Search result for sequence:
TACGGAGGGAGCTAGCGTTATTCGGAATTACTGGGCGTAAAGCGCACGTAGGCGGCTTTGTAAGTAAGAGGTGAAAGCCCAGAGCTCAACTCTGGAATTGCCTTTTAGACTGCATCGCTTGAATCATGGAGAGGTCAGTGGAATTCCGAG
common ontology terms
term enrichment score
TermScore
canada0.393064
skin0.342298
leaf0.206186
united states of america0.181398
plant0.152174
captive0.139303
zoological garden0.122271
air0.121519
african lion safari0.120301
farm0.108905
poland0.107527
beetle0.107527
tree0.104089
whole body0.102041
river0.101449
populus0.093023
toronto zoo0.093023
pair of nares0.088101
kingdom of spain0.086331
state of idaho0.085937
state of tennessee0.081633
china0.080853
horse0.078740
herbivorous beetle0.078740
water0.077419
equus caballus0.077220
soil0.073762
cultivated environment0.072727
nida basin0.071429
united kingdom0.065574
nasal cavity0.064412
stem0.064000
pyrenees0.064000
southern united states0.064000
belgium0.063325
snake0.062016
homo sapiens0.058556
rhizosphere0.057720
adult0.057471
fresh water0.056738
commonwealth of virginia0.055666
root0.054528
cambridgeshire0.048780
koshi river0.048780
brassicaceae0.048780
boechera stricta0.048780
french republic0.048387
newt0.047619
mucus0.047619
nepal0.047619
dog0.046512
depth 10 cm0.046512
canis lupus familiaris0.045113
city0.044776
populus trichocarpa x deltoides0.040984
ivy0.040984
hedera ibernica0.040984
greenhouse0.040984
carnivorous beetle0.040984
mouth0.040404
pasture0.040161
austria0.037879
state of california0.037641
kingdom of the netherlands0.033333
seed0.033333
tributary0.033058
agave0.033058
raba river0.033058
mexico0.032787
LOWER IN soil0.032653
biofilm0.032520
wheat0.032520
bos taurus0.032172
triticum aestivum0.032000
autumn0.031746
sus scrofa0.031746
pig0.031746
summer0.031008
desert0.030534
feces0.027088
dust0.025157
building0.025157
merlot0.025000
grapevine0.025000
new york0.025000
lissotriton vulgaris0.025000
triturus cristatus0.025000
LOWER IN populus deltoides0.025000
urban biome0.025000
LOWER IN mouth0.024896
vitis vinifera0.024691
filtered 0.2um0.024691
depth 0-5cm0.024691
particle bound0.024691
filtered 2.7um0.024691
dense settlement biome0.024691
tibetan plateau0.024691
foot0.024691
leaf surface0.024691
felis catus0.024540
Fraction of dbbact annotations with this term covered by the query
TermScore
canada2.000000
pair of nares0.700000
kingdom of the netherlands0.666667
seed0.666667
floor0.666667
dust0.666667
building0.666667
LOWER IN nasopharynx0.666667
rana catesbeiana0.666667
bullfrog0.666667
nasal cavity0.555556
air0.545455
leaf0.526316
populus0.500000
stem0.500000
populus deltoides0.500000
horse0.500000
merlot0.500000
grapevine0.500000
new york0.500000
canis lupus arctos0.500000
arctic wolf0.500000
toronto zoo0.500000
wild horse0.500000
african lion safari0.500000
red kangaroo0.500000
macropus rufus0.500000
lissotriton vulgaris0.500000
cambridgeshire0.500000
triturus cristatus0.500000
donkey0.500000
equus asinus africanus0.500000
eland0.500000
tragelaphus oryx0.500000
anaxyrus americanus0.500000
american toad0.500000
pyrenees0.500000
plant0.500000
nida basin0.500000
herbivorous beetle0.500000
cheilotoma musciformis0.500000
centricnemus leucogrammus0.500000
barbary sheep0.500000
ammotragus lervia0.500000
eastern gray squirrel0.500000
sciurus carolinensis0.500000
populus trichocarpa x deltoides0.500000
crioceris duodecimpunctata0.500000
polydrusus inustus0.500000
koshi river0.500000
tributary0.500000
reindeer0.500000
rangifer tarandus0.500000
cloud0.500000
lapland0.500000
crioceris quatuordecimpunctata0.500000
sumatran orangutan0.500000
pongo abelii0.500000
brassicaceae0.500000
boechera stricta0.500000
state of idaho0.500000
ivy0.500000
hedera ibernica0.500000
eusomus ovulum0.500000
pseudacris crucifer0.500000
peeper0.500000
water pipes0.500000
bactrian camel0.500000
camelus bactrianus0.500000
myrtillocactus geometrizans0.500000
opuntia robusta0.500000
root interior0.500000
orchesella cincta0.500000
springtail0.500000
age < 3 months0.500000
maryland county0.500000
tick0.500000
ixodes scapularis0.500000
pixr immunized0.500000
LOWER IN reproductive organ0.500000
LOWER IN reproductive system0.500000
LOWER IN genitalia0.500000
gallbladder0.500000
bile0.500000
junco hyemalis0.500000
songbird0.500000
reproductive system0.500000
reproductive organ0.500000
genitalia0.500000
agave0.500000
agave deserti0.500000
pikas0.500000
snow algae0.500000
depth 1-5 cm0.500000
aphthona venustula0.500000
bedroom0.500000
chicago0.500000
LOWER IN bulk soil0.500000
