Search result for sequence:
TACGGAGGATTCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGTTTGATAAGTTAGAGGTGAAATTTCGGGGCTCAACCCTGAACGTGCCTCTAATACTGTTGAGCTAGAGAGTAGTTGCGGTAGGCGGAATGTATGG
common ontology terms
term enrichment score
TermScore
homo sapiens0.550321
feces0.480392
adult0.404047
united states of america0.263385
control0.143519
child0.143369
china0.137179
city0.114493
obsolete_juvenile stage0.083333
msw0.070073
heterosexual0.070073
obesity0.061765
female0.059308
jiangsu province0.059041
LOWER IN crohn's disease0.053333
state of colorado0.050209
infant0.049710
poland0.045455
biopsy0.044693
rectum0.043956
rural community0.043956
low bmi0.042105
south korea0.041237
state of new york0.040816
state of california0.039474
israel0.039216
germany0.038095
parkinson's disease0.036753
colombia0.036364
biopsy site0.036309
LOWER IN rural community0.036199
LOWER IN ulcerative colitis0.036036
india0.036036
obese body mass index status0.035242
state of michigan0.034632
age 50-80 years0.034632
age0.033898
united kingdom0.033755
switzerland0.032389
kingdom of spain0.031621
water0.027746
diarrhea0.027523
metabolic syndrome0.027335
state of oklahoma0.027335
age 5-13 years0.027335
LOWER IN homosexual0.027273
LOWER IN msm0.027273
age 60-790.027149
oslo0.027149
age 30-400.027149
age 50-60 years0.027149
nanning city prefecture0.027149
age<17 years0.027149
denver0.027149
food allergy0.027149
age 4-10 years0.027149
age 130.027149
age 19-240.026786
european0.026786
atlanta0.026786
LOWER IN child0.026667
kingdom of denmark0.026608
finland0.026608
caucasian0.026432
amsterdam0.026432
caecum0.026258
hospital0.026087
commonwealth of virginia0.026087
juvenile organism0.026087
high bmi0.025918
kingdom of the netherlands0.025751
commonwealth of pennsylvania0.025424
kingdom of norway0.025105
diet0.025105
fresh water0.024490
australia0.024341
ulcerative colitis0.018433
animal product diet0.018349
age 200.018265
atherosclerosis0.018265
age 17-290.018265
rem sleep behavior disorder0.018265
age 13-140.018265
urocyon littoralis catalinae0.018265
santa catalina island fox0.018265
santa catalina island0.018265
urocyon littoralis0.018265
perianal skin0.018265
milk allergy0.018265
LOWER IN gay0.018265
lima0.018265
shantytown0.018265
glasgow0.018265
cron diet0.018265
LOWER IN small village0.018265
coturnix coturnix0.018265
common quail0.018265
estuary water0.018265
salinity <5 ppt0.018265
bilbao0.018265
Fraction of dbbact annotations with this term covered by the query
TermScore
parkinson's disease1.500000
diarrhea1.000000
poland1.000000
ulcerative colitis1.000000
colombia0.800000
biopsy site0.750000
metabolic syndrome0.666667
animal product diet0.666667
state of oklahoma0.666667
LOWER IN rural community0.666667
age 5-13 years0.666667
obesity0.600000
msw0.600000
heterosexual0.600000
LOWER IN crohn&#39;s disease0.600000
LOWER IN homosexual0.600000
LOWER IN msm0.600000
biopsy0.571429
LOWER IN ulcerative colitis0.571429
india0.571429
LOWER IN clostridium difficile colitis0.500000
tucson0.500000
small waist circumference0.500000
LOWER IN waist circumference0.500000
LOWER IN large waist circumference0.500000
age 200.500000
age 60-790.500000
atherosclerosis0.500000
daycare0.500000
age 1-5 years0.500000
age 17-290.500000
oslo0.500000
age 30-400.500000
rem sleep behavior disorder0.500000
age 50-60 years0.500000
nanning city prefecture0.500000
age<17 years0.500000
denver0.500000
age 13-140.500000
centererians0.500000
LOWER IN plant based diet0.500000
LOWER IN endospore enriched fraction0.500000
LOWER IN lysis0.500000
stroke0.500000
salmonella gastroenteritis0.500000
schizophrenia0.500000
native american0.500000
arapaho0.500000
cheyenne0.500000
yaounde0.500000
LOWER IN ngoantet0.500000
sesame allergy0.500000
food allergy0.500000
age 4-10 years0.500000
quito0.500000
LOWER IN egypt0.500000
metabolic syndrome x0.500000
urocyon littoralis catalinae0.500000
santa catalina island fox0.500000
santa catalina island0.500000
urocyon littoralis0.500000
perianal skin0.500000
milk allergy0.500000
azerbaijan0.500000
third trimester0.500000
LOWER IN gay0.500000
age 8-120.500000
LOWER IN inflammatory bowel disease0.500000
LOWER IN sesame allergy0.500000
age 3-60.500000
lima0.500000
shantytown0.500000
mild0.500000
LOWER IN severe0.500000
gangcha region0.500000
LOWER IN gannan tibetan autonomous prefecture0.500000
irritable bowel syndrome0.500000
age >940.500000
glasgow0.500000
LOWER IN cross-cutucu0.500000
upano valley0.500000
