928571
adult0.484127
united states of america0.396825
china0.198413
control0.174603
child0.087302
city0.071429
infant0.063492
jiangsu province0.055556
female0.055556
obsolete_juvenile stage0.055556
kingdom of denmark0.047619
age0.047619
diarrhea0.031746
kingdom of norway0.031746
age 50-60 years0.031746
nanning city prefecture0.031746
guangzhou city prefecture0.031746
LOWER IN crohn's disease0.031746
kingdom of spain0.031746
india0.031746
age >940.023810
commonwealth of virginia0.023810
age one year0.023810
united kingdom0.023810
oslo0.023810
age 30-400.023810
state of michigan0.023810
stroke0.023810
commonwealth of pennsylvania0.023810
LOWER IN control0.023810
state of colorado0.023810
heterosexual0.023810
msw0.023810
biopsy0.023810
LOWER IN ulcerative colitis0.023810
rural community0.023810
finland0.023810
LOWER IN rural community0.023810
metabolic syndrome0.015873
australia0.015873
hospital0.015873
south korea0.015873
state of california0.015873
LOWER IN male0.015873
biopsy site0.015873
age 19-240.015873
state of oklahoma0.015873
new delhi0.015873
duodenum0.015873
small intestine0.015873
toronto0.015873
LOWER IN adult0.015873
age 130.015873
juvenile organism0.015873
LOWER IN infant0.015873
LOWER IN small village0.015873
LOWER IN age < 1 year0.015873
rectum0.015873
LOWER IN age 30-500.015873
LOWER IN age 60-790.015873
water0.015873
bilbao0.015873
estuary0.015873
estuary water0.015873
fresh water0.015873
salinity <5 ppt0.015873
israel0.007937
clostridium difficile intestinal infectious disease0.007937
age 30-50 years0.007937
LOWER IN age 50-80 years0.007937
LOWER IN systemic lupus erythematosus0.007937
LOWER IN endospore enriched fraction0.007937
LOWER IN lysis0.007937
zoological garden0.007937
myrmecophaga tridactyla0.007937
giant anteater0.007937
salmonella gastroenteritis0.007937
schizophrenia0.007937
LOWER IN hiv infection0.007937
equus caballus0.007937
horse0.007937
farm0.007937
equine grass sickness0.007937
disease0.007937
age 17-290.007937
state of ohio0.007937
denver0.007937
LOWER IN nephrolithiasis0.007937
italy0.007937
obesity0.007937
high bmi0.007937
state of arizona0.007937
age 200.007937
LOWER IN egypt0.007937
colombia0.007937
american diet0.007937
nanchang city prefecture0.007937
low bmi0.007937
Exp. ID User ID Description Date Sequences
438amnonhighfreq feces, homo sapiens, china, age >94, adult, jiangsu province2018-12-301 / 14
400amnonhigh freq. in feces of european american females (highfreq homo sapiens, feces, united states of america, adult, female)2018-11-181 / 17
207amnonhigh freq. in people hospitalized with diarrhea (highfreq homo sapiens, israel, feces, diarrhea)2017-10-051 / 18
215amnonhighfreq homo sapiens, feces, united states of america2017-10-231 / 18
368amnonhighfreq feces, homo sapiens, commonwealth of virginia, united states of america, adult, control2018-09-031 / 18
477amnonhighfreq homo sapiens, feces, adult, united states of america2019-01-281 / 19
273amnonhighfreq feces, homo sapiens, kingdom of denmark, infant, age one year2018-01-141 / 20
122amnonhighfreq homo sapiens, feces, united kingdom2017-04-131 / 21
330amnonhighfreq homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-131 / 21
94amnonhighfreq homo sapiens, clostridium difficile intestinal infectious disease, feces, state of michigan, diarrhea2017-03-121 / 22
286amnonhigh freq. in feces of individuals without kidney stones (highfreq homo sapiens, feces, adult, age 50-60 years, china, nanning city prefecture, control)2018-01-271 / 22
467amnonhighfreq homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-141 / 22
333amnonhigh freq. in stroke patient feces (highfreq homo sapiens, feces, china, guangzhou city prefecture, adult, stroke)2018-05-151 / 22
395amnonhighfreq homo sapiens, feces, united states of america, commonwealth of pennsylvania, control2018-11-141 / 24
333amnonhigher in stroke patients compared to healthy controls ( high in stroke compared to control in homo sapiens feces china guangzhou city prefecture adult )2018-05-151 / 30
390amnoncommon homo sapiens, feces, diarrhea, australia, hospital2018-11-041 / 38
131amnonnegatively correlated with age (30-80 years) ( high in age age 30-50 years compared to age 50-80 years in homo sapiens feces south korea )2017-04-161 / 39
368amnon high in control compared to systemic lupus erythematosus in feces homo sapiens commonwealth of virginia united states of america adult 2018-09-031 / 39
401amnonlower in endospore enriched (lysis resistant) replicates ( high in control compared to endospore enriched fraction lysis in homo sapiens feces united states of america adult )2018-11-181 / 41
406amnoncommon feces, zoological garden, united states of america, myrmecophaga tridactyla, giant anteater2018-11-211 / 44
273amnoncommon feces, homo sapiens, kingdom of denmark, infant, age one year2018-01-141 / 46
333amnoncommon in stroke patient feces (common feces, homo sapiens, china, stroke, adult, guangzhou city prefecture)2018-05-151 / 53
390amnoncommon homo sapiens, feces, diarrhea, australia, hospital, salmonella gastroenteritis2018-11-041 / 55
333amnoncommon in healthy controls feces (common homo sapiens, feces, china, guangzhou city prefecture, adult, control)2018-05-151 / 61
