Search result for sequence:
TACGGAGGGAGCTAGCGTTATTCGGAATTACTGGGCGTAAAGCGCACGTAGGCGGCTTTGTAAGTAAGAGGTGAAAGCCCAGAGCTCAACTCTGGAATTGCCTTTTAGACTGCATCGCTTGAATCATGGAGAGGTCAGTGGAATTCCGAG
common ontology terms
term enrichment score
TermScore
canada0.336356
skin0.308370
leaf0.184615
united states of america0.182009
plant0.136808
captive0.114519
soil0.113636
farm0.111628
air0.108720
african lion safari0.107744
whole body0.107595
china0.102916
zoological garden0.102752
poland0.101695
beetle0.096774
tree0.093333
river0.091205
pair of nares0.085258
water0.084369
populus0.083045
toronto zoo0.083045
state of idaho0.076655
kingdom of spain0.075710
state of tennessee0.073846
herbivorous beetle0.070175
fresh water0.069346
horse0.067797
equus caballus0.066667
cultivated environment0.066482
nida basin0.063604
rhizosphere0.062500
united kingdom0.058920
nasal cavity0.057266
pyrenees0.056940
southern united states0.056940
stem0.056404
belgium0.056404
snake0.055363
homo sapiens0.052941
adult0.050019
commonwealth of virginia0.049558
root0.048069
israel0.047404
cambridgeshire0.043321
koshi river0.043321
brassicaceae0.043321
boechera stricta0.043321
wheat0.043321
wild0.043143
french republic0.043011
triticum aestivum0.042857
newt0.042403
mucus0.042403
nepal0.042403
dog0.041522
depth 10 cm0.041522
canis lupus familiaris0.040404
city0.039867
mouth0.036585
populus trichocarpa x deltoides0.036364
urocyon littoralis catalinae0.036364
santa catalina island fox0.036364
santa catalina island0.036364
urocyon littoralis0.036364
ivy0.036364
hedera ibernica0.036364
carnivorous beetle0.036364
switzerland0.035714
pasture0.035714
greenhouse0.035714
austria0.033898
state of california0.033708
seed0.029520
tributary0.029304
kingdom of the netherlands0.029304
food product type0.029304
agave0.029304
raba river0.029304
guizhou province0.029304
kaiyang county0.029304
maize field0.029304
mexico0.029091
biofilm0.028881
LOWER IN soil0.028881
bos taurus0.028470
sus scrofa0.028269
pig0.028269
autumn0.028070
summer0.027682
desert0.027304
state of florida0.027119
feces0.024341
dust0.022263
building0.022263
merlot0.022140
grapevine0.022140
lissotriton vulgaris0.022140
triturus cristatus0.022140
alfalfa sprouts0.022140
medicago sativa0.022140
Fraction of dbbact annotations with this term covered by the query
TermScore
canada1.333333
pair of nares0.727273
seed0.666667
floor0.666667
dust0.666667
building0.666667
LOWER IN nasopharynx0.666667
rana catesbeiana0.666667
bullfrog0.666667
nasal cavity0.555556
air0.545455
populus0.500000
populus deltoides0.500000
merlot0.500000
grapevine0.500000
leaf0.500000
macropus rufus0.500000
red kangaroo0.500000
african lion safari0.500000
toronto zoo0.500000
wild horse0.500000
arctic wolf0.500000
canis lupus arctos0.500000
lissotriton vulgaris0.500000
cambridgeshire0.500000
triturus cristatus0.500000
tragelaphus oryx0.500000
eland0.500000
equus asinus africanus0.500000
donkey0.500000
anaxyrus americanus0.500000
american toad0.500000
pyrenees0.500000
spring0.500000
poland0.500000
plant0.500000
nida basin0.500000
herbivorous beetle0.500000
cheilotoma musciformis0.500000
centricnemus leucogrammus0.500000
sciurus carolinensis0.500000
eastern gray squirrel0.500000
ammotragus lervia0.500000
barbary sheep0.500000
populus trichocarpa x deltoides0.500000
crioceris duodecimpunctata0.500000
ixodes ricinus0.500000
castor bean tick0.500000
polydrusus inustus0.500000
koshi river0.500000
tributary0.500000
rangifer tarandus0.500000
reindeer0.500000
cloud0.500000
lapland0.500000
crioceris quatuordecimpunctata0.500000
urocyon littoralis catalinae0.500000
santa catalina island fox0.500000
santa catalina island0.500000
urocyon littoralis0.500000
brassicaceae0.500000
boechera stricta0.500000
state of idaho0.500000
ivy0.500000
hedera ibernica0.500000
eusomus ovulum0.500000
pseudacris crucifer0.500000
peeper0.500000
kingdom of the netherlands0.500000
water pipes0.500000
camelus bactrianus0.500000
bactrian camel0.500000
food product type0.500000
alfalfa sprouts0.500000
medicago sativa0.500000
producer c20.500000
myrtillocactus geometrizans0.500000
opuntia robusta0.500000
root interior0.500000
orchesella cincta0.500000
springtail0.500000
age < 3 months0.500000
maryland county0.500000
ixodes scapularis0.500000
pixr immunized0.500000
LOWER IN reproductive organ0.500000
LOWER IN reproductive system0.500000
LOWER IN genitalia0.500000
gallbladder0.500000
bile0.500000
producer c10.500000
vigna radiata0.500000
mung bean sprouts0.500000
junco hyemalis0.500000
songbird0.500000
reproductive system0.500000
reproductive organ0.500000
genitalia0.500000
agave0.500000
agave deserti0.500000
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.279245
skin0.264151
canada0.192453
leaf0.113208
zoological garden0.105660
captive0.105660
china0.094340
soil0.094340
plant0.079245
farm0.075472
whole body0.064151
african lion safari0.060377
air0.060377
water0.060377
poland0.056604
beetle0.056604
homo sapiens0.056604
tree0.052830
river0.052830
adult0.049057
state of tennessee0.045283
populus0.045283
cultivated environment0.045283