shuar population0.500000
cron diet0.500000
hmong0.500000
LOWER IN karen0.500000
LOWER IN myanmar0.500000
age 130.500000
LOWER IN cuba0.500000
LOWER IN india0.500000
overweight body mass index status0.500000
gaz:000521000.500000
LOWER IN plant diet0.500000
LOWER IN peru0.500000
LOWER IN small village0.500000
LOWER IN tunapuco0.500000
estonia0.500000
LOWER IN russia0.500000
spondyloarthritis0.500000
spondylitis0.500000
gastric carcinoma0.500000
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.920930
feces0.893023
adult0.502326
united states of america0.418605
china0.181395
control0.144186
child0.093023
city0.065116
obsolete_juvenile stage0.046512
female0.041860
jiangsu province0.037209
msw0.037209
heterosexual0.037209
obesity0.032558
state of colorado0.027907
LOWER IN crohn&#39;s disease0.027907
infant0.027907
south korea0.023256
low bmi0.023256
poland0.023256
state of new york0.023256
germany0.023256
state of california0.023256
biopsy0.023256
israel0.023256
rectum0.023256
rural community0.023256
state of michigan0.018605
age 50-80 years0.018605
switzerland0.018605
obese body mass index status0.018605
colombia0.018605
united kingdom0.018605
parkinson's disease0.018605
biopsy site0.018605
LOWER IN ulcerative colitis0.018605
LOWER IN rural community0.018605
kingdom of spain0.018605
india0.018605
age0.018605
water0.018605
diarrhea0.013953
hospital0.013953
commonwealth of virginia0.013953
age 19-240.013953
age 60-790.013953
european0.013953
caucasian0.013953
high bmi0.013953
kingdom of norway0.013953
oslo0.013953
age 30-400.013953
age 50-60 years0.013953
nanning city prefecture0.013953
age<17 years0.013953
atlanta0.013953
kingdom of denmark0.013953
metabolic syndrome0.013953
denver0.013953
commonwealth of pennsylvania0.013953
diet0.013953
australia0.013953
state of oklahoma0.013953
food allergy0.013953
age 4-10 years0.013953
age 5-13 years0.013953
LOWER IN homosexual0.013953
LOWER IN msm0.013953
amsterdam0.013953
kingdom of the netherlands0.013953
LOWER IN child0.013953
age 130.013953
juvenile organism0.013953
finland0.013953
research facility0.013953
caecum0.013953
fresh water0.013953
state of arizona0.009302
age 200.009302
canada0.009302
atherosclerosis0.009302
age 17-290.009302
italy0.009302
rem sleep behavior disorder0.009302
brazil0.009302
type 2 diabetes mellitus0.009302
body mass index0.009302
age 13-140.009302
sichuan province0.009302
LOWER IN adult0.009302
animal product diet0.009302
state of alabama0.009302
ulcerative colitis0.009302
guangzhou city prefecture0.009302
LOWER IN hiv infection0.009302
hispanic or latin american0.009302
ecuador0.009302
urocyon littoralis catalinae0.009302
santa catalina island fox0.009302
santa catalina island0.009302
Exp. ID User ID Description Date Region Flag Sequences
689amnon high in non c. diff diarrhea compared to clostridium difficile infection clostridium difficile colitis in diarrhea hospital adult tucson united states of america feces homo sapiens 2028-03-11v4No1 / -6
74amnondominant united states of america, feces, homo sapiens2017-02-27v4No1 / 7
131amnonnegatively correlated with waist circumference ( high in small waist circumference compared to waist circumference large waist circumference in homo sapiens feces south korea )2017-04-16v4No1 / 7
289amnondominant homo sapiens, feces, adult, united states of america, state of michigan2018-02-01v4No1 / 9
368amnondominant feces, homo sapiens, commonwealth of virginia, united states of america, adult, systemic lupus erythematosus2018-09-03v4No1 / 9
400amnonhigh freq. in feces of european american females (dominant homo sapiens, feces, united states of america, adult, female)2018-11-18v4No1 / 9
591amnondominant homo sapiens, feces, adult, age 50-80 years, united states of america, control2020-02-17v4No1 / 9
663amnondominant low bmi, switzerland, adult, feces, homo sapiens2020-09-22v4No1 / 9
215amnondominant homo sapiens, feces, united states of america2017-10-23v4No1 / 10
368amnondominant feces, homo sapiens, commonwealth of virginia, united states of america, adult, control2018-09-03v4No1 / 10
430amnondominant homo sapiens, adult, united states of america, state of arizona, city, age 20, feces2018-12-15v4No1 / 10
663amnondominant poland, obese body mass index status, obesity, adult, feces, homo sapiens2020-09-22v4No1 / 10
663amnondominant poland, low bmi, adult, feces, homo sapiens2020-09-22v4No1 / 10
438amnondominant homo sapiens, feces, age 19-24, china2018-12-30v4No1 / 11
