Search result for sequence:
TACGGAGGATTCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGTTTGATAAGTTAGAGGTGAAATCCCGGGGCTTAACTCCGGAACTGCCTCTAATACTGTTAGACTAGAGAGTAGTTGCGGTAGGCGGAATGTATGG
common ontology terms
term enrichment score
TermScore
homo sapiens0.589361
feces0.508792
adult0.450807
united states of america0.251893
control0.160071
china0.136005
child0.123163
city0.105793
female0.102171
infant0.086486
obsolete_juvenile stage0.085106
jiangsu province0.074074
kingdom of denmark0.071429
age0.070671
heterosexual0.064378
msw0.064378
age 50-60 years0.051613
nanning city prefecture0.051613
LOWER IN crohn's disease0.051282
diarrhea0.051173
india0.051173
guangzhou city prefecture0.050314
rectum0.049896
kingdom of norway0.049080
kingdom of spain0.046243
parkinson's disease0.040000
age >940.039216
age one year0.039216
oslo0.039216
age 30-400.039216
stroke0.039216
LOWER IN rural community0.039216
state of michigan0.038961
LOWER IN ulcerative colitis0.038961
age 50-80 years0.038462
amsterdam0.038462
biopsy0.038462
rural community0.038462
state of colorado0.038095
finland0.038095
kingdom of the netherlands0.037736
pregnancy0.037736
united kingdom0.037383
commonwealth of virginia0.037037
commonwealth of pennsylvania0.037037
israel0.036036
germany0.032258
LOWER IN male0.026667
urocyon littoralis catalinae0.026490
santa catalina island fox0.026490
santa catalina island0.026490
urocyon littoralis0.026490
perianal skin0.026490
new delhi0.026490
toronto0.026490
age 130.026490
LOWER IN small village0.026490
LOWER IN age 30-500.026490
LOWER IN age 60-790.026490
estuary0.026490
estuary water0.026490
salinity <5 ppt0.026490
bilbao0.026490
LOWER IN homosexual0.026316
LOWER IN msm0.026316
LOWER IN infant0.026316
LOWER IN age < 1 year0.026316
metabolic syndrome0.026144
age 19-240.026144
state of oklahoma0.026144
LOWER IN hiv infection0.025806
biopsy site0.025806
small intestine0.025806
juvenile organism0.025806
male0.025641
south korea0.025478
hospital0.025157
duodenum0.024242
LOWER IN adult0.024242
state of california0.024096
farm0.022857
australia0.022099
wild0.022099
fresh water0.021622
LOWER IN control0.020906
mouse0.020101
mus musculus0.019417
water0.016194
research facility0.015686
age 30-50 years0.013423
LOWER IN age 50-80 years0.013423
LOWER IN endospore enriched fraction0.013423
LOWER IN lysis0.013423
myrmecophaga tridactyla0.013423
giant anteater0.013423
salmonella gastroenteritis0.013423
rectal swab0.013423
schizophrenia0.013423
equine grass sickness0.013423
age 17-290.013423
Fraction of dbbact annotations with this term covered by the query
TermScore
parkinson's disease1.000000
LOWER IN male0.666667
heterosexual0.600000
msw0.600000
age >940.500000
age one year0.500000
oslo0.500000
age 30-400.500000
age 50-60 years0.500000
nanning city prefecture0.500000
stroke0.500000
age 30-50 years0.500000
LOWER IN age 50-80 years0.500000
LOWER IN endospore enriched fraction0.500000
LOWER IN lysis0.500000
myrmecophaga tridactyla0.500000
giant anteater0.500000
salmonella gastroenteritis0.500000
rectal swab0.500000
schizophrenia0.500000
equine grass sickness0.500000
age 17-290.500000
high fat diet + inulin0.500000
denver0.500000
LOWER IN nephrolithiasis0.500000
type 2 diabetes mellitus0.500000
age 200.500000
LOWER IN egypt0.500000
urocyon littoralis catalinae0.500000
santa catalina island fox0.500000
santa catalina island0.500000
urocyon littoralis0.500000
perianal skin0.500000
nanchang city prefecture0.500000
azerbaijan0.500000
third trimester0.500000
age 8-120.500000
age one month0.500000
LOWER IN age one week0.500000
LOWER IN inflammatory bowel disease0.500000
age 3-60.500000
mild0.500000
LOWER IN severe0.500000
age 60-790.500000
gangcha region0.500000
LOWER IN gannan tibetan autonomous prefecture0.500000
age 30-500.500000
irritable bowel syndrome0.500000
new delhi0.500000
toronto0.500000
cron diet0.500000
age 13-140.500000
rem sleep behavior disorder0.500000
hmong0.500000
LOWER IN karen0.500000
LOWER IN myanmar0.500000
age 130.500000
LOWER IN india0.500000
glasgow0.500000
age<17 years0.500000
LOWER IN peru0.500000
LOWER IN small village0.500000
LOWER IN tunapuco0.500000
LOWER IN rural community0.500000
estonia0.500000
LOWER IN russia0.500000
deinagkistrodon acutus0.500000
pit viper0.500000
snake farm0.500000
adula0.500000
spondyloarthritis0.500000
spondylitis0.500000
atherosclerosis0.500000
poland0.500000
shantytown0.500000
lima0.500000
LOWER IN el salado0.500000
LOWER IN age 30-500.500000
LOWER IN age 60-790.500000
LOWER IN age >940.500000
soldiers0.500000
nephrolithiasis0.500000
age 1-20.500000