toronto zoo0.045283
kingdom of spain0.045283
pair of nares0.045283
fresh water0.041509
state of idaho0.041509
equus caballus0.037736
horse0.037736
herbivorous beetle0.037736
rhizosphere0.037736
united kingdom0.033962
nida basin0.033962
stem0.030189
pyrenees0.030189
nasal cavity0.030189
belgium0.030189
snake0.030189
southern united states0.030189
commonwealth of virginia0.026415
wild0.026415
israel0.026415
root0.026415
canis lupus familiaris0.022642
dog0.022642
newt0.022642
cambridgeshire0.022642
mucus0.022642
depth 10 cm0.022642
koshi river0.022642
nepal0.022642
french republic0.022642
brassicaceae0.022642
boechera stricta0.022642
city0.022642
mouth0.022642
feces0.022642
triticum aestivum0.022642
wheat0.022642
populus trichocarpa x deltoides0.018868
switzerland0.018868
pasture0.018868
urocyon littoralis catalinae0.018868
santa catalina island fox0.018868
santa catalina island0.018868
urocyon littoralis0.018868
ivy0.018868
hedera ibernica0.018868
state of california0.018868
austria0.018868
greenhouse0.018868
carnivorous beetle0.018868
bos taurus0.015094
tributary0.015094
autumn0.015094
saliva0.015094
kingdom of the netherlands0.015094
biofilm0.015094
summer0.015094
food product type0.015094
seed0.015094
mexico0.015094
research facility0.015094
control0.015094
agave0.015094
desert0.015094
sus scrofa0.015094
pig0.015094
raba river0.015094
LOWER IN soil0.015094
state of florida0.015094
guizhou province0.015094
kaiyang county0.015094
maize field0.015094
felis catus0.011321
merlot0.011321
vitis vinifera0.011321
grapevine0.011321
new york0.011321
Exp. ID User ID Description Date Region Flag Sequences
462amnondominant united states of america, state of tennessee, populus, tree, stem, populus deltoides, cultivated environment2019-01-13v4No1 / 3
565amnondominant skin, canada, equus caballus, horse, farm2019-11-21v3No1 / 7
565amnondominant skin, canada, canis lupus familiaris, dog2019-11-21v3No1 / 7
565amnondominant skin, canada, felis catus, cat2019-11-21v3No1 / 8
101amnoncommon merlot, vitis vinifera, grapevine, new york, united states of america, leaf2017-04-03v4No1 / 9
565amnondominant skin, canada, macropus rufus, red kangaroo, zoological garden, captive, african lion safari2019-11-21v3No1 / 9
565amnondominant skin, canada, zoological garden, captive, toronto zoo, equus przewalskii, wild horse2019-11-21v3No1 / 9
565amnondominant skin, canada, zoological garden, captive, toronto zoo, arctic wolf, canis lupus arctos2019-11-21v3No1 / 9
353amnonhigh freq. in wild Lissotriton vulgaris newts skin (dominant newt, adult, skin, lissotriton vulgaris, cambridgeshire, united kingdom)2018-07-30v4No1 / 10
353amnonhigh freq. in wild Triturus cristatus newts skin (dominant newt, adult, skin, cambridgeshire, triturus cristatus, united kingdom)2018-07-30v4No1 / 10
565amnondominant skin, canada, zoological garden, captive, tragelaphus oryx, eland, toronto zoo2019-11-21v3No1 / 10
565amnondominant skin, canada, equus asinus africanus, donkey, farm2019-11-21v3No1 / 10
99amnondominant commonwealth of virginia, united states of america, skin, mucus, anaxyrus americanus, american toad2017-04-02v4No1 / 11
403amnondominant air, kingdom of spain, pyrenees, spring2018-11-18v4No1 / 11
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, cheilotoma musciformis2019-04-18v4No1 / 11
515amnondominant poland, whole body, beetle, plant, nida basin, herbivorous beetle, centricnemus leucogrammus2019-04-18v4No1 / 11
565amnondominant skin, canada, sciurus carolinensis, eastern gray squirrel2019-11-21v3No1 / 11
565amnondominant skin, canada, ammotragus lervia, barbary sheep, zoological garden, captive, african lion safari2019-11-21v3No1 / 11
565amnondominant skin, canada, captive, panthera leo, lion, zoological garden, toronto zoo2019-11-21v3No1 / 11
462amnondominant united states of america, state of tennessee, populus, tree, populus trichocarpa x deltoides, stem, cultivated environment2019-01-13v4No1 / 12
515amnondominant poland, whole body, beetle, plant, nida basin, herbivorous beetle, crioceris duodecimpunctata2019-04-18v4No1 / 12
565amnondominant skin, acinonyx jubatus, cheetah, canada, zoological garden, captive, african lion safari2019-11-21v3No1 / 12
565amnondominant skin, canada, farm, bos taurus, cow2019-11-21v3No1 / 12
595amnondominant ixodes ricinus, castor bean tick, whole body, switzerland2020-03-16v4No1 / 12
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, polydrusus inustus2019-04-18v4No1 / 13
534amnondominant river, water, fresh water, depth 10 cm, koshi river, tributary, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 13
384amnondominant equus caballus, horse, canada, farm, nasal cavity, pair of nares, pasture2018-10-22v4No1 / 14
403amnondominant air, kingdom of spain, pyrenees, winter2018-11-18v4No1 / 14
565amnondominant skin, canada, captive, zoological garden, rangifer tarandus, reindeer, african lion safari2019-11-21v3No1 / 14
253amnonhigh freq. in clouds in puy de dome mountain in france (dominant cloud, french republic, air, autumn)2017-11-22v4No1 / 15
