Search result for sequence:
TACGGAGGATTCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGTTTGATAAGTTAGAGGTGAAATTTCGGGGCTCAACCCTGAACGTGCCTCTAATACTGTTGAGCTAGAGAGTAGTTGCGGTAGGCGGAATGTATGG
common ontology terms
term enrichment score
TermScore
homo sapiens0.630808
feces0.518153
adult0.445820
united states of america0.267001
china0.171053
child0.167671
control0.145308
city0.134977
obsolete_juvenile stage0.105263
jiangsu province0.081218
msw0.068966
heterosexual0.068966
LOWER IN crohn's disease0.068966
state of colorado0.064516
biopsy0.058394
female0.055944
infant0.053333
colombia0.047059
biopsy site0.046967
india0.046784
LOWER IN ulcerative colitis0.046512
rural community0.045889
state of michigan0.044693
south korea0.044199
united kingdom0.043716
age0.043478
kingdom of spain0.043243
metabolic syndrome0.035398
state of oklahoma0.035398
age 5-13 years0.035398
water0.035346
LOWER IN rural community0.035294
age 19-240.035088
age 60-790.035088
oslo0.035088
age 30-400.035088
age 50-60 years0.035088
nanning city prefecture0.035088
age<17 years0.035088
denver0.035088
commonwealth of pennsylvania0.035088
LOWER IN child0.035088
age 130.035088
atlanta0.034483
kingdom of denmark0.034483
rectum0.034483
finland0.034188
juvenile organism0.033898
commonwealth of virginia0.033333
australia0.032000
kingdom of norway0.031746
diet0.031746
fresh water0.031250
state of california0.031008
caecum0.030303
animal product diet0.023810
LOWER IN gay0.023810
LOWER IN msm0.023810
LOWER IN homosexual0.023810
age 200.023669
canada0.023669
atherosclerosis0.023669
age 17-290.023669
age 13-140.023669
guangzhou city prefecture0.023669
nanchang city prefecture0.023669
lima0.023669
shantytown0.023669
age 30-500.023669
glasgow0.023669
cron diet0.023669
LOWER IN small village0.023669
LOWER IN age < 1 year0.023669
coturnix coturnix0.023669
common quail0.023669
estuary0.023669
estuary water0.023669
salinity <5 ppt0.023669
bilbao0.023669
africa0.023669
chuquisaca department0.023669
LOWER IN mouth mucosa0.023669
LOWER IN infant0.023529
LOWER IN hiv infection0.023392
caloric restriction diet0.023392
ulcerative colitis0.023256
state of arizona0.023121
texas0.023121
bolivia0.023121
pig0.022989
sus scrofa0.022989
duodenum0.022989
obesity0.022599
sichuan province0.022599
hospital0.022599
river0.022599
diarrhea0.022346
LOWER IN mouth0.022346
LOWER IN feces0.022222
high bmi0.022099
Fraction of dbbact annotations with this term covered by the query
TermScore
colombia0.800000
biopsy0.800000
biopsy site0.750000
msw0.666667
heterosexual0.666667
metabolic syndrome0.666667
animal product diet0.666667
LOWER IN crohn's disease0.666667
state of oklahoma0.666667
age 5-13 years0.666667
LOWER IN gay0.666667
LOWER IN msm0.666667
LOWER IN homosexual0.666667
india0.666667
LOWER IN rural community0.600000
LOWER IN ulcerative colitis0.571429
small waist circumference0.500000
LOWER IN waist circumference0.500000
LOWER IN large waist circumference0.500000
age 200.500000
age 19-240.500000
age 60-790.500000
canada0.500000
atherosclerosis0.500000
daycare0.500000
age 1-5 years0.500000
age 17-290.500000
oslo0.500000
age 30-400.500000
age 50-60 years0.500000
nanning city prefecture0.500000
age<17 years0.500000
denver0.500000
commonwealth of pennsylvania0.500000
age 13-140.500000
centererians0.500000
LOWER IN plant based diet0.500000
LOWER IN endospore enriched fraction0.500000
LOWER IN lysis0.500000
stroke0.500000
guangzhou city prefecture0.500000
salmonella gastroenteritis0.500000
schizophrenia0.500000
native american0.500000
arapaho0.500000
cheyenne0.500000
quito0.500000
LOWER IN egypt0.500000
metabolic syndrome x0.500000
nanchang city prefecture0.500000
azerbaijan0.500000
age 8-120.500000
LOWER IN child0.500000
LOWER IN inflammatory bowel disease0.500000
age 3-60.500000
lima0.500000
shantytown0.500000
mild0.500000
LOWER IN severe0.500000
gangcha region0.500000
LOWER IN gannan tibetan autonomous prefecture0.500000
age 30-500.500000
irritable bowel syndrome0.500000
age >940.500000