438amnondominant feces, homo sapiens, age 60-79, adult, jiangsu province, china2018-12-30v4No1 / 11
455amnondominant homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 11
477amnondominant homo sapiens, feces, adult, united states of america2019-01-28v4No1 / 11
482amnondominant homo sapiens, feces, colombia, medellin metropolitan area, child, daycare, age 1-5 years2019-02-12v4No1 / 11
484amnondominant feces, adult, age 17-29, united states of america, state of michigan, homo sapiens2019-02-13v4No1 / 12
650amnondominant state of new york, european, caucasian, united states of america, homo sapiens, adult, feces2020-09-09v4No1 / 12
663amnondominant obese body mass index status, obesity, switzerland, adult, feces, homo sapiens2020-09-22v4No1 / 12
122amnondominant homo sapiens, feces, united kingdom2017-04-13v4No1 / 13
247amnondominant homo sapiens, italy, feces, high bmi, obesity2017-11-21v4No1 / 13
249amnondominant homo sapiens, feces, united states of america2017-11-22v4No1 / 13
330amnondominant homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-13v4No1 / 13
393amnondominant homo sapiens, feces, united states of america, adult, state of colorado, city, msw, heterosexual2018-11-06v4No1 / 13
591amnondominant homo sapiens, feces, adult, age 50-80 years, united states of america, parkinson's disease2020-02-17v4No1 / 13
607amnondominant germany, homo sapiens, feces, rem sleep behavior disorder2020-04-19v4No1 / 13
120amnondominant homo sapiens, feces, brazil2017-04-12v4No1 / 14
284amnondominant homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 14
286amnonhigh freq. in feces of individuals without kidney stones (dominant homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, control, china)2018-01-27v4No1 / 14
297amnondominant homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 14
467amnondominant homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 14
132amnondominant homo sapiens, feces, united states of america2017-04-16v4No1 / 15
344amnonhigh freq. in feces of heterosexuals (dominant homo sapiens, feces, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 15
601amnondominant homo sapiens, feces, china, adult, type 2 diabetes mellitus2020-03-30v4No1 / 15
239amnondominant homo sapiens, feces, united states of america2017-11-08v4No1 / 16
395amnondominant homo sapiens, feces, united states of america, commonwealth of pennsylvania, control2018-11-14v4No1 / 16
650amnonpositively correlated with BMI ( high in high bmi body mass index compared to low bmi in feces adult homo sapiens united states of america state of new york )2020-09-09v4No1 / 18
131amnondominant homo sapiens, feces, south korea2017-04-16v4No1 / 19
601amnondominant homo sapiens, feces, china, adult, control2020-03-30v4No1 / 19
438amnondominant homo sapiens, feces, jiangsu province, age 13-14, china2018-12-30v4No1 / 21
36amnonhigher in centernarians ( high in centererians compared to adult in homo sapiens feces sichuan province )2016-12-06v4No1 / 22
63amnon high in animal product diet diet compared to plant based diet in homo sapiens united states of america feces 2017-04-12v4No1 / 24
51amnoncommon homo sapiens, biopsy site, biopsy, united states of america2017-01-19v4No1 / 30
297amnon high in control compared to crohn's disease ulcerative colitis in homo sapiens feces obsolete_juvenile stage age<17 years united states of america atlanta child 2018-02-12v4No1 / 30
390amnoncommon homo sapiens, feces, australia, hospital, diarrhea2018-11-04v4No1 / 30
401amnonlower in endospore enriched (lysis resistant) replicates ( high in control compared to endospore enriched fraction lysis in homo sapiens feces united states of america adult )2018-11-18v4No1 / 33
51amnoncommon feces, homo sapiens, united states of america2017-01-19v4No1 / 34
36amnoncommon homo sapiens, feces, sichuan province2016-12-06v4No1 / 36
591amnoncommon homo sapiens, feces, adult, age 50-80 years, united states of america, parkinson's disease2020-02-17v4No1 / 39
651amnoncommon parkinson's disease, state of alabama, united states of america, adult, feces, homo sapiens2020-09-13v4No1 / 41
650amnoncommon african american, state of new york, united states of america, homo sapiens, adult, feces2020-09-09v4No1 / 44
292amnoncommon homo sapiens, adult, feces, ulcerative colitis, china2018-02-05v4No1 / 45
333amnoncommon in stroke patient feces (common feces, homo sapiens, stroke, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 45