462amnondominant united states of america, state of tennessee, populus, tree, leaf, cultivated environment2019-01-13v4No1 / 15
511amnondominant snow, depth 0-5cm, lapland, finland, sweden, kingdom of norway2019-03-20v4No1 / 15
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, crioceris quatuordecimpunctata2019-04-18v4No1 / 15
534amnondominant river, water, fresh water, depth 10 cm, koshi river, tributary, nepal, particle bound, filtered 2.7um2019-07-22v4No1 / 16
565amnondominant skin, canada, zoological garden, captive, toronto zoo, pongo abelii, sumatran orangutan2019-11-21v3No1 / 16
582amnondominant urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, urocyon littoralis, axilla2020-01-22v4No1 / 16
266amnonhigh freq. on perennial plant leaves (dominant brassicaceae, boechera stricta, plant, leaf, united states of america, state of idaho)2017-12-19v4No1 / 17
128amnondominant belgium, ivy, hedera ibernica, leaf, city, dense settlement biome2017-04-14v4No1 / 18
384amnondominant equus caballus, horse, canada, farm, oral cavity, saliva, pasture, mouth2018-10-22v4No1 / 18
403amnondominant air, kingdom of spain, pyrenees, autumn2018-11-18v4No1 / 18
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, eusomus ovulum2019-04-18v4No1 / 18
565amnondominant skin, canada, zoological garden, captive, african lion safari, giraffa camelopardalis, giraffe2019-11-21v3No1 / 18
99amnondominant commonwealth of virginia, united states of america, skin, mucus, pseudacris crucifer, peeper2017-04-02v4No1 / 19
101amnoncommon united states of america, vitis vinifera, merlot, grapevine, new york, grape, botanical fruit food product2017-04-03v4No1 / 19
178amnonhigh freq. in drinking water pipes biofilm (dominant kingdom of the netherlands, water, drinking water, biofilm, water pipes)2017-08-10v4No1 / 19
565amnondominant skin, canada, captive, zoological garden, african lion safari, camelus bactrianus, bactrian camel2019-11-21v3No1 / 20
565amnondominant skin, canada, zoological garden, captive, african lion safari, ceratotherium simum, white rhinoceros2019-11-21v3No1 / 20
403amnondominant air, kingdom of spain, pyrenees, summer2018-11-18v4No1 / 22
587amnondominant israel, food product type, alfalfa sprouts, medicago sativa, producer c22020-02-10v3No1 / 23
29amnoncommon in various plant seeds ( high in compared to in french republic seed )2016-12-05v4No1 / 26
565amnoncommon skin, canada, felis catus, cat2019-11-21v3No1 / 26
462amnoncommon united states of america, state of tennessee, populus, tree, leaf, cultivated environment2019-01-13v4No1 / 28
129amnonfound INSIDE roots of cactus (common mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, root interior, root)2017-04-15v4No1 / 29
462amnoncommon united states of america, state of tennessee, populus, tree, stem, populus deltoides, cultivated environment2019-01-13v4No1 / 29
364amnoncommon orchesella cincta, springtail, kingdom of denmark, body proper2018-08-29v4No1 / 30
233amnon high in age age < 3 months compared to age > 3 months in feces homo sapiens infant united states of america 2017-11-05v4No1 / 31
101amnoncommon united states of america, leaf, vitis vinifera, merlot, grapevine, new york2017-04-03v4No1 / 32
403amnoncommon air, kingdom of spain, pyrenees, spring2018-11-18v4No1 / 32
37amnoncommon maryland county, leaf, solanum lycopersicum2016-12-09v4No1 / 33
262amnonhigher in tick larvae fed on PIXR immunized mice compared to non immunized ( high in pixr immunized compared to control in tick ixodes scapularis larval stage body proper research facility )2017-12-10v4No1 / 35
231amnonhigher in urine compared to genitalia in dogs ( high in urine compared to reproductive organ reproductive system genitalia in dog canis lupus familiaris united states of america )2017-11-02v4No1 / 36
403amnoncommon air, kingdom of spain, pyrenees, autumn2018-11-18v4No1 / 36
403amnoncommon air, kingdom of spain, pyrenees, summer2018-11-18v4No1 / 39
526amnoncommon in bile of healthy controls (common homo sapiens, gallbladder, bile, adult, kingdom of spain, control)2019-07-14v3No1 / 39
403amnoncommon air, kingdom of spain, pyrenees, winter2018-11-18v4No1 / 42
587amnoncommon israel, food product type, producer c1, vigna radiata, mung bean sprouts2020-02-10v3No1 / 42
595amnoncommon ixodes ricinus, castor bean tick, whole body, switzerland2020-03-16v4No1 / 42
89amnoncommon junco hyemalis, uropygial gland, commonwealth of virginia, songbird2017-03-08v4No1 / 43
231amnoncommon in dog genitalia (common dog, canis lupus familiaris, united states of america, reproductive system, reproductive organ, genitalia)2017-11-02v4No1 / 43
89amnoncommon junco hyemalis, commonwealth of virginia, songbird, cloaca2017-03-08v4No1 / 48
360amnoncommon agave, agave deserti, leaf, leaf endosphere, desert, state of california2018-08-20v4No1 / 48
462amnoncommon united states of america, state of tennessee, populus, tree, populus trichocarpa x deltoides, stem, cultivated environment2019-01-13v4No1 / 48