glasgow0.500000
cron diet0.500000
thailand0.500000
hmong0.500000
LOWER IN karen0.500000
LOWER IN myanmar0.500000
age 130.500000
toronto0.500000
LOWER IN india0.500000
LOWER IN plant diet0.500000
LOWER IN peru0.500000
LOWER IN small village0.500000
LOWER IN tunapuco0.500000
estonia0.500000
LOWER IN russia0.500000
age 1-3 years0.500000
LOWER IN age < 1 year0.500000
spondyloarthritis0.500000
spondylitis0.500000
gastric carcinoma0.500000
stomach neoplasm0.500000
coturnix coturnix0.500000
common quail0.500000
LOWER IN el salado0.500000
LOWER IN age 30-500.500000
LOWER IN age 60-790.500000
LOWER IN age >940.500000
soldiers0.500000
nephrolithiasis0.500000
hirundo rustica0.500000
colorado0.500000
barn swallow0.500000
sea urchin0.500000
eagle harbor0.500000
age 1-20.500000
LOWER IN age 0-10.500000
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.927273
feces0.884848
adult0.436364
united states of america0.430303
china0.200000
control0.145455
child0.103030
city0.078788
obsolete_juvenile stage0.060606
jiangsu province0.048485
female0.036364
state of colorado0.036364
msw0.036364
heterosexual0.036364
LOWER IN crohn's disease0.036364
biopsy0.030303
infant0.030303
south korea0.024242
state of michigan0.024242
colombia0.024242
united kingdom0.024242
biopsy site0.024242
LOWER IN ulcerative colitis0.024242
kingdom of spain0.024242
rural community0.024242
india0.024242
age0.024242
water0.024242
commonwealth of virginia0.018182
age 19-240.018182
age 60-790.018182
kingdom of norway0.018182
oslo0.018182
age 30-400.018182
state of california0.018182
age 50-60 years0.018182
nanning city prefecture0.018182
age<17 years0.018182
atlanta0.018182
kingdom of denmark0.018182
metabolic syndrome0.018182
denver0.018182
commonwealth of pennsylvania0.018182
diet0.018182
australia0.018182
state of oklahoma0.018182
age 5-13 years0.018182
LOWER IN child0.018182
rectum0.018182
age 130.018182
juvenile organism0.018182
finland0.018182
LOWER IN rural community0.018182
research facility0.018182
caecum0.018182
fresh water0.018182
state of arizona0.012121
age 200.012121
canada0.012121
atherosclerosis0.012121
age 17-290.012121
italy0.012121
high bmi0.012121
obesity0.012121
brazil0.012121
age 13-140.012121
sichuan province0.012121
LOWER IN adult0.012121
animal product diet0.012121
hospital0.012121
diarrhea0.012121
ulcerative colitis0.012121
guangzhou city prefecture0.012121
LOWER IN hiv infection0.012121
nanchang city prefecture0.012121
LOWER IN gay0.012121
LOWER IN msm0.012121
LOWER IN homosexual0.012121
lima0.012121
shantytown0.012121
age 30-500.012121
LOWER IN feces0.012121
glasgow0.012121
cron diet0.012121
caloric restriction diet0.012121
LOWER IN infant0.012121
LOWER IN small village0.012121
LOWER IN age < 1 year0.012121
LOWER IN control0.012121
texas0.012121
coturnix coturnix0.012121
common quail0.012121
estuary0.012121
estuary water0.012121
salinity <5 ppt0.012121
bilbao0.012121
pig0.012121
sus scrofa0.012121
river0.012121
autumn0.012121
Exp. ID User ID Description Date Region Flag Sequences
74amnonhighfreq united states of america, feces, homo sapiens2017-02-27v4No1 / 15
131amnonnegatively correlated with waist circumference ( high in small waist circumference compared to waist circumference large waist circumference in homo sapiens feces south korea )2017-04-16v4No1 / 15
289amnonhighfreq homo sapiens, feces, adult, united states of america, state of michigan2018-02-01v4No1 / 17
368amnonhighfreq feces, homo sapiens, commonwealth of virginia, united states of america, adult, systemic lupus erythematosus2018-09-03v4No1 / 17
400amnonhigh freq. in feces of european american females (highfreq homo sapiens, feces, united states of america, adult, female)2018-11-18v4No1 / 17
215amnonhighfreq homo sapiens, feces, united states of america2017-10-23v4No1 / 18
368amnonhighfreq feces, homo sapiens, commonwealth of virginia, united states of america, adult, control2018-09-03v4No1 / 18
430amnonhighfreq homo sapiens, adult, united states of america, state of arizona, city, age 20, feces2018-12-15v4No1 / 18