131amnon high in female compared to male in homo sapiens feces south korea 2017-04-16v4No1 / 47
292amnoncommon homo sapiens, adult, feces, crohn's disease, china2018-02-05v4No1 / 47
390amnoncommon homo sapiens, feces, australia, hospital, salmonella gastroenteritis, diarrhea2018-11-04v4No1 / 47
591amnoncommon homo sapiens, feces, adult, age 50-80 years, united states of america, control2020-02-17v4No1 / 48
650amnoncommon state of new york, european, caucasian, united states of america, homo sapiens, adult, feces2020-09-09v4No1 / 48
651amnoncommon control, state of alabama, united states of america, adult, feces, homo sapiens2020-09-13v4No1 / 50
333amnoncommon in healthy controls feces (common homo sapiens, feces, guangzhou city prefecture, adult, control, china)2018-05-15v4No1 / 53
502amnoncommon homo sapiens, feces, adult, united states of america, schizophrenia2019-03-12v4No1 / 55
242amnoncommon in native-americans (common homo sapiens, feces, united states of america, state of oklahoma, native american, arapaho, cheyenne)2017-11-14v4No1 / 57
51amnon high in control compared to hiv infection in homo sapiens feces united states of america 2017-01-19v4No1 / 61
22amnon high in control compared to hiv infection in united states of america feces homo sapiens 2016-11-28v4No1 / 62
594amnon high in yaounde city compared to rural community ngoantet in adult cameroon feces homo sapiens 2020-03-12v4No1 / 62
644amnoncommon adult, united states of america, hispanic or latin american, feces, homo sapiens2020-08-31v4No1 / 63
663amnoncommon obese body mass index status, obesity, switzerland, adult, feces, homo sapiens2020-09-22v4No1 / 63
395amnoncommon homo sapiens, feces, united states of america, commonwealth of pennsylvania, control2018-11-14v4No1 / 67
74amnoncommon united states of america, feces, homo sapiens2017-02-27v4No1 / 68
484amnoncommon feces, united states of america, adult, state of michigan, age 17-29, homo sapiens2019-02-13v4No1 / 68
516amnoncommon homo sapiens, feces, united states of america, state of ohio, adult2019-05-29v4No1 / 69
401amnoncommon homo sapiens, feces, united states of america, adult2018-11-18v4No1 / 71
404amnoncommon homo sapiens, feces, colombia, city, adult2018-11-20v4No1 / 71
292amnoncommon homo sapiens, adult, feces, control, china2018-02-05v4No1 / 73
643amnoncommon adult, south korea, feces, homo sapiens2020-08-30v4No1 / 73
695amnoncommon sesame allergy, food allergy, age 4-10 years, child, israel, feces, homo sapiens2028-03-27v4No1 / 73
344amnoncommon in feces of heterosexuals (common homo sapiens, feces, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 74
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, control2018-09-03v4No1 / 74
562amnoncommon feces, quito, ecuador, child, age 5-13 years2019-11-05v4No1 / 74
502amnoncommon homo sapiens, feces, adult, united states of america, control2019-03-12v4No1 / 75
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msw, heterosexual2018-11-06v4No1 / 76
247amnoncommon homo sapiens, italy, feces, high bmi, obesity2017-11-21v4No1 / 77
601amnoncommon homo sapiens, feces, china, adult, type 2 diabetes mellitus2020-03-30v4No1 / 77
629amnon high in heterosexual msw compared to homosexual msm in male adult amsterdam kingdom of the netherlands feces homo sapiens 2020-05-31v4No1 / 77
663amnoncommon low bmi, switzerland, adult, feces, homo sapiens2020-09-22v4No1 / 77
249amnoncommon homo sapiens, feces, united states of america2017-11-22v4No1 / 78
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, control2018-11-06v4No1 / 78
430amnoncommon homo sapiens, adult, united states of america, state of arizona, city, age 20, feces2018-12-15v4No1 / 79
62amnon high in united states of america compared to egypt in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 80
487amnoncommon homo sapiens, feces, united states of america, metabolic syndrome, metabolic syndrome x2019-02-24v4No1 / 80
582amnoncommon urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, urocyon littoralis, perianal skin, rectum2020-01-22v4No1 / 80
293amnoncommon homo sapiens, feces, adult, united states of america, american diet2018-02-07v4No1 / 81
629amnoncommon female, amsterdam, kingdom of the netherlands, adult, feces, homo sapiens2020-05-31v4No1 / 81
303amnoncommon homo sapiens, feces, germany, adult2018-03-12v4No1 / 85
428amnoncommon homo sapiens, adult, feces, nanchang city prefecture, control, china2018-12-09v4No1 / 85
601amnoncommon homo sapiens, feces, china, adult, control2020-03-30v4No1 / 85