321amnonhigher in mice treated with ampicillin compared to untreated mice ( high in ampicillin antibiotic compared to control in mus musculus mouse c57bl/6j feces united states of america research facility )2018-04-22v4No1 / 52
279amnon high in mouth compared to small intestine stomach in ochotonidae pikas china 2018-01-24v4No1 / 53
543amnoncommon snow algae, snow field, antarctica, depth 1-5 cm, antarctic peninsula2019-08-01v4No1 / 53
515amnoncommon poland, whole body, beetle, aphthona venustula, plant, nida basin, herbivorous beetle2019-04-18v4No1 / 54
63amnoncommon in skin in american gut (common homo sapiens, skin)2017-02-15v4No1 / 56
308amnoncommon in neonatal intensive care unit floor (common united states of america, state of california, hospital, floor, dust)2018-03-31v4No1 / 57
523amnoncommon air, building, bedroom, united states of america, chicago, state of illinois2019-07-03v4No1 / 58
565amnoncommon skin, canada, equus caballus, horse, farm2019-11-21v3No1 / 58
155amnonlower in bulk soil compared to loose bound root soil ( high in rhizosphere compared to bulk soil in triticum aestivum wheat soil china )2017-07-02v4No1 / 63
536amnoncommon snake, skin, united states of america, southern united states, coluber constrictor, eastern racer snake2019-07-28v4No1 / 64
582amnoncommon urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, urocyon littoralis, lip, labial commissure2020-01-22v4No1 / 68
231amnoncommon in dog urine (common dog, canis lupus familiaris, united states of america, urine)2017-11-02v4No1 / 69
558amnon high in crop compared to gizzard in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 69
462amnon high in populus trichocarpa x deltoides compared to populus deltoides in united states of america state of tennessee populus tree leaf cultivated environment 2019-01-13v4No1 / 76
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, tributary, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 80
269amnonpeaks at 2 weeks in refrigeration of yao meat ( high in middle timepoint two weeks compared to fresh food spoilage late timepoint in china foodon product type )2018-01-09v4No1 / 83
279amnoncommon grassland, leaf, stem, steppe, mongolia, china2018-01-24v4No1 / 83
565amnoncommon skin, canada, canis lupus familiaris, dog2019-11-21v3No1 / 83
565amnoncommon skin, canada, eidolon helvum, fruit bat, zoological garden, toronto zoo, captive2019-11-21v3No1 / 83
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, centricnemus leucogrammus2019-04-18v4No1 / 84
227amnonhiger in first 24hrs compared to later timepoints in baby nasopharynx ( high in age age <=24 hours compared to age >= 7 days in homo sapiens nasopharynx nasal cavity infant kingdom of the netherlands )2017-10-30v4No1 / 85
26amnon high in pair of nares mucus compared to saliva mouth in united states of america felis catus 2016-12-05v4No1 / 86
277amnon high in pair of nares nasal cavity compared to nasopharynx in homo sapiens belgium adult 2018-01-23v4No1 / 86
336amnoncommon feces, qinghai province, anser, goose, greylag goose, china2018-05-16v4No1 / 87
199amnoncommon on shower wall tile (common bathroom, shower, building, tile, urban biome, united states of america, building wall)2017-10-01v4No1 / 90
178amnoncommon in drinking water pipes biofilm (common kingdom of the netherlands, water, drinking water, biofilm, water pipes)2017-08-10v4No1 / 91
582amnoncommon urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, urocyon littoralis, external naris, pair of nares2020-01-22v4No1 / 92
306amnoncommon at whole plant corn at time 0 (common zea mays subsp. mays, corn, whole plant, israel)2018-03-19v4No1 / 96
565amnoncommon skin, canada, captive, zoological garden, rangifer tarandus, reindeer, african lion safari2019-11-21v3No1 / 96
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, rana catesbeiana, bullfrog2017-04-02v4No1 / 99
361amnoncommon leaf, austria, greenhouse, plant, dracaena fragrans2018-08-21v4No1 / 100
536amnoncommon crotalus horridus, snake, skin, united states of america, southern united states, timber rattlesnake2019-07-28v4No1 / 101
536amnoncommon snake, skin, united states of america, southern united states, fossorial snake, storeria dekayi, ground snake2019-07-28v4No1 / 101
361amnoncommon leaf, austria, greenhouse, plant, malvaviscus penduliflorus2018-08-21v4No1 / 102
198amnoncommon yellowstone national park, united states of america, geothermal field, water, hot spring, high temperature environment2017-09-13v4No1 / 103
279amnoncommon ochotonidae, pikas, mouth, china2018-01-24v4No1 / 103
279amnoncommon grassland, tibetan plateau, leaf, stem, kobresia humilis, china2018-01-24v4No1 / 104
565amnoncommon skin, canada, sciurus carolinensis, eastern gray squirrel2019-11-21v3No1 / 104
587amnoncommon israel, food product type, alfalfa sprouts, medicago sativa, producer c12020-02-10v3No1 / 106
256amnonhigher in control diet compared to diet enriched with sucram in pig gut ( high in diet standard feed compared to sucram in gastrointestinal system sus scrofa pig united kingdom )2017-11-26v4No1 / 109