southern united states0.500000
coluber constrictor0.500000
Fraction of annotations for the query sequences containing the term
TermScore
skin0.299145
united states of america0.282051
canada0.217949
leaf0.128205
captive0.119658
zoological garden0.119658
plant0.089744
farm0.072650
african lion safari0.068376
air0.068376
china0.068376
poland0.064103
whole body0.064103
beetle0.064103
homo sapiens0.064103
tree0.059829
river0.059829
soil0.059829
adult0.055556
water0.055556
state of tennessee0.051282
populus0.051282
cultivated environment0.051282
toronto zoo0.051282
kingdom of spain0.051282
pair of nares0.047009
state of idaho0.047009
horse0.042735
equus caballus0.042735
herbivorous beetle0.042735
united kingdom0.038462
nida basin0.038462
stem0.034188
pyrenees0.034188
fresh water0.034188
nasal cavity0.034188
belgium0.034188
rhizosphere0.034188
snake0.034188
southern united states0.034188
commonwealth of virginia0.029915
root0.029915
dog0.025641
canis lupus familiaris0.025641
newt0.025641
cambridgeshire0.025641
mucus0.025641
depth 10 cm0.025641
koshi river0.025641
nepal0.025641
french republic0.025641
brassicaceae0.025641
boechera stricta0.025641
city0.025641
mouth0.025641
feces0.025641
populus trichocarpa x deltoides0.021368
pasture0.021368
ivy0.021368
hedera ibernica0.021368
state of california0.021368
austria0.021368
greenhouse0.021368
carnivorous beetle0.021368
bos taurus0.017094
tributary0.017094
autumn0.017094
saliva0.017094
kingdom of the netherlands0.017094
biofilm0.017094
summer0.017094
seed0.017094
mexico0.017094
research facility0.017094
control0.017094
agave0.017094
desert0.017094
triticum aestivum0.017094
wheat0.017094
sus scrofa0.017094
pig0.017094
raba river0.017094
LOWER IN soil0.017094
felis catus0.012821
merlot0.012821
vitis vinifera0.012821
grapevine0.012821
new york0.012821
lissotriton vulgaris0.012821
triturus cristatus0.012821
free floating0.012821
filtered 0.2um0.012821
winter0.012821
snow0.012821
depth 0-5cm0.012821
particle bound0.012821
filtered 2.7um0.012821
dense settlement biome0.012821
oral cavity0.012821
drinking water0.012821
Exp. ID User ID Description Date Region Flag Sequences
462amnonhighfreq united states of america, state of tennessee, populus, tree, stem, populus deltoides, cultivated environment2019-01-13v4No1 / 3
565amnonhighfreq dog, canis lupus familiaris, canada, skin2019-11-21v3No1 / 7
565amnonhighfreq farm, horse, equus caballus, canada, skin2019-11-21v3No1 / 7
565amnonhighfreq cat, felis catus, canada, skin2019-11-21v3No1 / 8
101amnoncommon merlot, vitis vinifera, grapevine, new york, united states of america, leaf2017-04-03v4No1 / 9
565amnonhighfreq canis lupus arctos, arctic wolf, toronto zoo, captive, zoological garden, canada, skin2019-11-21v3No1 / 9
565amnonhighfreq wild horse, equus przewalskii, toronto zoo, captive, zoological garden, canada, skin2019-11-21v3No1 / 9
565amnonhighfreq african lion safari, captive, zoological garden, red kangaroo, macropus rufus, canada, skin2019-11-21v3No1 / 9
353amnonhigh freq. in wild Lissotriton vulgaris newts skin (highfreq newt, adult, skin, lissotriton vulgaris, cambridgeshire, united kingdom)2018-07-30v4No1 / 10
353amnonhigh freq. in wild Triturus cristatus newts skin (highfreq newt, adult, skin, cambridgeshire, triturus cristatus, united kingdom)2018-07-30v4No1 / 10
565amnonhighfreq farm, donkey, equus asinus africanus, canada, skin2019-11-21v3No1 / 10
565amnonhighfreq toronto zoo, eland, tragelaphus oryx, captive, zoological garden, canada, skin2019-11-21v3No1 / 10
99amnonhighfreq commonwealth of virginia, united states of america, skin, mucus, anaxyrus americanus, american toad2017-04-02v4No1 / 11
403amnonhighfreq air, kingdom of spain, pyrenees, spring2018-11-18v4No1 / 11
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, cheilotoma musciformis2019-04-18v4No1 / 11
515amnonhighfreq poland, whole body, beetle, plant, nida basin, herbivorous beetle, centricnemus leucogrammus2019-04-18v4No1 / 11
565amnonhighfreq toronto zoo, zoological garden, lion, panthera leo, captive, canada, skin2019-11-21v3No1 / 11
565amnonhighfreq african lion safari, captive, zoological garden, barbary sheep, ammotragus lervia, canada, skin2019-11-21v3No1 / 11
565amnonhighfreq eastern gray squirrel, sciurus carolinensis, canada, skin2019-11-21v3No1 / 11
462amnonhighfreq united states of america, state of tennessee, populus, tree, populus trichocarpa x deltoides, stem, cultivated environment2019-01-13v4No1 / 12