400amnoncommon in feces of european american females (common homo sapiens, feces, united states of america, adult, female)2018-11-18v4No1 / 87
695amnoncommon milk allergy, food allergy, age 4-10 years, child, israel, feces, homo sapiens2028-03-27v4No1 / 87
238amnoncommon homo sapiens, feces, colombia2017-11-07v4No1 / 88
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 89
409amnoncommon homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v4No1 / 89
629amnoncommon msw, heterosexual, amsterdam, kingdom of the netherlands, adult, feces, homo sapiens2020-05-31v4No1 / 89
663amnoncommon poland, low bmi, adult, feces, homo sapiens2020-09-22v4No1 / 90
438amnoncommon homo sapiens, feces, age 19-24, china2018-12-30v4No1 / 93
702amnon high in felis catus cat compared to canis lupus familiaris dog in state of north carolina united states of america feces 2028-04-02v4No1 / 93
477amnoncommon homo sapiens, feces, adult, united states of america2019-01-28v4No1 / 95
580amnoncommon homo sapiens, feces, israel, adult, female, pregnancy, third trimester2020-01-14v4No1 / 95
284amnoncommon homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 97
344amnonlower in gay (msm) individuals compared to heterosexual (msw) ( high in heterosexual msw compared to gay msm homosexual in homo sapiens feces united states of america state of colorado denver )2018-05-31v4No1 / 98
438amnoncommon homo sapiens, feces, jiangsu province, child, age 8-12, china2018-12-30v4No1 / 98
683amnoncommon state of california, united states of america, adult, feces, homo sapiens2028-03-04v4No1 / 98
215amnoncommon homo sapiens, feces, united states of america2017-10-23v4No1 / 99
393amnon high in heterosexual msw compared to gay homosexual msm in homo sapiens feces united states of america adult state of colorado city 2018-11-06v4No1 / 99
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child ulcerative colitis inflammatory bowel disease crohn's disease in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 99
398amnoncommon in feces of healthy adults from belgium (common homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 99
409amnoncommon homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 100
695amnon high in milk allergy compared to sesame allergy in food allergy age 4-10 years child israel feces homo sapiens 2028-03-27v4No1 / 100
289amnoncommon homo sapiens, feces, adult, united states of america, state of michigan2018-02-01v4No1 / 101
438amnoncommon homo sapiens, feces, jiangsu province, child, age 3-6, china2018-12-30v4No1 / 101
53amnoncommon homo sapiens, feces, lima, city, shantytown2017-01-21v4No1 / 102
276amnoncommon feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v4No1 / 102
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to severe ulcerative colitis in homo sapiens child united states of america feces )2018-11-22v4No1 / 102
438amnoncommon feces, homo sapiens, age 60-79, adult, jiangsu province, china2018-12-30v4No1 / 103
580amnoncommon homo sapiens, feces, israel, adult, female, pregnancy, first trimester2020-01-14v4No1 / 104
663amnoncommon poland, obese body mass index status, obesity, adult, feces, homo sapiens2020-09-22v4No1 / 104
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 106
438amnoncommon feces, homo sapiens, jiangsu province, age 30-50, adult, china2018-12-30v4No1 / 107
239amnoncommon homo sapiens, feces, united states of america2017-11-08v4No1 / 109
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 110
410amnonlower in feces compared to rectal biopsies in children with treatment naive uc ( high in rectum biopsy biopsy site compared to feces in homo sapiens child united states of america ulcerative colitis )2018-11-22v4No1 / 110
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 112
438amnoncommon feces, homo sapiens, age >94, jiangsu province, adult, china2018-12-30v4No1 / 113
449amnoncommon homo sapiens, feces, colombia2019-01-09v4No1 / 116
73amnonhigh in healthy adult controls compared to children with Crohn's disease ( high in control adult compared to obsolete_juvenile stage child crohn's disease in glasgow feces homo sapiens )2017-02-26v4No1 / 117
607amnoncommon germany, homo sapiens, feces, parkinson's disease2020-04-19v4No1 / 117
131amnoncommon homo sapiens, feces, south korea2017-04-16v4No1 / 120
607amnoncommon germany, homo sapiens, feces, control2020-04-19v4No1 / 120
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-13v4No1 / 122