LOWER IN age 0-10.500000
LOWER IN nepal0.500000
LOWER IN himalayas0.500000
central america0.500000
dry forest0.500000
LOWER IN tropical moist broadleaf forest biome0.500000
estuary0.500000
estuary water0.500000
salinity <5 ppt0.500000
bilbao0.500000
LOWER IN short bowel syndrome0.500000
LOWER IN ear canal0.500000
LOWER IN external acoustic meatus0.500000
LOWER IN amerindian0.500000
LOWER IN hunter gatherer0.500000
LOWER IN venezuela0.500000
sigmoid colon0.500000
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.931973
feces0.925170
adult0.503401
united states of america0.394558
china0.197279
control0.183673
child0.074830
female0.068027
city0.061224
infant0.054422
jiangsu province0.047619
obsolete_juvenile stage0.047619
kingdom of denmark0.040816
age0.040816
heterosexual0.034014
msw0.034014
diarrhea0.027211
kingdom of norway0.027211
age 50-60 years0.027211
nanning city prefecture0.027211
guangzhou city prefecture0.027211
rectum0.027211
LOWER IN crohn's disease0.027211
kingdom of spain0.027211
india0.027211
age >940.020408
israel0.020408
commonwealth of virginia0.020408
age one year0.020408
united kingdom0.020408
oslo0.020408
age 30-400.020408
age 50-80 years0.020408
parkinson's disease0.020408
state of michigan0.020408
stroke0.020408
commonwealth of pennsylvania0.020408
LOWER IN control0.020408
state of colorado0.020408
amsterdam0.020408
kingdom of the netherlands0.020408
biopsy0.020408
pregnancy0.020408
LOWER IN ulcerative colitis0.020408
germany0.020408
rural community0.020408
finland0.020408
LOWER IN rural community0.020408
metabolic syndrome0.013605
australia0.013605
hospital0.013605
south korea0.013605
male0.013605
LOWER IN hiv infection0.013605
farm0.013605
mouse0.013605
mus musculus0.013605
research facility0.013605
LOWER IN homosexual0.013605
LOWER IN msm0.013605
state of california0.013605
LOWER IN male0.013605
urocyon littoralis catalinae0.013605
santa catalina island fox0.013605
santa catalina island0.013605
wild0.013605
urocyon littoralis0.013605
perianal skin0.013605
biopsy site0.013605
age 19-240.013605
state of oklahoma0.013605
new delhi0.013605
duodenum0.013605
small intestine0.013605
toronto0.013605
LOWER IN adult0.013605
age 130.013605
juvenile organism0.013605
LOWER IN infant0.013605
LOWER IN small village0.013605
LOWER IN age < 1 year0.013605
LOWER IN age 30-500.013605
LOWER IN age 60-790.013605
water0.013605
estuary0.013605
estuary water0.013605
fresh water0.013605
salinity <5 ppt0.013605
bilbao0.013605
clostridium difficile intestinal infectious disease0.006803
age 30-50 years0.006803
LOWER IN age 50-80 years0.006803
LOWER IN systemic lupus erythematosus0.006803
LOWER IN endospore enriched fraction0.006803
LOWER IN lysis0.006803
zoological garden0.006803
myrmecophaga tridactyla0.006803
giant anteater0.006803
salmonella gastroenteritis0.006803
rectal swab0.006803
Exp. ID User ID Description Date Region Flag Sequences
438amnondominant feces, homo sapiens, age >94, adult, jiangsu province, china2018-12-30v4No1 / 14
400amnonhigh freq. in feces of european american females (dominant homo sapiens, feces, united states of america, adult, female)2018-11-18v4No1 / 17
207amnonhigh freq. in people hospitalized with diarrhea (dominant homo sapiens, israel, feces, diarrhea)2017-10-05v4No1 / 18
215amnondominant homo sapiens, feces, united states of america2017-10-23v4No1 / 18
368amnondominant feces, homo sapiens, commonwealth of virginia, united states of america, adult, control2018-09-03v4No1 / 18
477amnondominant homo sapiens, feces, adult, united states of america2019-01-28v4No1 / 19
273amnondominant feces, homo sapiens, kingdom of denmark, infant, age one year2018-01-14v4No1 / 20
122amnondominant homo sapiens, feces, united kingdom2017-04-13v4No1 / 21
330amnondominant homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-13v4No1 / 21
591amnondominant homo sapiens, feces, adult, age 50-80 years, united states of america, parkinson's disease2020-02-17v4No1 / 21
94amnondominant homo sapiens, clostridium difficile intestinal infectious disease, feces, state of michigan, diarrhea2017-03-12v4No1 / 22
286amnonhigh freq. in feces of individuals without kidney stones (dominant homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, control, china)2018-01-27v4No1 / 22
467amnondominant homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 22
333amnonhigh freq. in stroke patient feces (dominant homo sapiens, feces, guangzhou city prefecture, adult, stroke, china)2018-05-15v4No1 / 22
395amnondominant homo sapiens, feces, united states of america, commonwealth of pennsylvania, control2018-11-14v4No1 / 24