565amnoncommon skin, canada, pteropus giganteus, indian flying fox, zoological garden, captive, african lion safari2019-11-21v3No1 / 109
536amnoncommon snake, skin, united states of america, southern united states, thamnophis sirtalis, common garter snake2019-07-28v4No1 / 110
536amnoncommon snake, skin, united states of america, southern united states, aquatic snake, nerodia sipedon, northern water snake2019-07-28v4No1 / 111
565amnoncommon skin, canada, zoological garden, captive, toronto zoo, equus przewalskii, wild horse2019-11-21v3No1 / 112
198amnoncommon sediment, yellowstone national park, united states of america, thermophilic sediment, geothermal field, high temperature environment2017-09-13v4No1 / 113
565amnoncommon skin, canada, zoological garden, captive, toronto zoo, arctic wolf, canis lupus arctos2019-11-21v3No1 / 114
492amnoncommon skin, adult, germany, bufo bufo, toad, common toad2019-02-27v4No1 / 115
195amnoncommon in boston subway surfaces (common city, urban biome, train, boston)2017-09-07v4No1 / 116
343amnoncommon in apple flowers (common apple, malus x domestica, flower structure, flower, united states of america, state of connecticut)2018-05-28v4No1 / 118
311amnoncommon united states of america, state of rhode island, scallion, foodon product type2018-04-09v4No1 / 121
565amnoncommon skin, canada, captive, zoological garden, african lion safari, camelus bactrianus, bactrian camel2019-11-21v3No1 / 122
565amnoncommon skin, canada, zoological garden, captive, african lion safari, ceratotherium simum, white rhinoceros2019-11-21v3No1 / 122
557amnoncommon lake, freshwater lake, fresh water, water, french republic, depth 10m2019-09-14v3No1 / 123
565amnoncommon skin, acinonyx jubatus, cheetah, canada, zoological garden, captive, african lion safari2019-11-21v3No1 / 123
582amnoncommon urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, external ear, urocyon littoralis2020-01-22v4No1 / 124
199amnoncommon in kitchen sink (common building, urban biome, united states of america, kitchen, sink)2017-10-01v4No1 / 130
384amnoncommon equus caballus, horse, canada, farm, nasal cavity, pair of nares, barn, hay2018-10-22v4No1 / 131
515amnoncommon carnivorous beetle, river, poland, raba river, whole body, beetle, bembidion modestum2019-04-18v4No1 / 131
176amnoncommon in skin of hairless mice (common mouse, mus musculus, skin, female, skh-1 hairless mouse, dorsum, research facility, united states of america)2017-07-29v4No1 / 133
511amnoncommon snow, depth 0-5cm, united states of america, state of colorado2019-03-20v4No1 / 134
585amnoncommon china, pomacea canaliculata, golden apple snail, nanheng river, qingpu district, buccal mass2020-02-02v3No1 / 136
617amnoncommon alpine pasture, alpine, farm, italy, cow milk (raw), cow milk (fluid), milk2020-05-03v3No1 / 137
63amnon high in female compared to male in homo sapiens skin 2017-02-15v4No1 / 139
582amnoncommon urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, urocyon littoralis, axilla2020-01-22v4No1 / 140
291amnoncommon canis lupus familiaris, dog, pair of nares, nasal cavity, germany2018-02-01v4No1 / 144
29amnoncommon brassica oleracea, french republic, seed2016-12-05v4No1 / 146
475amnoncommon in air next to subway stations in hong kong (common air, hong kong, city)2019-01-20v4No1 / 147
565amnoncommon skin, canada, zoological garden, captive, african lion safari, elephas maximus, asian elephant2019-11-21v3No1 / 149
565amnoncommon skin, canada, captive, panthera leo, lion, zoological garden, toronto zoo2019-11-21v3No1 / 150
361amnoncommon leaf, austria, greenhouse, plant, howea forsteriana2018-08-21v4No1 / 154
361amnoncommon leaf, austria, greenhouse, plant, dracaena draco2018-08-21v4No1 / 155
526amnoncommon in bile of Cholelithiasis patients (common homo sapiens, gallbladder, bile, adult, kingdom of spain, cholelithiasis)2019-07-14v3No1 / 155
266amnoncommon on perennial plant leaves (common brassicaceae, boechera stricta, plant, leaf, united states of america, state of idaho)2017-12-19v4No1 / 156
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, crioceris duodecimpunctata2019-04-18v4No1 / 157
192amnoncommon seed, seed structure, brassica napus2017-09-05v4No1 / 161
475amnoncommon in air in subway train in hong kong (common air, hong kong, city, subway)2019-01-20v4No1 / 161
232amnoncoomon in foot of healthy controls (common homo sapiens, skin, australia, foot)2017-11-05v4No1 / 166
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 172
565amnoncommon skin, canada, zoological garden, captive, toronto zoo, pongo abelii, sumatran orangutan2019-11-21v3No1 / 174
384amnoncommon equus caballus, horse, canada, farm, nasal cavity, pair of nares, pasture2018-10-22v4No1 / 175
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, anaxyrus americanus, american toad2017-04-02v4No1 / 176
536amnoncommon snake, skin, united states of america, southern united states, pantherophis obsoletus, black rat snake, arboreal snake2019-07-28v4No1 / 184