660amnonlower in the cross cutcu population (more modern) comparen to upano valley (less modern) ( high in upano valley compared to cross-cutucu in shuar population village rural community ecuador feces homo sapiens )2020-09-20v4No1 / 124
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 126
438amnoncommon homo sapiens, feces, jiangsu province, age 13-14, china2018-12-30v4No1 / 126
607amnoncommon germany, homo sapiens, feces, rem sleep behavior disorder2020-04-19v4No1 / 126
400amnonhigher in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in hmong china compared to karen myanmar in homo sapiens feces thailand rural community )2018-11-18v4No1 / 127
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, finland2017-09-12v4No1 / 128
644amnonhigher in individuals born in mexico compared to cuba ( high in mexico compared to cuba in adult united states of america hispanic or latin american feces homo sapiens )2020-08-31v4No1 / 128
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 129
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 130
197amnon high in finland compared to india in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 130
721amnoncommon obesity, overweight body mass index status, adult, scotland, gaz:00052100, feces, homo sapiens2028-05-23v4No1 / 131
132amnoncommon homo sapiens, feces, united states of america2017-04-16v4No1 / 137
330amnon high in adult age 30-40 compared to infant age 1 year in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 137
74amnonHigher in animal product diet compared to plant diet ( high in diet animal product diet compared to plant diet in homo sapiens feces united states of america )2017-02-27v4No1 / 141
73amnoncommon homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 142
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 149
292amnon high in control compared to crohn's disease ulcerative colitis in homo sapiens adult feces china 2018-02-05v4No1 / 153
290amnoncommon homo sapiens, feces, adult, city, china2018-02-01v4No1 / 154
297amnoncommon homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 154
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 160
241amnonlower in babies from russia compared to estonia ( high in estonia compared to russia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 161
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 162
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in homo sapiens feces infant )2017-11-13v4No1 / 165
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 175
312amnoncommon feces, homo sapiens, french republic, adult, spondyloarthritis, spondylitis2018-04-09v4No1 / 189
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 200
669amnon high in age 1 year compared to age 2 months in sweden infant feces homo sapiens 2020-09-26v4No1 / 205
520amnonhigher in gastric cancer compared to paired normal tissue ( high in gastric carcinoma stomach neoplasm compared to control in homo sapiens zhejiang province stomach adult china )2019-06-26v3No1 / 206
108amnoncommon research facility, texas, united states of america, caecum, coturnix coturnix, common quail2017-04-07v4No1 / 208
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 208
290amnoncommon homo sapiens, feces, adult, small village, rural community, china2018-02-01v4No1 / 210
566amnoncommon feces, china, homo sapiens, adult2019-11-24v4No1 / 213
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 219
53amnon high in shantytown lima compared to el salado small village in homo sapiens feces city 2017-01-21v4No1 / 229
438amnonhigher in students and soldiers age 19-24 compared to older adults ( high in age 19-24 soldiers compared to adult age 30-50 age 60-79 age >94 in homo sapiens feces china )2018-12-30v4No1 / 230
286amnoncommon in feces of individuals with kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, nephrolithiasis, china)2018-01-27v4No1 / 231
161amnoncommon in barn swallows in colorado (common hirundo rustica, feces, united states of america, colorado, barn swallow)2017-07-12v4No1 / 237
351amnoncommon sea urchin, lytechinus variegatus, coelomic fluid, research facility, eagle harbor, state of florida, united states of america2018-07-30v4No1 / 241
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces infant india )2016-12-19v4No1 / 245
286amnoncommon in feces of individuals without kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, control, china)2018-01-27v4No1 / 273