438amnonhighfreq homo sapiens, feces, age 19-24, china2018-12-30v4No1 / 19
438amnonhighfreq feces, homo sapiens, age 60-79, adult, jiangsu province, china2018-12-30v4No1 / 19
455amnonhighfreq homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 19
477amnonhighfreq homo sapiens, feces, adult, united states of america2019-01-28v4No1 / 19
482amnonhighfreq homo sapiens, feces, colombia, medellin metropolitan area, child, daycare, age 1-5 years2019-02-12v4No1 / 19
484amnonhighfreq feces, adult, age 17-29, united states of america, state of michigan, homo sapiens2019-02-13v4No1 / 20
122amnonhighfreq homo sapiens, feces, united kingdom2017-04-13v4No1 / 21
247amnonhighfreq homo sapiens, italy, feces, high bmi, obesity2017-11-21v4No1 / 21
249amnonhighfreq homo sapiens, feces, united states of america2017-11-22v4No1 / 21
330amnonhighfreq homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-13v4No1 / 21
393amnonhighfreq homo sapiens, feces, united states of america, adult, state of colorado, city, msw, heterosexual2018-11-06v4No1 / 21
120amnonhighfreq homo sapiens, feces, brazil2017-04-12v4No1 / 22
284amnonhighfreq homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 22
286amnonhigh freq. in feces of individuals without kidney stones (highfreq homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, control, china)2018-01-27v4No1 / 22
297amnonhighfreq homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 22
467amnonhighfreq homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 22
132amnonhighfreq homo sapiens, feces, united states of america2017-04-16v4No1 / 23
344amnonhigh freq. in feces of heterosexuals (highfreq homo sapiens, feces, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 23
239amnonhighfreq homo sapiens, feces, united states of america2017-11-08v4No1 / 24
395amnonhighfreq homo sapiens, feces, united states of america, commonwealth of pennsylvania, control2018-11-14v4No1 / 24
131amnonhighfreq homo sapiens, feces, south korea2017-04-16v4No1 / 27
438amnonhighfreq homo sapiens, feces, jiangsu province, age 13-14, china2018-12-30v4No1 / 29
36amnonhigher in centernarians ( high in centererians compared to adult in homo sapiens feces sichuan province )2016-12-06v4No1 / 30
63amnon high in animal product diet diet compared to plant based diet in homo sapiens united states of america feces 2017-04-12v4No1 / 32
51amnoncommon homo sapiens, biopsy site, biopsy, united states of america2017-01-19v4No1 / 38
297amnon high in control compared to crohn's disease ulcerative colitis in homo sapiens feces obsolete_juvenile stage age<17 years united states of america atlanta child 2018-02-12v4No1 / 38
390amnoncommon homo sapiens, feces, australia, hospital, diarrhea2018-11-04v4No1 / 38
401amnonlower in endospore enriched (lysis resistant) replicates ( high in control compared to endospore enriched fraction lysis in homo sapiens feces united states of america adult )2018-11-18v4No1 / 41
51amnoncommon feces, homo sapiens, united states of america2017-01-19v4No1 / 42
36amnoncommon homo sapiens, feces, sichuan province2016-12-06v4No1 / 44
292amnoncommon homo sapiens, adult, feces, ulcerative colitis, china2018-02-05v4No1 / 53
333amnoncommon in stroke patient feces (common feces, homo sapiens, stroke, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 53
131amnon high in female compared to male in homo sapiens feces south korea 2017-04-16v4No1 / 55
292amnoncommon homo sapiens, adult, feces, crohn's disease, china2018-02-05v4No1 / 55
390amnoncommon homo sapiens, feces, australia, hospital, salmonella gastroenteritis, diarrhea2018-11-04v4No1 / 55
333amnoncommon in healthy controls feces (common homo sapiens, feces, guangzhou city prefecture, adult, control, china)2018-05-15v4No1 / 61
502amnoncommon homo sapiens, feces, adult, united states of america, schizophrenia2019-03-12v4No1 / 63
242amnoncommon in native-americans (common homo sapiens, feces, united states of america, state of oklahoma, native american, arapaho, cheyenne)2017-11-14v4No1 / 65