567amnon high in anterior naris pair of nares compared to nasopharynx in homo sapiens adult belgium 2019-12-05v4No1 / 186
567amnon high in control compared to sinusitis chronic rhinosinusitis in homo sapiens adult belgium anterior naris pair of nares 2019-12-05v4No1 / 191
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, tributary, nepal, particle bound, filtered 2.7um2019-07-22v4No1 / 193
585amnoncommon china, pomacea canaliculata, golden apple snail, nanheng river, qingpu district, stomach2020-02-02v3No1 / 194
515amnoncommon bembidion decorum, carnivorous beetle, river, poland, raba river, whole body, beetle2019-04-18v4No1 / 198
384amnoncommon equus caballus, horse, canada, farm, oral cavity, saliva, pasture, mouth2018-10-22v4No1 / 201
515amnon high in herbivorous beetle poland compared to detritivorous beetle bulgaria in whole body beetle 2019-04-19v4No1 / 205
565amnoncommon skin, canada, ammotragus lervia, barbary sheep, zoological garden, captive, african lion safari2019-11-21v3No1 / 205
511amnoncommon snow, depth 0-5cm, lapland, finland, sweden, kingdom of norway2019-03-20v4No1 / 213
587amnoncommon israel, food product type, alfalfa sprouts, medicago sativa, producer c22020-02-10v3No1 / 215
265amnoncommon in tree leaves (common canada, province of quebec, tree, leaf)2017-12-11v4No1 / 226
331amnon high in dry season compared to wet season in feces monkey theropithecus gelada ethiopia 2018-05-13v4No1 / 232
583amnoncommon soil, mountain, switzerland, ph 4-6, depth 0-10cm, elevation 2000-3000m, siliceous parent material, rhone river valley2020-01-27v3No1 / 234
492amnoncommon skin, adult, rana catesbeiana, bullfrog, lithobates catesbeianus, frog, japan2019-02-27v4No1 / 236
536amnoncommon snake, skin, united states of america, southern united states, agkistrodon contortrix, copperhead snake2019-07-28v4No1 / 236
585amnoncommon china, pomacea canaliculata, golden apple snail, nanheng river, qingpu district, intestine2020-02-02v3No1 / 240
384amnon high in pasture compared to barn hay in equus caballus horse canada farm saliva mouth 2018-10-22v4No1 / 245
462amnon high in populus trichocarpa x deltoides compared to populus deltoides in united states of america state of tennessee populus tree stem cultivated environment 2019-01-13v4No1 / 249
432amnoncommon united states of america, plant, state of north carolina, stem, tsuga canadensis, eastern hemlock2018-12-19v4No1 / 251
617amnoncommon lowland pasture, lowland farm, farm, italy, cow milk (raw), cow milk (fluid), milk2020-05-03v3No1 / 257
253amnoncommon in clouds in puy de dome mountain in france (common cloud, french republic, air, autumn)2017-11-22v4No1 / 267
361amnoncommon leaf, austria, greenhouse, plant, chlorophytum comosum2018-08-21v4No1 / 270
384amnoncommon equus caballus, horse, canada, farm, barn, hay, oral cavity, saliva, mouth2018-10-22v4No1 / 274
558amnon high in summer compared to winter in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 274
128amnonhigher in ivy leaves from city compared to moor and forest ( high in city dense settlement biome compared to moor forest ecosystem in belgium ivy hedera ibernica leaf )2017-04-14v4No1 / 287
423amnoncommon bank vole, myodes glareolus, ukraine, skin2018-12-05v4No1 / 291
37amnoncommon in plastic leaf plants (in field next to tomato plants) (common maryland county, leaf)2016-12-09v4No1 / 298
237amnonlower in burrow soil compared to bird ( high in oceanodroma leucorhoa bird seabird compared to soil burrow in canada bon portage island )2017-11-07v4No1 / 298
462amnon high in populus trichocarpa x deltoides compared to populus deltoides in united states of america state of tennessee populus tree root cultivated environment 2019-01-13v4No1 / 300
515amnoncommon carnivorous beetle, river, poland, raba river, whole body, beetle, bembidion punctulatum2019-04-18v4No1 / 305
515amnoncommon carnivorous beetle, river, poland, raba river, whole body, beetle, bembidion varicolor2019-04-18v4No1 / 308
565amnoncommon skin, canada, zoological garden, captive, african lion safari, giraffa camelopardalis, giraffe2019-11-21v3No1 / 310
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, nepal, particle bound, filtered 2.7um2019-07-22v4No1 / 315
565amnoncommon skin, canada, farm, bos taurus, cow2019-11-21v3No1 / 318
311amnoncommon in floor of kimchi production facility (common united states of america, state of rhode island, floor, food processing factory)2018-04-09v4No1 / 324
565amnoncommon skin, canada, equus asinus africanus, donkey, farm2019-11-21v3No1 / 335
175amnonhigher in winter compared to summer in heavy metal contaminated soils in china ( high in winter compared to summer in soil heavy metal china )2017-07-29v4No1 / 337
583amnoncommon soil, mountain, switzerland, depth 0-10cm, elevation 2000-3000m, siliceous parent material, ph 4.5-7, canton of graubunden2020-01-27v3No1 / 359
565amnoncommon skin, canada, macropus rufus, red kangaroo, zoological garden, captive, african lion safari2019-11-21v3No1 / 360
565amnoncommon skin, canada, papio anubis, olive baboon, zoological garden, captive, toronto zoo2019-11-21v3No1 / 368