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 280
477amnon high in united states of america compared to nepal himalayas rural community in homo sapiens feces adult 2019-01-28v4No1 / 287
683amnonlower in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in control compared to metronidazole neomycin vancomycin antibiotic in state of california united states of america adult feces homo sapiens )2028-03-04v4No1 / 294
510amnoncommon kingdom of spain, water, estuary, estuary water, fresh water, salinity <5 ppt, bilbao2019-03-20v4No1 / 309
299amnon high in mouth neoplasm cancer compared to control in saliva adult homo sapiens china 2018-02-27v4No1 / 311
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 320
400amnonlower in people from thailand compared to 2nd generation immigrants to usa ( high in united states of america compared to thailand rural community in homo sapiens feces )2018-11-18v4No1 / 335
122amnonnegatively correlated with bmi ( high in body mass index low bmi compared to high bmi in homo sapiens feces united kingdom )2017-04-13v4No1 / 337
521amnonhigher in pre-weaned pigs compared to weaned older timepoints ( high in suckling preweaned age 2-4 weeks compared to weaned corn and soybean diet age 4-7 weeks in pig sus scrofa feces farm jiangxi province china )2019-07-02v3No1 / 339
254amnonhigher in river when close to populated region compared to downstream ( high in city populated place upstream compared to downstream in river water fresh water depth 0.5m jiulong river fujian province china )2017-11-23v4No1 / 348
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 365
160amnoncommon in river water upstream of WTP effluent in autumn in china (common river, water, autumn, china)2017-07-12v4No1 / 368
108amnon high in caecum compared to colon in research facility texas united states of america coturnix coturnix common quail 2017-04-07v4No1 / 372
293amnonhigher in caloric restriction (CRON) diet compared to american diet ( high in cron diet caloric restriction diet diet compared to american diet in homo sapiens adult feces united states of america )2018-02-07v4No1 / 373
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 379
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 382
582amnon high in perianal skin rectum compared to ear canal external acoustic meatus in wild united states of america santa catalina island urocyon littoralis santa catalina island fox urocyon littoralis catalinae 2020-01-22v4No1 / 392
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 408
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-06v4No1 / 409
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 414
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 449
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 451
160amnoncommon in wastewater treatment plant effluent in autumn in china (common autumn, wastewater treatment plant, effluent, china)2017-07-12v4No1 / 461
650amnon high in european caucasian compared to asian in feces adult homo sapiens united states of america state of new york 2020-09-12v4No1 / 467
438amnon high in age 30-50 age 60-79 adult compared to age 3-6 age 8-12 child in homo sapiens feces china 2018-12-30v4No1 / 478
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 537
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 549
425amnon high in central african republic bangui compared to madagascar antananarivo in homo sapiens feces africa child 2018-12-08v4No1 / 556
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 559
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in kingdom of spain water estuary estuary water bilbao 2019-03-20v4No1 / 584
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 744
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 828
767sheryoCommon in soil planted with Chrysanthemum, fertilized with bio-organic fertilizer in Nanjing China (common paenibacillus polymyxa, paenibacillus, compost, compost biofilter, pig manure, bio-organic fertilizer, soil, ph 6.9, chrysanthemum morifolium ramat., chrysanthemum, china, nanjing county)2021-04-14v4No1 / 866
767sheryoCommon in soil planted with Chrysanthemum, amended with soil fumigant 'Dazomet' in Nanjing China (common nanjing county, china, chrysanthemum, chrysanthemum morifolium ramat., ph 6.9, soil, soil fumigation, dazomet)2021-04-14v4No1 / 946
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1006

Problems / suggestions? Please email info AT dbbact DOT org