515amnonhighfreq poland, whole body, beetle, plant, nida basin, herbivorous beetle, crioceris duodecimpunctata2019-04-18v4No1 / 12
565amnonhighfreq cow, bos taurus, farm, canada, skin2019-11-21v3No1 / 12
565amnonhighfreq african lion safari, captive, zoological garden, canada, cheetah, acinonyx jubatus, skin2019-11-21v3No1 / 12
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, polydrusus inustus2019-04-18v4No1 / 13
534amnonhighfreq river, water, fresh water, depth 10 cm, koshi river, tributary, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 13
384amnonhighfreq equus caballus, horse, canada, farm, nasal cavity, pair of nares, pasture2018-10-22v4No1 / 14
403amnonhighfreq air, kingdom of spain, pyrenees, winter2018-11-18v4No1 / 14
565amnonhighfreq african lion safari, reindeer, rangifer tarandus, zoological garden, captive, canada, skin2019-11-21v3No1 / 14
253amnonhigh freq. in clouds in puy de dome mountain in france (highfreq cloud, french republic, air, autumn)2017-11-22v4No1 / 15
462amnonhighfreq united states of america, state of tennessee, populus, tree, leaf, cultivated environment2019-01-13v4No1 / 15
511amnonhighfreq snow, depth 0-5cm, lapland, finland, sweden, kingdom of norway2019-03-20v4No1 / 15
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, crioceris quatuordecimpunctata2019-04-18v4No1 / 15
534amnonhighfreq river, water, fresh water, depth 10 cm, koshi river, tributary, nepal, particle bound, filtered 2.7um2019-07-22v4No1 / 16
565amnonhighfreq sumatran orangutan, pongo abelii, toronto zoo, captive, zoological garden, canada, skin2019-11-21v3No1 / 16
266amnonhigh freq. on perennial plant leaves (highfreq brassicaceae, boechera stricta, plant, leaf, united states of america, state of idaho)2017-12-19v4No1 / 17
128amnonhighfreq belgium, ivy, hedera ibernica, leaf, city, dense settlement biome2017-04-14v4No1 / 18
384amnonhighfreq equus caballus, horse, canada, farm, oral cavity, saliva, pasture, mouth2018-10-22v4No1 / 18
403amnonhighfreq air, kingdom of spain, pyrenees, autumn2018-11-18v4No1 / 18
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, eusomus ovulum2019-04-18v4No1 / 18
565amnonhighfreq giraffe, giraffa camelopardalis, african lion safari, captive, zoological garden, canada, skin2019-11-21v3No1 / 18
99amnonhighfreq commonwealth of virginia, united states of america, skin, mucus, pseudacris crucifer, peeper2017-04-02v4No1 / 19
101amnoncommon united states of america, vitis vinifera, merlot, grapevine, new york, grape, botanical fruit food product2017-04-03v4No1 / 19
178amnonhigh freq. in drinking water pipes biofilm (highfreq kingdom of the netherlands, water, drinking water, biofilm, water pipes)2017-08-10v4No1 / 19
565amnonhighfreq white rhinoceros, ceratotherium simum, african lion safari, captive, zoological garden, canada, skin2019-11-21v3No1 / 20
565amnonhighfreq bactrian camel, camelus bactrianus, african lion safari, zoological garden, captive, canada, skin2019-11-21v3No1 / 20
403amnonhighfreq air, kingdom of spain, pyrenees, summer2018-11-18v4No1 / 22
29amnoncommon in various plant seeds ( high in compared to in french republic seed )2016-12-05v4No1 / 26
565amnoncommon cat, felis catus, canada, skin2019-11-21v3No1 / 26
462amnoncommon united states of america, state of tennessee, populus, tree, leaf, cultivated environment2019-01-13v4No1 / 28
129amnonfound INSIDE roots of cactus (common mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, root interior, root)2017-04-15v4No1 / 29
462amnoncommon united states of america, state of tennessee, populus, tree, stem, populus deltoides, cultivated environment2019-01-13v4No1 / 29
364amnoncommon orchesella cincta, springtail, kingdom of denmark, body proper2018-08-29v4No1 / 30
233amnon high in age age < 3 months compared to age > 3 months in feces homo sapiens infant united states of america 2017-11-05v4No1 / 31
101amnoncommon united states of america, leaf, vitis vinifera, merlot, grapevine, new york2017-04-03v4No1 / 32
403amnoncommon air, kingdom of spain, pyrenees, spring2018-11-18v4No1 / 32
37amnoncommon maryland county, leaf, solanum lycopersicum2016-12-09v4No1 / 33
262amnonhigher in tick larvae fed on PIXR immunized mice compared to non immunized ( high in pixr immunized compared to control in tick ixodes scapularis larval stage body proper research facility )2017-12-10v4No1 / 35
231amnonhigher in urine compared to genitalia in dogs ( high in urine compared to reproductive organ reproductive system genitalia in dog canis lupus familiaris united states of america )2017-11-02v4No1 / 36