51amnon high in control compared to hiv infection in homo sapiens feces united states of america 2017-01-19v4No1 / 69
22amnon high in control compared to hiv infection in united states of america feces homo sapiens 2016-11-28v4No1 / 70
395amnoncommon homo sapiens, feces, united states of america, commonwealth of pennsylvania, control2018-11-14v4No1 / 75
74amnoncommon united states of america, feces, homo sapiens2017-02-27v4No1 / 76
484amnoncommon feces, united states of america, adult, state of michigan, age 17-29, homo sapiens2019-02-13v4No1 / 76
516amnoncommon homo sapiens, feces, united states of america, state of ohio, adult2019-05-29v4No1 / 77
401amnoncommon homo sapiens, feces, united states of america, adult2018-11-18v4No1 / 79
404amnoncommon homo sapiens, feces, colombia, city, adult2018-11-20v4No1 / 79
292amnoncommon homo sapiens, adult, feces, control, china2018-02-05v4No1 / 81
344amnoncommon in feces of heterosexuals (common homo sapiens, feces, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 82
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, control2018-09-03v4No1 / 82
562amnoncommon age 5-13 years, child, ecuador, quito, feces2019-11-05v4No1 / 82
502amnoncommon homo sapiens, feces, adult, united states of america, control2019-03-12v4No1 / 83
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msw, heterosexual2018-11-06v4No1 / 84
247amnoncommon homo sapiens, italy, feces, high bmi, obesity2017-11-21v4No1 / 85
249amnoncommon homo sapiens, feces, united states of america2017-11-22v4No1 / 86
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, control2018-11-06v4No1 / 86
430amnoncommon homo sapiens, adult, united states of america, state of arizona, city, age 20, feces2018-12-15v4No1 / 87
62amnon high in united states of america compared to egypt in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 88
487amnoncommon homo sapiens, feces, united states of america, metabolic syndrome, metabolic syndrome x2019-02-24v4No1 / 88
293amnoncommon homo sapiens, feces, adult, united states of america, american diet2018-02-07v4No1 / 89
303amnoncommon homo sapiens, feces, germany, adult2018-03-12v4No1 / 93
428amnoncommon homo sapiens, adult, feces, nanchang city prefecture, control, china2018-12-09v4No1 / 93
400amnoncommon in feces of european american females (common homo sapiens, feces, united states of america, adult, female)2018-11-18v4No1 / 95
238amnoncommon homo sapiens, feces, colombia2017-11-07v4No1 / 96
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 97
409amnoncommon homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v4No1 / 97
438amnoncommon homo sapiens, feces, age 19-24, china2018-12-30v4No1 / 101
477amnoncommon homo sapiens, feces, adult, united states of america2019-01-28v4No1 / 103
284amnoncommon homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 105
344amnonlower in gay (msm) individuals compared to heterosexual (msw) ( high in heterosexual msw compared to gay msm homosexual in homo sapiens feces united states of america state of colorado denver )2018-05-31v4No1 / 106
438amnoncommon homo sapiens, feces, jiangsu province, child, age 8-12, china2018-12-30v4No1 / 106
215amnoncommon homo sapiens, feces, united states of america2017-10-23v4No1 / 107
393amnon high in heterosexual msw compared to gay homosexual msm in homo sapiens feces united states of america adult state of colorado city 2018-11-06v4No1 / 107
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child ulcerative colitis inflammatory bowel disease crohn's disease in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 107
409amnoncommon homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 108
289amnoncommon homo sapiens, feces, adult, united states of america, state of michigan2018-02-01v4No1 / 109
438amnoncommon homo sapiens, feces, jiangsu province, child, age 3-6, china2018-12-30v4No1 / 109