502amnoncommon homo sapiens, feces, adult, united states of america, schizophrenia2019-03-121 / 63
22amnon high in control compared to hiv infection in united states of america feces homo sapiens 2016-11-281 / 70
448amnon high in equine grass sickness disease compared to control in equus caballus horse feces united kingdom farm 2019-01-081 / 72
395amnoncommon homo sapiens, feces, united states of america, commonwealth of pennsylvania, control2018-11-141 / 75
74amnoncommon united states of america, feces, homo sapiens2017-02-271 / 76
484amnoncommon feces, united states of america, adult, state of michigan, age 17-29, homo sapiens2019-02-131 / 76
516amnoncommon adult, state of ohio, united states of america, feces, homo sapiens2019-05-291 / 77
401amnoncommon homo sapiens, feces, united states of america, adult2018-11-181 / 79
292amnoncommon homo sapiens, china, adult, feces, control2018-02-051 / 81
344amnoncommon in feces of heterosexuals (common homo sapiens, feces, united states of america, state of colorado, denver, heterosexual, msw)2018-05-311 / 82
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, control2018-09-031 / 82
286amnonlower in feces of individuals with kidney stones ( high in control compared to nephrolithiasis in homo sapiens feces adult age 50-60 years china nanning city prefecture )2018-01-271 / 83
502amnoncommon homo sapiens, feces, adult, united states of america, control2019-03-121 / 83
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msw, heterosexual2018-11-061 / 84
247amnoncommon homo sapiens, italy, feces, obesity, high bmi2017-11-211 / 85
249amnoncommon homo sapiens, feces, united states of america2017-11-221 / 86
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, control2018-11-061 / 86
430amnoncommon homo sapiens, adult, united states of america, state of arizona, city, age 20, feces2018-12-151 / 87
62amnon high in united states of america compared to egypt in homo sapiens feces obsolete_juvenile stage child 2017-02-131 / 88
404amnon high in female compared to male in homo sapiens feces adult colombia city 2018-11-201 / 88
293amnoncommon homo sapiens, feces, adult, united states of america, american diet2018-02-071 / 89
428amnoncommon homo sapiens, adult, feces, china, nanchang city prefecture, control2018-12-091 / 93
400amnoncommon in feces of european american females (common homo sapiens, feces, united states of america, adult, female)2018-11-181 / 95
293amnonhigher in lean participants in human feces ( high in low bmi compared to high bmi in united states of america feces adult homo sapiens )2018-02-071 / 96
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-301 / 97
409amnoncommon homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-221 / 97
438amnoncommon homo sapiens, feces, china, age 19-242018-12-301 / 101
477amnoncommon homo sapiens, feces, adult, united states of america2019-01-281 / 103
284amnoncommon homo sapiens, adult, female, feces, state of california2018-01-271 / 105
438amnoncommon homo sapiens, feces, china, jiangsu province, child, age 8-122018-12-301 / 106
215amnoncommon homo sapiens, feces, united states of america2017-10-231 / 107
273amnon high in age age one month compared to age one week in feces homo sapiens kingdom of denmark infant 2018-01-141 / 107
393amnon high in heterosexual msw compared to gay homosexual msm in homo sapiens feces united states of america adult state of colorado city 2018-11-061 / 107
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child inflammatory bowel disease crohn's disease ulcerative colitis in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-131 / 107
398amnoncommon in feces of healthy adults from belgium (common homo sapiens, feces, belgium, adult, control)2018-11-151 / 107
409amnoncommon homo sapiens, united states of america, feces, adult2018-11-221 / 108
289amnoncommon homo sapiens, feces, adult, united states of america, state of michigan2018-02-011 / 109
438amnoncommon homo sapiens, feces, china, jiangsu province, child, age 3-62018-12-301 / 109
276amnoncommon feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-221 / 110
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to ulcerative colitis severe in homo sapiens child united states of america feces )2018-11-221 / 110
438amnoncommon feces, homo sapiens, china, age 60-79, adult, jiangsu province2018-12-301 / 111
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-031 / 114
438amnoncommon feces, homo sapiens, china, jiangsu province, age 30-50, adult2018-12-301 / 115
239amnoncommon homo sapiens, feces, united states of america2017-11-081 / 117
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-221 / 118
212amnoncommon mouse, mus musculus, feces, research facility, united states of america, lean body mass, control2017-10-221 / 120
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-091 / 120
352amnoncommon in duodenal biopsies (common homo sapiens, india, new delhi, duodenum, small intestine)2018-07-301 / 121
438amnoncommon feces, homo sapiens, china, age >94, jiangsu province, adult2018-12-301 / 121
10amnonnegatively correlated with age (6-35) ( high in child compared to adult in homo sapiens feces toronto )2016-10-271 / 125