403amnoncommon air, kingdom of spain, pyrenees, autumn2018-11-18v4No1 / 36
403amnoncommon air, kingdom of spain, pyrenees, summer2018-11-18v4No1 / 39
526amnoncommon in bile of healthy controls (common homo sapiens, gallbladder, bile, adult, kingdom of spain, control)2019-07-14v3No1 / 39
403amnoncommon air, kingdom of spain, pyrenees, winter2018-11-18v4No1 / 42
89amnoncommon junco hyemalis, uropygial gland, commonwealth of virginia, songbird2017-03-08v4No1 / 43
231amnoncommon in dog genitalia (common dog, canis lupus familiaris, united states of america, reproductive system, reproductive organ, genitalia)2017-11-02v4No1 / 43
89amnoncommon junco hyemalis, commonwealth of virginia, songbird, cloaca2017-03-08v4No1 / 48
360amnoncommon agave, agave deserti, leaf, leaf endosphere, desert, state of california2018-08-20v4No1 / 48
462amnoncommon united states of america, state of tennessee, populus, tree, populus trichocarpa x deltoides, stem, cultivated environment2019-01-13v4No1 / 48
321amnonhigher in mice treated with ampicillin compared to untreated mice ( high in ampicillin antibiotic compared to control in mus musculus mouse c57bl/6j feces united states of america research facility )2018-04-22v4No1 / 52
279amnon high in mouth compared to small intestine stomach in ochotonidae pikas china 2018-01-24v4No1 / 53
543amnoncommon snow algae, snow field, antarctica, depth 1-5 cm, antarctic peninsula2019-08-01v4No1 / 53
515amnoncommon poland, whole body, beetle, aphthona venustula, plant, nida basin, herbivorous beetle2019-04-18v4No1 / 54
63amnoncommon in skin in american gut (common homo sapiens, skin)2017-02-15v4No1 / 56
308amnoncommon in neonatal intensive care unit floor (common united states of america, state of california, hospital, floor, dust)2018-03-31v4No1 / 57
523amnoncommon air, building, bedroom, united states of america, chicago, state of illinois2019-07-03v4No1 / 58
565amnoncommon farm, horse, equus caballus, canada, skin2019-11-21v3No1 / 58
155amnonlower in bulk soil compared to loose bound root soil ( high in rhizosphere compared to bulk soil in triticum aestivum wheat soil china )2017-07-02v4No1 / 63
536amnoncommon snake, skin, united states of america, southern united states, coluber constrictor, eastern racer snake2019-07-28v4No1 / 64
231amnoncommon in dog urine (common dog, canis lupus familiaris, united states of america, urine)2017-11-02v4No1 / 69
558amnon high in crop compared to gizzard in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 69
462amnon high in populus trichocarpa x deltoides compared to populus deltoides in united states of america state of tennessee populus tree leaf cultivated environment 2019-01-13v4No1 / 76
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, tributary, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 80
269amnonpeaks at 2 weeks in refrigeration of yao meat ( high in middle timepoint two weeks compared to fresh food spoilage late timepoint in china foodon product type )2018-01-09v4No1 / 83
279amnoncommon grassland, leaf, stem, steppe, mongolia, china2018-01-24v4No1 / 83
565amnoncommon captive, toronto zoo, zoological garden, fruit bat, eidolon helvum, canada, skin2019-11-21v3No1 / 83
565amnoncommon dog, canis lupus familiaris, canada, skin2019-11-21v3No1 / 83
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, centricnemus leucogrammus2019-04-18v4No1 / 84
227amnonhiger in first 24hrs compared to later timepoints in baby nasopharynx ( high in age age <=24 hours compared to age >= 7 days in homo sapiens nasopharynx nasal cavity infant kingdom of the netherlands )2017-10-30v4No1 / 85
26amnon high in pair of nares mucus compared to saliva mouth in united states of america felis catus 2016-12-05v4No1 / 86
277amnon high in pair of nares nasal cavity compared to nasopharynx in homo sapiens belgium adult 2018-01-23v4No1 / 86
336amnoncommon feces, qinghai province, anser, goose, greylag goose, china2018-05-16v4No1 / 87
199amnoncommon on shower wall tile (common bathroom, shower, building, tile, urban biome, united states of america, building wall)2017-10-01v4No1 / 90
178amnoncommon in drinking water pipes biofilm (common kingdom of the netherlands, water, drinking water, biofilm, water pipes)2017-08-10v4No1 / 91
306amnoncommon at whole plant corn at time 0 (common zea mays subsp. mays, corn, whole plant, israel)2018-03-19v4No1 / 96