53amnoncommon homo sapiens, feces, lima, city, shantytown2017-01-21v4No1 / 110
276amnoncommon feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v4No1 / 110
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to severe ulcerative colitis in homo sapiens child united states of america feces )2018-11-22v4No1 / 110
438amnoncommon feces, homo sapiens, age 60-79, adult, jiangsu province, china2018-12-30v4No1 / 111
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 114
438amnoncommon feces, homo sapiens, jiangsu province, age 30-50, adult, china2018-12-30v4No1 / 115
239amnoncommon homo sapiens, feces, united states of america2017-11-08v4No1 / 117
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 118
410amnonlower in feces compared to rectal biopsies in children with treatment naive uc ( high in rectum biopsy biopsy site compared to feces in homo sapiens child united states of america ulcerative colitis )2018-11-22v4No1 / 118
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
438amnoncommon feces, homo sapiens, age >94, jiangsu province, adult, china2018-12-30v4No1 / 121
449amnoncommon homo sapiens, feces, colombia2019-01-09v4No1 / 124
73amnonhigh in healthy adult controls compared to children with Crohn's disease ( high in control adult compared to obsolete_juvenile stage child crohn's disease in glasgow feces homo sapiens )2017-02-26v4No1 / 125
131amnoncommon homo sapiens, feces, south korea2017-04-16v4No1 / 128
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-13v4No1 / 130
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
438amnoncommon homo sapiens, feces, jiangsu province, age 13-14, china2018-12-30v4No1 / 134
400amnonhigher in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in hmong china compared to karen myanmar in homo sapiens feces thailand rural community )2018-11-18v4No1 / 135
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, finland2017-09-12v4No1 / 136
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 137
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 138
197amnon high in finland compared to india in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 138
132amnoncommon homo sapiens, feces, united states of america2017-04-16v4No1 / 145
330amnon high in adult age 30-40 compared to infant age 1 year in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 145
74amnonHigher in animal product diet compared to plant diet ( high in diet animal product diet compared to plant diet in homo sapiens feces united states of america )2017-02-27v4No1 / 149
73amnoncommon homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 150
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 157
292amnon high in control compared to crohn's disease ulcerative colitis in homo sapiens adult feces china 2018-02-05v4No1 / 161
290amnoncommon homo sapiens, feces, adult, city, china2018-02-01v4No1 / 162
297amnoncommon homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 162
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
241amnonlower in babies from russia compared to estonia ( high in estonia compared to russia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 169
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 170
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in homo sapiens feces infant )2017-11-13v4No1 / 173
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 183
312amnoncommon feces, homo sapiens, french republic, adult, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
520amnonhigher in gastric cancer compared to paired normal tissue ( high in gastric carcinoma stomach neoplasm compared to control in homo sapiens zhejiang province stomach adult china )2019-06-26v3No1 / 214
108amnoncommon research facility, texas, united states of america, caecum, coturnix coturnix, common quail2017-04-07v4No1 / 216
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon homo sapiens, feces, adult, small village, rural community, china2018-02-01v4No1 / 218
566amnoncommon adult, homo sapiens, china, feces2019-11-24v4No1 / 221