29amnon high in seed compared to seedling in brassica oleracea french republic 2016-12-05v4No1 / 379
256amnoncommon sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 380
512amnon high in tibetan plateau riganqiao peatland ph 5.5-6.5 compared to hani peatland baekdudaegan ph 5-6 in fen peatland peat soil soil china 2019-03-22v4No1 / 381
612amnoncommon state of florida, united states of america, spring water, water, fresh water, location 52020-04-22v4No1 / 383
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
353amnoncommon in wild Lissotriton vulgaris newts skin (common newt, adult, skin, lissotriton vulgaris, cambridgeshire, united kingdom)2018-07-30v4No1 / 418
612amnoncommon state of florida, united states of america, spring water, water, fresh water, location 32020-04-22v4No1 / 420
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, pseudacris crucifer, peeper2017-04-02v4No1 / 438
577amnon high in hypersaline water high salinity depth 4-9m monimolimnion compared to depth 0-3m mixolimnion low salinity in lake romania ursu lake water lake water 2020-01-09v3No1 / 439
353amnoncommon in wild Triturus cristatus newts skin (common newt, adult, skin, cambridgeshire, triturus cristatus, united kingdom)2018-07-30v4No1 / 456
128amnoncommon belgium, ivy, hedera ibernica, leaf, city, dense settlement biome2017-04-14v4No1 / 461
512amnoncommon fen, peatland, peat soil, soil, ph 5.5-6.5, tibetan plateau, riganqiao peatland, china2019-03-22v4No1 / 483
617amnonlower in cow milk of cows in alpine pasture compared to lowland farm ( high in lowland farm lowland pasture compared to alpine pasture alpine in farm italy cow milk (raw) cow milk (fluid) milk )2020-05-03v3No1 / 484
360amnoncommon agave, desert, leaf, leaf surface, agave salmiana, mexico, guanajuato2018-08-21v4No1 / 492
304amnoncommon united states of america, state of california, beach, pacific ocean, air, aerosol, santa cruz province2018-03-12v4No1 / 518
129amnoncommon mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, leaf2017-04-15v4No1 / 562
536amnon high in terrestrial snake compared to aquatic snake in snake skin united states of america southern united states 2019-07-28v4No1 / 590
265amnonhigher in tree leaves compared to soil and soilwater ( high in leaf tree compared to soil soilwater water in canada province of quebec )2017-12-11v4No1 / 610
128amnoncommon belgium, ivy, hedera ibernica, leaf, moor, scrubland2017-04-14v4No1 / 623
360amnonhigher in leaf surface compared to soil in agave plants ( high in leaf leaf surface compared to soil in desert state of california mexico guanajuato agave )2018-08-21v4No1 / 645
616amnon high in ph 5.5-6 fertilized soil compared to ph 6.7 non-fertilized soil in sugarcane saccharum soil topsoil depth 0-20cm china guangzhou city prefecture 2020-04-27v3No1 / 648
360amnoncommon agave, desert, state of california, agave deserti, leaf, leaf surface2018-08-21v4No1 / 649
200amnoncommon in river downstream of wastewater treatment plant (common river, fresh water, water, united states of america, wastewater treatment plant, effluent)2017-10-01v4No1 / 655
612amnoncommon state of florida, united states of america, spring water, water, fresh water, location 42020-04-22v4No1 / 655
178amnoncommon in drinking water pipe loose deposits (common kingdom of the netherlands, water, deposits, drinking water)2017-08-10v4No1 / 656
565amnoncommon skin, canada, zoological garden, captive, tragelaphus oryx, eland, toronto zoo2019-11-21v3No1 / 674
416amnon high in mulch diet compared to wood diet in termite reticulitermes flaviceps colon research facility united states of america 2018-11-30v4No1 / 681
521amnonlower in pre-weaned pigs compared to weaned older timepoints ( high in weaned age 4-7 weeks corn and soybean diet compared to preweaned suckling age 2-4 weeks in pig sus scrofa feces farm jiangxi province china )2019-07-02v3No1 / 681
128amnoncommon belgium, ivy, hedera ibernica, leaf, forest ecosystem2017-04-14v4No1 / 693
232amnonlower in diabetec patient foot skin compared to healthy controls ( high in control compared to diabetes mellitus in homo sapiens skin australia foot )2017-11-05v4No1 / 708
206amnoncommon in air from israel particles <10um size (common air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 765
157amnoncommon in naers of weened calves (common nasal cavity, bos taurus, calve, united states of america, juvenile organism, pair of nares)2017-07-04v4No1 / 766
384amnon high in pair of nares nasal cavity compared to oral cavity saliva mouth in equus caballus horse canada farm 2018-10-22v4No1 / 791
454amnon high in summer compared to winter in elaphurus davidianus pere deer deer feces china 2019-01-10v4No1 / 791
583amnoncommon soil, mountain, switzerland, depth 0-10cm, elevation 2000-3000m, canton of graubunden, calcareous parent material, ph 7-82020-01-28v3No1 / 830
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 836
517amnon high in skin arm forearm compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 836