333amnonhigher in stroke patients compared to healthy controls ( high in stroke compared to control in homo sapiens feces guangzhou city prefecture adult china )2018-05-15v4No1 / 30
390amnoncommon homo sapiens, feces, australia, hospital, diarrhea2018-11-04v4No1 / 38
131amnonnegatively correlated with age (30-80 years) ( high in age age 30-50 years compared to age 50-80 years in homo sapiens feces south korea )2017-04-16v4No1 / 39
368amnon high in control compared to systemic lupus erythematosus in feces homo sapiens commonwealth of virginia united states of america adult 2018-09-03v4No1 / 39
401amnonlower in endospore enriched (lysis resistant) replicates ( high in control compared to endospore enriched fraction lysis in homo sapiens feces united states of america adult )2018-11-18v4No1 / 41
406amnoncommon feces, zoological garden, united states of america, myrmecophaga tridactyla, giant anteater2018-11-21v4No1 / 44
273amnoncommon feces, homo sapiens, kingdom of denmark, infant, age one year2018-01-14v4No1 / 46
591amnoncommon homo sapiens, feces, adult, age 50-80 years, united states of america, parkinson's disease2020-02-17v4No1 / 47
333amnoncommon in stroke patient feces (common feces, homo sapiens, stroke, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 53
390amnoncommon homo sapiens, feces, australia, hospital, salmonella gastroenteritis, diarrhea2018-11-04v4No1 / 55
591amnoncommon homo sapiens, feces, adult, age 50-80 years, united states of america, control2020-02-17v4No1 / 56
563amnon high in control compared to hiv infection in homo sapiens feces rectal swab united states of america male msm homosexual 2019-11-18v4No1 / 58
333amnoncommon in healthy controls feces (common homo sapiens, feces, guangzhou city prefecture, adult, control, china)2018-05-15v4No1 / 61
502amnoncommon homo sapiens, feces, adult, united states of america, schizophrenia2019-03-12v4No1 / 63
22amnon high in control compared to hiv infection in united states of america feces homo sapiens 2016-11-28v4No1 / 70
448amnon high in equine grass sickness disease compared to control in equus caballus horse feces farm united kingdom 2019-01-08v4No1 / 72
395amnoncommon homo sapiens, feces, united states of america, commonwealth of pennsylvania, control2018-11-14v4No1 / 75
74amnoncommon united states of america, feces, homo sapiens2017-02-27v4No1 / 76
484amnoncommon feces, united states of america, adult, state of michigan, age 17-29, homo sapiens2019-02-13v4No1 / 76
516amnoncommon homo sapiens, feces, united states of america, state of ohio, adult2019-05-29v4No1 / 77
556amnoncommon homo sapiens, feces, united states of america, adult2019-09-14v1No1 / 77
589amnoncommon mouse, mus musculus, c57bl/6, research facility, feces, jackson laboratories, united states of america, state of georgia, high fat diet + inulin2020-02-10v4No1 / 78
401amnoncommon homo sapiens, feces, united states of america, adult2018-11-18v4No1 / 79
292amnoncommon homo sapiens, adult, feces, control, china2018-02-05v4No1 / 81
344amnoncommon in feces of heterosexuals (common homo sapiens, feces, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 82
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, control2018-09-03v4No1 / 82
286amnonlower in feces of individuals with kidney stones ( high in control compared to nephrolithiasis in homo sapiens feces adult age 50-60 years nanning city prefecture china )2018-01-27v4No1 / 83
502amnoncommon homo sapiens, feces, adult, united states of america, control2019-03-12v4No1 / 83
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msw, heterosexual2018-11-06v4No1 / 84
629amnon high in heterosexual msw compared to homosexual msm in male adult amsterdam kingdom of the netherlands feces homo sapiens 2020-05-31v4No1 / 85
247amnoncommon homo sapiens, italy, feces, high bmi, obesity2017-11-21v4No1 / 85
601amnoncommon homo sapiens, feces, china, adult, type 2 diabetes mellitus2020-03-30v4No1 / 85
249amnoncommon homo sapiens, feces, united states of america2017-11-22v4No1 / 86
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, control2018-11-06v4No1 / 86
430amnoncommon homo sapiens, adult, united states of america, state of arizona, city, age 20, feces2018-12-15v4No1 / 87
62amnon high in united states of america compared to egypt in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 88
404amnon high in female compared to male in homo sapiens feces adult colombia city 2018-11-20v4No1 / 88
582amnoncommon urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, urocyon littoralis, perianal skin, rectum2020-01-22v4No1 / 88