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 227
53amnon high in shantytown lima compared to el salado small village in homo sapiens feces city 2017-01-21v4No1 / 237
438amnonhigher in students and soldiers age 19-24 compared to older adults ( high in age 19-24 soldiers compared to adult age 30-50 age 60-79 age >94 in homo sapiens feces china )2018-12-30v4No1 / 238
286amnoncommon in feces of individuals with kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, nephrolithiasis, china)2018-01-27v4No1 / 239
161amnoncommon in barn swallows in colorado (common hirundo rustica, feces, united states of america, colorado, barn swallow)2017-07-12v4No1 / 245
351amnoncommon sea urchin, lytechinus variegatus, coelomic fluid, research facility, eagle harbor, state of florida, united states of america2018-07-30v4No1 / 249
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces infant india )2016-12-19v4No1 / 253
286amnoncommon in feces of individuals without kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, control, china)2018-01-27v4No1 / 281
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 288
477amnon high in united states of america compared to nepal himalayas rural community in homo sapiens feces adult 2019-01-28v4No1 / 295
510amnoncommon kingdom of spain, water, estuary, estuary water, fresh water, salinity <5 ppt, bilbao2019-03-20v4No1 / 317
299amnon high in mouth neoplasm cancer compared to control in saliva adult homo sapiens china 2018-02-27v4No1 / 319
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
400amnonlower in people from thailand compared to 2nd generation immigrants to usa ( high in united states of america compared to thailand rural community in homo sapiens feces )2018-11-18v4No1 / 343
122amnonnegatively correlated with bmi ( high in body mass index low bmi compared to high bmi in homo sapiens feces united kingdom )2017-04-13v4No1 / 345
521amnonhigher in pre-weaned pigs compared to weaned older timepoints ( high in suckling preweaned age 2-4 weeks compared to weaned corn and soybean diet age 4-7 weeks in pig sus scrofa feces farm jiangxi province china )2019-07-02v3No1 / 347
254amnonhigher in river when close to populated region compared to downstream ( high in city populated place upstream compared to downstream in river water fresh water depth 0.5m jiulong river fujian province china )2017-11-23v4No1 / 356
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
160amnoncommon in river water upstream of WTP effluent in autumn in china (common river, water, autumn, china)2017-07-12v4No1 / 376
108amnon high in caecum compared to colon in research facility texas united states of america coturnix coturnix common quail 2017-04-07v4No1 / 380
293amnonhigher in caloric restriction (CRON) diet compared to american diet ( high in cron diet caloric restriction diet diet compared to american diet in homo sapiens adult feces united states of america )2018-02-07v4No1 / 381
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-06v4No1 / 417
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
160amnoncommon in wastewater treatment plant effluent in autumn in china (common autumn, wastewater treatment plant, effluent, china)2017-07-12v4No1 / 469
438amnon high in age 30-50 age 60-79 adult compared to age 3-6 age 8-12 child in homo sapiens feces china 2018-12-30v4No1 / 486
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
425amnon high in central african republic bangui compared to madagascar antananarivo in homo sapiens feces africa child 2018-12-08v4No1 / 564
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 567
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in kingdom of spain water estuary estuary water bilbao 2019-03-20v4No1 / 592
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 752
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 836
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014

Problems / suggestions? Please email info AT dbbact DOT org