131amnoncommon homo sapiens, feces, south korea2017-04-161 / 128
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-131 / 130
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-071 / 134
438amnoncommon homo sapiens, feces, china, jiangsu province, age 13-142018-12-301 / 134
400amnonhigher in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in hmong china compared to karen myanmar in homo sapiens feces thailand rural community )2018-11-181 / 135
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, finland2017-09-121 / 136
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-091 / 137
10amnoncommon homo sapiens, feces, toronto2016-10-271 / 138
197amnon high in finland compared to india in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-121 / 138
132amnoncommon homo sapiens, feces, united states of america2017-04-161 / 145
330amnon high in adult age 30-40 compared to infant age 1 year in homo sapiens feces kingdom of norway oslo 2018-05-131 / 145
73amnoncommon homo sapiens, feces, adult, glasgow2017-02-261 / 150
122amnoncommon homo sapiens, feces, united kingdom2017-04-131 / 157
292amnon high in control compared to crohn's disease ulcerative colitis in homo sapiens china adult feces 2018-02-051 / 161
290amnoncommon homo sapiens, feces, china, adult, city2018-02-011 / 162
297amnoncommon homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-121 / 162
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-221 / 168
194amnon high in feces compared to colon ileum in homo sapiens kingdom of norway 2017-09-071 / 169
241amnonlower in babies from russia compared to estonia ( high in estonia compared to russia in homo sapiens feces infant age < 3 years )2017-11-131 / 169
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in homo sapiens feces infant )2017-11-131 / 173
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-181 / 183
312amnoncommon feces, homo sapiens, french republic, adult, spondylitis, spondyloarthritis2018-04-091 / 197
6amnoncommon urine, female, homo sapiens, pregnancy, state of tennessee2016-10-131 / 201
120amnoncommon homo sapiens, feces, brazil2017-04-121 / 208
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-101 / 216
290amnoncommon homo sapiens, feces, china, adult, small village, rural community2018-02-011 / 218
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-071 / 227
53amnon high in shantytown lima compared to el salado small village in homo sapiens feces city 2017-01-211 / 237
438amnonhigher in students and soldiers age 19-24 compared to older adults ( high in age 19-24 soldiers compared to adult age 30-50 age 60-79 age >94 in homo sapiens feces china )2018-12-301 / 238
286amnoncommon in feces of individuals with kidney stones (common homo sapiens, feces, adult, age 50-60 years, china, nanning city prefecture, nephrolithiasis)2018-01-271 / 239
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces india infant )2016-12-191 / 253
286amnoncommon in feces of individuals without kidney stones (common homo sapiens, feces, adult, age 50-60 years, china, nanning city prefecture, control)2018-01-271 / 281
477amnon high in united states of america compared to nepal himalayas rural community in homo sapiens feces adult 2019-01-281 / 295
80amnon high in dry forest compared to tropical moist broadleaf forest biome in feces woodland central america alouatta palliata mantled howler monkey 2017-03-031 / 314
510amnoncommon kingdom of spain, water, bilbao, estuary, estuary water, fresh water, salinity <5 ppt2019-03-201 / 317
299amnon high in cancer mouth neoplasm compared to control in saliva adult homo sapiens china 2018-02-271 / 319
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-141 / 328
400amnonlower in people from thailand compared to 2nd generation immigrants to usa ( high in united states of america compared to thailand rural community in homo sapiens feces )2018-11-181 / 343
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-131 / 373
63amnon high in female compared to male in homo sapiens feces united states of america 2017-12-041 / 384
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-161 / 390
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-061 / 417
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-131 / 422
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-241 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-141 / 459
438amnonhigher in centenarians compared to adults ( high in age >94 compared to age 30-50 age 60-79 in homo sapiens feces china )2018-12-301 / 474
352amnon high in small intestine duodenum compared to feces in homo sapiens india new delhi 2018-07-301 / 545
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-141 / 557
425amnon high in central african republic bangui compared to madagascar antananarivo in homo sapiens feces africa child 2018-12-081 / 564
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in homo sapiens feces infant finland )2017-11-121 / 567
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in kingdom of spain water bilbao estuary estuary water 2019-03-201 / 592
517amnon high in feces compared to mouth mucosa mouth in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-291 / 752

Problems / suggestions? Please email info AT dbbact DOT org