565amnoncommon african lion safari, reindeer, rangifer tarandus, zoological garden, captive, canada, skin2019-11-21v3No1 / 96
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, rana catesbeiana, bullfrog2017-04-02v4No1 / 99
361amnoncommon leaf, austria, greenhouse, plant, dracaena fragrans2018-08-21v4No1 / 100
536amnoncommon crotalus horridus, snake, skin, united states of america, southern united states, timber rattlesnake2019-07-28v4No1 / 101
536amnoncommon snake, skin, united states of america, southern united states, fossorial snake, storeria dekayi, ground snake2019-07-28v4No1 / 101
361amnoncommon leaf, austria, greenhouse, plant, malvaviscus penduliflorus2018-08-21v4No1 / 102
198amnoncommon yellowstone national park, united states of america, geothermal field, water, hot spring, high temperature environment2017-09-13v4No1 / 103
279amnoncommon ochotonidae, pikas, mouth, china2018-01-24v4No1 / 103
279amnoncommon grassland, tibetan plateau, leaf, stem, kobresia humilis, china2018-01-24v4No1 / 104
565amnoncommon eastern gray squirrel, sciurus carolinensis, canada, skin2019-11-21v3No1 / 104
256amnonhigher in control diet compared to diet enriched with sucram in pig gut ( high in diet standard feed compared to sucram in gastrointestinal system sus scrofa pig united kingdom )2017-11-26v4No1 / 109
565amnoncommon african lion safari, captive, zoological garden, indian flying fox, pteropus giganteus, canada, skin2019-11-21v3No1 / 109
536amnoncommon snake, skin, united states of america, southern united states, thamnophis sirtalis, common garter snake2019-07-28v4No1 / 110
536amnoncommon snake, skin, united states of america, southern united states, aquatic snake, nerodia sipedon, northern water snake2019-07-28v4No1 / 111
565amnoncommon wild horse, equus przewalskii, toronto zoo, captive, zoological garden, canada, skin2019-11-21v3No1 / 112
198amnoncommon sediment, yellowstone national park, united states of america, thermophilic sediment, geothermal field, high temperature environment2017-09-13v4No1 / 113
565amnoncommon canis lupus arctos, arctic wolf, toronto zoo, captive, zoological garden, canada, skin2019-11-21v3No1 / 114
492amnoncommon skin, adult, germany, bufo bufo, toad, common toad2019-02-27v4No1 / 115
195amnoncommon in boston subway surfaces (common city, urban biome, train, boston)2017-09-07v4No1 / 116
343amnoncommon in apple flowers (common apple, malus x domestica, flower structure, flower, united states of america, state of connecticut)2018-05-28v4No1 / 118
311amnoncommon united states of america, state of rhode island, scallion, foodon product type2018-04-09v4No1 / 121
565amnoncommon white rhinoceros, ceratotherium simum, african lion safari, captive, zoological garden, canada, skin2019-11-21v3No1 / 122
565amnoncommon bactrian camel, camelus bactrianus, african lion safari, zoological garden, captive, canada, skin2019-11-21v3No1 / 122
565amnoncommon african lion safari, captive, zoological garden, canada, cheetah, acinonyx jubatus, skin2019-11-21v3No1 / 123
557amnoncommon lake, freshwater lake, fresh water, water, french republic, depth 10m2019-09-14v3No1 / 123
199amnoncommon in kitchen sink (common building, urban biome, united states of america, kitchen, sink)2017-10-01v4No1 / 130
384amnoncommon equus caballus, horse, canada, farm, nasal cavity, pair of nares, barn, hay2018-10-22v4No1 / 131
515amnoncommon carnivorous beetle, river, poland, raba river, whole body, beetle, bembidion modestum2019-04-18v4No1 / 131
176amnoncommon in skin of hairless mice (common mouse, mus musculus, skin, female, skh-1 hairless mouse, dorsum, research facility, united states of america)2017-07-29v4No1 / 133
511amnoncommon snow, depth 0-5cm, united states of america, state of colorado2019-03-20v4No1 / 134
63amnon high in female compared to male in homo sapiens skin 2017-02-15v4No1 / 139
291amnoncommon canis lupus familiaris, dog, pair of nares, nasal cavity, germany2018-02-01v4No1 / 144
29amnoncommon brassica oleracea, french republic, seed2016-12-05v4No1 / 146
475amnoncommon in air next to subway stations in hong kong (common air, hong kong, city)2019-01-20v4No1 / 147
565amnoncommon asian elephant, elephas maximus, african lion safari, captive, zoological garden, canada, skin2019-11-21v3No1 / 149
565amnoncommon toronto zoo, zoological garden, lion, panthera leo, captive, canada, skin2019-11-21v3No1 / 150
361amnoncommon leaf, austria, greenhouse, plant, howea forsteriana2018-08-21v4No1 / 154