629amnoncommon female, amsterdam, kingdom of the netherlands, adult, feces, homo sapiens2020-05-31v4No1 / 89
293amnoncommon homo sapiens, feces, adult, united states of america, american diet2018-02-07v4No1 / 89
428amnoncommon homo sapiens, adult, feces, nanchang city prefecture, control, china2018-12-09v4No1 / 93
601amnoncommon homo sapiens, feces, china, adult, control2020-03-30v4No1 / 93
400amnoncommon in feces of european american females (common homo sapiens, feces, united states of america, adult, female)2018-11-18v4No1 / 95
293amnonhigher in lean participants in human feces ( high in low bmi compared to high bmi in united states of america feces adult homo sapiens )2018-02-07v4No1 / 96
629amnoncommon msw, heterosexual, amsterdam, kingdom of the netherlands, adult, feces, homo sapiens2020-05-31v4No1 / 97
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 97
409amnoncommon homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v4No1 / 97
438amnoncommon homo sapiens, feces, age 19-24, china2018-12-30v4No1 / 101
477amnoncommon homo sapiens, feces, adult, united states of america2019-01-28v4No1 / 103
580amnoncommon homo sapiens, feces, israel, adult, female, pregnancy, third trimester2020-01-14v4No1 / 103
284amnoncommon homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 105
438amnoncommon homo sapiens, feces, jiangsu province, child, age 8-12, china2018-12-30v4No1 / 106
215amnoncommon homo sapiens, feces, united states of america2017-10-23v4No1 / 107
273amnon high in age age one month compared to age one week in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 107
393amnon high in heterosexual msw compared to gay homosexual msm in homo sapiens feces united states of america adult state of colorado city 2018-11-06v4No1 / 107
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child ulcerative colitis inflammatory bowel disease crohn's disease in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 107
409amnoncommon homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 108
289amnoncommon homo sapiens, feces, adult, united states of america, state of michigan2018-02-01v4No1 / 109
438amnoncommon homo sapiens, feces, jiangsu province, child, age 3-6, china2018-12-30v4No1 / 109
276amnoncommon feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v4No1 / 110
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to severe ulcerative colitis in homo sapiens child united states of america feces )2018-11-22v4No1 / 110
438amnoncommon feces, homo sapiens, age 60-79, adult, jiangsu province, china2018-12-30v4No1 / 111
580amnoncommon homo sapiens, feces, israel, adult, female, pregnancy, first trimester2020-01-14v4No1 / 112
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 114
438amnoncommon feces, homo sapiens, jiangsu province, age 30-50, adult, china2018-12-30v4No1 / 115
239amnoncommon homo sapiens, feces, united states of america2017-11-08v4No1 / 117
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 118
212amnoncommon mouse, mus musculus, feces, research facility, united states of america, lean body mass, control2017-10-22v4No1 / 120
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
352amnoncommon in duodenal biopsies (common homo sapiens, new delhi, duodenum, small intestine, india)2018-07-30v4No1 / 121
438amnoncommon feces, homo sapiens, age >94, jiangsu province, adult, china2018-12-30v4No1 / 121
10amnonnegatively correlated with age (6-35) ( high in child compared to adult in homo sapiens feces toronto )2016-10-27v4No1 / 125
607amnoncommon germany, homo sapiens, feces, parkinson's disease2020-04-19v4No1 / 125
131amnoncommon homo sapiens, feces, south korea2017-04-16v4No1 / 128
607amnoncommon germany, homo sapiens, feces, control2020-04-19v4No1 / 128
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-13v4No1 / 130
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
438amnoncommon homo sapiens, feces, jiangsu province, age 13-14, china2018-12-30v4No1 / 134
607amnoncommon germany, homo sapiens, feces, rem sleep behavior disorder2020-04-19v4No1 / 134
400amnonhigher in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in hmong china compared to karen myanmar in homo sapiens feces thailand rural community )2018-11-18v4No1 / 135
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, finland2017-09-12v4No1 / 136
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 137
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 138
197amnon high in finland compared to india in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 138