266amnoncommon in roots in JAM garden (common brassicaceae, boechera stricta, plant, united states of america, state of idaho, root)2017-12-19v4No1 / 843
462amnon high in leaf compared to stem in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 890
206amnoncommon in dust storm air from israel particles <10um size (common israel, air, size < 10um, dust, dust storm)2017-10-04v4No1 / 902
126amnoncommon rhizosphere, germany, hordeum vulgare, winter barley2017-04-14v4No1 / 925
266amnoncommon in soil from MIL garden (common soil, united states of america, state of idaho, ph 6.5)2017-12-18v4No1 / 980
193amnonhigher in nares of people working in dairy farms ( high in bos taurus farm compared to control in homo sapiens united states of america pair of nares )2017-09-05v4No1 / 992
610sheryoCommon in agricultural field soil amended with straw (common straw, triticum aestivum, ph 7, wheat, kingdom of denmark, agricultural field, soil)2020-04-21v3No1 / 998
610sheryoCommon in agricultural field soil amended with low biochar (common low biochar, triticum aestivum, ph 7, wheat, kingdom of denmark, agricultural field, soil)2020-04-21v3No1 / 1009
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014
266amnoncommon in soil from PAR garden (common soil, united states of america, state of idaho, ph 5.5)2017-12-18v4No1 / 1032
252amnoncommon in river rock biofilm (common kingdom of spain, biofilm, river, rock, epilithic)2017-11-22v4No1 / 1081
266amnoncommon in roots in MAH garden (common brassicaceae, boechera stricta, plant, united states of america, state of idaho, root)2017-12-19v4No1 / 1110
515amnon high in carabidae compared to staphylinidae in whole body beetle carnivorous beetle river poland 2019-04-19v4No1 / 1130
266amnon high in leaf compared to root in brassicaceae boechera stricta plant united states of america state of idaho 2017-12-19v4No1 / 1175
252amnoncommon in river sand biofilm (common river, biofilm, kingdom of spain, sand)2017-11-22v4No1 / 1181
531amnoncommon rhizosphere, greenhouse soil, farm, orthic anthrosol, cucumis sativus, cucumber, china2019-07-21v3No1 / 1223
266amnonCommon in soil from MAH garden (common soil, united states of america, state of idaho, ph 6)2017-12-18v4No1 / 1299
266amnoncommon in soil from SIL garden (common soil, united states of america, state of idaho, ph 6)2017-12-18v4No1 / 1389
266amnoncoomon in roots in SIL garden (common brassicaceae, boechera stricta, plant, united states of america, state of idaho, root)2017-12-19v4No1 / 1399
76amnoncommon in non-seleniferous soil (common soil, rhizosphere, united states of america, non-seleniferous, state of florida)2017-02-28v4No1 / 1414
462amnon high in rhizosphere compared to soil in united states of america state of tennessee populus tree cultivated environment 2019-01-12v4No1 / 1428
266amnoncommon in soil from JAM garden (common soil, united states of america, state of idaho, ph 5.5)2017-12-18v4No1 / 1456
631sheryoCommon in maize field biochar amended rhizosphere soil (common ph 7.85, biochar, rhizosphere, china, guizhou province, kaiyang county, soil, maize field, after 6 years)2020-06-02v3No1 / 1492
76amnonhigher in non-seleniferous soil compared to seleniferous soil ( high in non-seleniferous compared to selenium seleniferous in soil united states of america rhizosphere woodland area )2017-02-28v4No1 / 1621
631sheryocommon in maize field unamended rhizosphere soil (common unamended soil, ph 7.6, rhizosphere, china, guizhou province, kaiyang county, soil, maize field, after 6 years)2020-06-02v3No1 / 1637
616amnoncommon in topsoil of PK/NP/NPK/NK fertilized sugarcane field (common fertilized soil, ph 5.5-6, sugarcane, saccharum, soil, topsoil, depth 0-20cm, china, guangzhou city prefecture)2020-04-27v3No1 / 1710
155amnonhigher in tightly bound root soil compared to loose soil and bulk soil ( high in root compared to bulk soil in triticum aestivum wheat soil china )2017-07-02v4No1 / 1714
631sheryoCommon in maize field unamended bulk soil (common bulk soil, unamended soil, ph 7.9, maize field, soil, kaiyang county, guizhou province, china)2020-06-02v3No1 / 1814
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in newt adult skin cambridgeshire triturus cristatus united kingdom )2018-07-30v4No1 / 1834
631sheryocommon in maize field biochar amended bulk soil, after 6 years of biochar amended (common ph 8, china, guizhou province, kaiyang county, soil, maize field, bulk soil, biochar, after 6 years)2020-06-02v3No1 / 1872
155amnoncommon in soil tightly bound to wheat root (common triticum aestivum, wheat, soil, root, china)2017-07-02v4No1 / 1977
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in newt adult skin cambridgeshire lissotriton vulgaris united kingdom )2018-07-30v4No1 / 2162
155amnoncommon in soil loosely bound to wheat root (common triticum aestivum, wheat, soil, rhizosphere, china)2017-07-02v4No1 / 2425
462amnon high in rhizosphere compared to root in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 4630

Problems / suggestions? Please email info AT dbbact DOT org