361amnoncommon leaf, austria, greenhouse, plant, dracaena draco2018-08-21v4No1 / 155
526amnoncommon in bile of Cholelithiasis patients (common homo sapiens, gallbladder, bile, adult, kingdom of spain, cholelithiasis)2019-07-14v3No1 / 155
266amnoncommon on perennial plant leaves (common brassicaceae, boechera stricta, plant, leaf, united states of america, state of idaho)2017-12-19v4No1 / 156
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, crioceris duodecimpunctata2019-04-18v4No1 / 157
192amnoncommon seed, seed structure, brassica napus2017-09-05v4No1 / 161
475amnoncommon in air in subway train in hong kong (common air, hong kong, city, subway)2019-01-20v4No1 / 161
232amnoncoomon in foot of healthy controls (common homo sapiens, skin, australia, foot)2017-11-05v4No1 / 166
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 172
565amnoncommon sumatran orangutan, pongo abelii, toronto zoo, captive, zoological garden, canada, skin2019-11-21v3No1 / 174
384amnoncommon equus caballus, horse, canada, farm, nasal cavity, pair of nares, pasture2018-10-22v4No1 / 175
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, anaxyrus americanus, american toad2017-04-02v4No1 / 176
536amnoncommon snake, skin, united states of america, southern united states, pantherophis obsoletus, black rat snake, arboreal snake2019-07-28v4No1 / 184
567amnon high in pair of nares anterior naris compared to nasopharynx in belgium adult homo sapiens 2019-12-05v4No1 / 186
567amnon high in control compared to chronic rhinosinusitis sinusitis in pair of nares anterior naris belgium adult homo sapiens 2019-12-05v4No1 / 191
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, tributary, nepal, particle bound, filtered 2.7um2019-07-22v4No1 / 193
515amnoncommon bembidion decorum, carnivorous beetle, river, poland, raba river, whole body, beetle2019-04-18v4No1 / 198
384amnoncommon equus caballus, horse, canada, farm, oral cavity, saliva, pasture, mouth2018-10-22v4No1 / 201
515amnon high in herbivorous beetle poland compared to detritivorous beetle bulgaria in whole body beetle 2019-04-19v4No1 / 205
565amnoncommon african lion safari, captive, zoological garden, barbary sheep, ammotragus lervia, canada, skin2019-11-21v3No1 / 205
511amnoncommon snow, depth 0-5cm, lapland, finland, sweden, kingdom of norway2019-03-20v4No1 / 213
265amnoncommon in tree leaves (common canada, province of quebec, tree, leaf)2017-12-11v4No1 / 226
331amnon high in dry season compared to wet season in feces monkey theropithecus gelada ethiopia 2018-05-13v4No1 / 232
492amnoncommon skin, adult, rana catesbeiana, bullfrog, lithobates catesbeianus, frog, japan2019-02-27v4No1 / 236
536amnoncommon snake, skin, united states of america, southern united states, agkistrodon contortrix, copperhead snake2019-07-28v4No1 / 236
384amnon high in pasture compared to barn hay in equus caballus horse canada farm saliva mouth 2018-10-22v4No1 / 245
462amnon high in populus trichocarpa x deltoides compared to populus deltoides in united states of america state of tennessee populus tree stem cultivated environment 2019-01-13v4No1 / 249
432amnoncommon united states of america, plant, state of north carolina, stem, tsuga canadensis, eastern hemlock2018-12-19v4No1 / 251
253amnoncommon in clouds in puy de dome mountain in france (common cloud, french republic, air, autumn)2017-11-22v4No1 / 267
361amnoncommon leaf, austria, greenhouse, plant, chlorophytum comosum2018-08-21v4No1 / 270
384amnoncommon equus caballus, horse, canada, farm, barn, hay, oral cavity, saliva, mouth2018-10-22v4No1 / 274
558amnon high in summer compared to winter in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 274
128amnonhigher in ivy leaves from city compared to moor and forest ( high in city dense settlement biome compared to moor forest ecosystem in belgium ivy hedera ibernica leaf )2017-04-14v4No1 / 287
423amnoncommon bank vole, myodes glareolus, ukraine, skin2018-12-05v4No1 / 291
37amnoncommon in plastic leaf plants (in field next to tomato plants) (common maryland county, leaf)2016-12-09v4No1 / 298
237amnonlower in burrow soil compared to bird ( high in oceanodroma leucorhoa bird seabird compared to soil burrow in canada bon portage island )2017-11-07v4No1 / 298
462amnon high in populus trichocarpa x deltoides compared to populus deltoides in united states of america state of tennessee populus tree root cultivated environment 2019-01-13v4No1 / 300