132amnoncommon homo sapiens, feces, united states of america2017-04-16v4No1 / 145
330amnon high in adult age 30-40 compared to infant age 1 year in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 145
73amnoncommon homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 150
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 157
292amnon high in control compared to crohn's disease ulcerative colitis in homo sapiens adult feces china 2018-02-05v4No1 / 161
290amnoncommon homo sapiens, feces, adult, city, china2018-02-01v4No1 / 162
297amnoncommon homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 162
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
194amnon high in feces compared to colon ileum in homo sapiens kingdom of norway 2017-09-07v4No1 / 169
241amnonlower in babies from russia compared to estonia ( high in estonia compared to russia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 169
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in homo sapiens feces infant )2017-11-13v4No1 / 173
530amnoncommon snake, deinagkistrodon acutus, pit viper, feces, snake farm, farm, adula, hunan province, china2019-07-21v4No1 / 178
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 183
312amnoncommon feces, homo sapiens, french republic, adult, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
6amnoncommon urine, female, homo sapiens, pregnancy, state of tennessee2016-10-13v4No1 / 201
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon homo sapiens, feces, adult, small village, rural community, china2018-02-01v4No1 / 218
566amnoncommon feces, china, homo sapiens, adult2019-11-24v4No1 / 221
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 227
53amnon high in shantytown lima compared to el salado small village in homo sapiens feces city 2017-01-21v4No1 / 237
438amnonhigher in students and soldiers age 19-24 compared to older adults ( high in age 19-24 soldiers compared to adult age 30-50 age 60-79 age >94 in homo sapiens feces china )2018-12-30v4No1 / 238
286amnoncommon in feces of individuals with kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, nephrolithiasis, china)2018-01-27v4No1 / 239
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces infant india )2016-12-19v4No1 / 253
286amnoncommon in feces of individuals without kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, control, china)2018-01-27v4No1 / 281
477amnon high in united states of america compared to nepal himalayas rural community in homo sapiens feces adult 2019-01-28v4No1 / 295
80amnon high in dry forest compared to tropical moist broadleaf forest biome in feces central america alouatta palliata mantled howler monkey state of florida 2017-03-03v4No1 / 314
510amnoncommon kingdom of spain, water, estuary, estuary water, fresh water, salinity <5 ppt, bilbao2019-03-20v4No1 / 317
299amnon high in mouth neoplasm cancer compared to control in saliva adult homo sapiens china 2018-02-27v4No1 / 319
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
532amnon high in control compared to short bowel syndrome in homo sapiens feces czech republic adult 2019-07-21v1No1 / 334
400amnonlower in people from thailand compared to 2nd generation immigrants to usa ( high in united states of america compared to thailand rural community in homo sapiens feces )2018-11-18v4No1 / 343
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
63amnon high in female compared to male in homo sapiens feces united states of america 2017-12-04v4No1 / 384
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
582amnon high in perianal skin rectum compared to ear canal external acoustic meatus in wild united states of america santa catalina island urocyon littoralis santa catalina island fox urocyon littoralis catalinae 2020-01-22v4No1 / 400
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-06v4No1 / 417
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
438amnonhigher in centenarians compared to adults ( high in age >94 compared to age 30-50 age 60-79 in homo sapiens feces china )2018-12-30v4No1 / 474
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
425amnon high in central african republic bangui compared to madagascar antananarivo in homo sapiens feces africa child 2018-12-08v4No1 / 564
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 567
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in kingdom of spain water estuary estuary water bilbao 2019-03-20v4No1 / 592
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 752

Problems / suggestions? Please email info AT dbbact DOT org