515amnoncommon carnivorous beetle, river, poland, raba river, whole body, beetle, bembidion punctulatum2019-04-18v4No1 / 305
515amnoncommon carnivorous beetle, river, poland, raba river, whole body, beetle, bembidion varicolor2019-04-18v4No1 / 308
565amnoncommon giraffe, giraffa camelopardalis, african lion safari, captive, zoological garden, canada, skin2019-11-21v3No1 / 310
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, nepal, particle bound, filtered 2.7um2019-07-22v4No1 / 315
565amnoncommon cow, bos taurus, farm, canada, skin2019-11-21v3No1 / 318
311amnoncommon in floor of kimchi production facility (common united states of america, state of rhode island, floor, food processing factory)2018-04-09v4No1 / 324
565amnoncommon farm, donkey, equus asinus africanus, canada, skin2019-11-21v3No1 / 335
175amnonhigher in winter compared to summer in heavy metal contaminated soils in china ( high in winter compared to summer in soil heavy metal china )2017-07-29v4No1 / 337
565amnoncommon african lion safari, captive, zoological garden, red kangaroo, macropus rufus, canada, skin2019-11-21v3No1 / 360
565amnoncommon toronto zoo, captive, zoological garden, olive baboon, papio anubis, canada, skin2019-11-21v3No1 / 368
29amnon high in seed compared to seedling in brassica oleracea french republic 2016-12-05v4No1 / 379
256amnoncommon sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 380
512amnon high in tibetan plateau riganqiao peatland ph 5.5-6.5 compared to hani peatland baekdudaegan ph 5-6 in fen peatland peat soil soil china 2019-03-22v4No1 / 381
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
353amnoncommon in wild Lissotriton vulgaris newts skin (common newt, adult, skin, lissotriton vulgaris, cambridgeshire, united kingdom)2018-07-30v4No1 / 418
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, pseudacris crucifer, peeper2017-04-02v4No1 / 438
577amnon high in monimolimnion depth 4-9m high salinity hypersaline water compared to low salinity mixolimnion depth 0-3m in lake water water ursu lake romania lake 2020-01-09v3No1 / 439
353amnoncommon in wild Triturus cristatus newts skin (common newt, adult, skin, cambridgeshire, triturus cristatus, united kingdom)2018-07-30v4No1 / 456
128amnoncommon belgium, ivy, hedera ibernica, leaf, city, dense settlement biome2017-04-14v4No1 / 461
512amnoncommon fen, peatland, peat soil, soil, ph 5.5-6.5, tibetan plateau, riganqiao peatland, china2019-03-22v4No1 / 483
360amnoncommon agave, desert, leaf, leaf surface, agave salmiana, mexico, guanajuato2018-08-21v4No1 / 492
304amnoncommon united states of america, state of california, beach, pacific ocean, air, aerosol, santa cruz province2018-03-12v4No1 / 518
129amnoncommon mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, leaf2017-04-15v4No1 / 562
536amnon high in terrestrial snake compared to aquatic snake in snake skin united states of america southern united states 2019-07-28v4No1 / 590
265amnonhigher in tree leaves compared to soil and soilwater ( high in leaf tree compared to soil soilwater water in canada province of quebec )2017-12-11v4No1 / 610
128amnoncommon belgium, ivy, hedera ibernica, leaf, moor, scrubland2017-04-14v4No1 / 623
360amnonhigher in leaf surface compared to soil in agave plants ( high in leaf leaf surface compared to soil in desert state of california mexico guanajuato agave )2018-08-21v4No1 / 645
360amnoncommon agave, desert, state of california, agave deserti, leaf, leaf surface2018-08-21v4No1 / 649
200amnoncommon in river downstream of wastewater treatment plant (common river, fresh water, water, united states of america, wastewater treatment plant, effluent)2017-10-01v4No1 / 655
178amnoncommon in drinking water pipe loose deposits (common kingdom of the netherlands, water, deposits, drinking water)2017-08-10v4No1 / 656
565amnoncommon toronto zoo, eland, tragelaphus oryx, captive, zoological garden, canada, skin2019-11-21v3No1 / 674
416amnon high in mulch diet compared to wood diet in termite reticulitermes flaviceps colon research facility united states of america 2018-11-30v4No1 / 681
521amnonlower in pre-weaned pigs compared to weaned older timepoints ( high in weaned age 4-7 weeks corn and soybean diet compared to preweaned suckling age 2-4 weeks in pig sus scrofa feces farm jiangxi province china )2019-07-02v3No1 / 681
128amnoncommon belgium, ivy, hedera ibernica, leaf, forest ecosystem2017-04-14v4No1 / 693
232amnonlower in diabetec patient foot skin compared to healthy controls ( high in control compared to diabetes mellitus in homo sapiens skin australia foot )2017-11-05v4No1 / 708
206amnoncommon in air from israel particles <10um size (common air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 765
157amnoncommon in naers of weened calves (common nasal cavity, bos taurus, calve, united states of america, juvenile organism, pair of nares)2017-07-04v4No1 / 766
384amnon high in pair of nares nasal cavity compared to oral cavity saliva mouth in equus caballus horse canada farm 2018-10-22v4No1 / 791
454amnon high in summer compared to winter in elaphurus davidianus pere deer deer feces china 2019-01-10v4No1 / 791
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 836
517amnon high in skin arm forearm compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 836
266amnoncommon in roots in JAM garden (common brassicaceae, boechera stricta, plant, united states of america, state of idaho, root)2017-12-19v4No1 / 843
462amnon high in leaf compared to stem in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 890
206amnoncommon in dust storm air from israel particles <10um size (common israel, air, size < 10um, dust, dust storm)2017-10-04v4No1 / 902
126amnoncommon rhizosphere, germany, hordeum vulgare, winter barley2017-04-14v4No1 / 925
266amnoncommon in soil from MIL garden (common soil, united states of america, state of idaho, ph 6.5)2017-12-18v4No1 / 980
193amnonhigher in nares of people working in dairy farms ( high in bos taurus farm compared to control in homo sapiens united states of america pair of nares )2017-09-05v4No1 / 992
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014
266amnoncommon in soil from PAR garden (common soil, united states of america, state of idaho, ph 5.5)2017-12-18v4No1 / 1032
252amnoncommon in river rock biofilm (common kingdom of spain, biofilm, river, rock, epilithic)2017-11-22v4No1 / 1081
266amnoncommon in roots in MAH garden (common brassicaceae, boechera stricta, plant, united states of america, state of idaho, root)2017-12-19v4No1 / 1110
515amnon high in carabidae compared to staphylinidae in whole body beetle carnivorous beetle river poland 2019-04-19v4No1 / 1130
266amnon high in leaf compared to root in brassicaceae boechera stricta plant united states of america state of idaho 2017-12-19v4No1 / 1175
252amnoncommon in river sand biofilm (common river, biofilm, kingdom of spain, sand)2017-11-22v4No1 / 1181
531amnoncommon rhizosphere, greenhouse soil, farm, orthic anthrosol, cucumis sativus, cucumber, china2019-07-21v3No1 / 1223
266amnonCommon in soil from MAH garden (common soil, united states of america, state of idaho, ph 6)2017-12-18v4No1 / 1299
266amnoncommon in soil from SIL garden (common soil, united states of america, state of idaho, ph 6)2017-12-18v4No1 / 1389
266amnoncoomon in roots in SIL garden (common brassicaceae, boechera stricta, plant, united states of america, state of idaho, root)2017-12-19v4No1 / 1399
76amnoncommon in non-seleniferous soil (common soil, rhizosphere, united states of america, non-seleniferous, state of florida)2017-02-28v4No1 / 1414
462amnon high in rhizosphere compared to soil in united states of america state of tennessee populus tree cultivated environment 2019-01-12v4No1 / 1428
266amnoncommon in soil from JAM garden (common soil, united states of america, state of idaho, ph 5.5)2017-12-18v4No1 / 1456
76amnonhigher in non-seleniferous soil compared to seleniferous soil ( high in non-seleniferous compared to selenium seleniferous in soil united states of america rhizosphere woodland area )2017-02-28v4No1 / 1621
155amnonhigher in tightly bound root soil compared to loose soil and bulk soil ( high in root compared to bulk soil in triticum aestivum wheat soil china )2017-07-02v4No1 / 1714
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in newt adult skin cambridgeshire triturus cristatus united kingdom )2018-07-30v4No1 / 1834
155amnoncommon in soil tightly bound to wheat root (common triticum aestivum, wheat, soil, root, china)2017-07-02v4No1 / 1977
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in newt adult skin cambridgeshire lissotriton vulgaris united kingdom )2018-07-30v4No1 / 2162
155amnoncommon in soil loosely bound to wheat root (common triticum aestivum, wheat, soil, rhizosphere, china)2017-07-02v4No1 / 2425
462amnon high in rhizosphere compared to root in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 4630

Problems / suggestions? Please email info AT dbbact DOT org