Search result for sequence:
TACGGAGGGAGCTAGCGTTATTCGGAATTACTGGGCGTAAAGCGCACGTAGGCGGCTTTGTAAGTTAGAGGTGAAAGCCTGGAGCTCAACTCCAGAACTGCCTTTAAGACTGCATCGCTTGAATCCAGGAGAGGTGAGTGGAATTCCGAG
common ontology terms
term enrichment score
TermScore
soil0.400371
rhizosphere0.244375
china0.211060
canada0.182670
skin0.168416
agricultural field0.145172
captive0.122982
province of ontario0.119149
zoological garden0.111940
depth (soil) 0-20cm0.100022
grand river watershed0.093897
rare charitable research reserve0.093897
root0.084791
cambridge0.082305
farm0.081474
depth (soil) 0-10cm0.079033
african lion safari0.076555
triticum aestivum0.073247
germany0.067925
luvisol0.067633
united states of america0.067629
israel0.067133
land snail0.059406
toronto zoo0.058537
pot expreiment0.058537
fertilized soil0.057692
body proper0.055300
luancheng county0.054658
wheat0.054411
french republic0.052783
brazil0.051426
state of sabah0.049261
forested area0.048662
malaysia0.048077
adult0.045908
stomach0.045881
state of california0.045361
silt loam0.045056
research facility0.044856
ph 60.044554
quercus velutina0.044554
quercus alba0.044554
quercus rubra0.044554
acer saccharum0.044554
acer saccharum subsp. nigrum0.044554
fagus grandifolia0.044554
forest0.044554
kingdom of spain0.043860
gastrointestinal system0.043860
surface water0.043584
homo sapiens0.042300
maize field0.040336
water0.040323
ph 80.040201
loam soil0.040201
zea mays0.039801
cannabis sativa0.039801
thyrow0.039801
lettuce0.039801
flood plain0.039801
sacramento0.039801
cosumnes river preserve0.039801
citrus0.039409
epidermis0.038278
italy0.037987
kingdom of denmark0.037915
winter0.037736
whole body0.037209
loess plateau0.035309
neve yaar0.035000
la rioja province0.035000
depth 0-15cm0.035000
dipsacus fullonum0.035000
solidago0.035000
apocynum0.035000
decomissioned agricultural field0.035000
meadow ecosystem0.035000
calcic chernozem0.035000
south moravian region0.035000
colluvial soil0.035000
jejunum0.034797
daucus carota0.034398
cultivated environment0.033816
tick0.033816
topsoil0.033533
switzerland0.033533
czech republic0.031674
depth (soil) 0-30 cm0.030457
nicotiana tabacum0.030380
bulk soil0.030265
ph 7.60.030151
late weichselian glaciation0.030151
clayey till0.030151
lund0.030151
dekalb county0.030151
illinois0.030151
depth 15-30cm0.030151
depth 30-45cm0.030151
mature forest0.030151
brunisol0.030151
Fraction of dbbact annotations with this term covered by the query
TermScore
ph 6-6.51.000000
turrialba canton1.000000
cane toad1.000000
rhinella marina1.000000
cuticle1.000000
chitin-based cuticle1.000000
atlantic rainforest1.000000
parque estadual serra do mar-núcleo picinguaba1.000000
odontomachus hastatus1.000000
sao paulo state1.000000
qiao nature reserve1.000000
sonneratia apetala1.000000
LOWER IN licosa island1.000000
punta licosa1.000000
lizard1.000000
podarcis siculus1.000000
riwoqe county1.000000
jejunal mucosa1.000000
age 7 weeks1.000000
wuhan1.000000
lumen of jejunum1.000000
common octopus1.000000
octopus vulgaris1.000000
sepia esculenta1.000000
cuttlefish1.000000
uroteuthis edulis1.000000
inshore squid1.000000
octopus variabilis1.000000
whiparm octupus1.000000
egg chorion1.000000
black soldier fly1.000000
hermetia illucens1.000000
tours1.000000
fully formed stage1.000000
mirs bay1.000000
LOWER IN deep bay1.000000
volcan sumaco1.000000
saccharina latissima1.000000
sugar kelp1.000000
newport river estuary1.000000
town of beaufort1.000000
helsinki1.000000
south island1.000000
aldabra atoll1.000000
seychelles1.000000
sediment depth 2.5cm1.000000
department of peten1.000000
ear1.000000
ngamba island1.000000
ulan bator1.000000
siberian musk deer1.000000
moschus moschiferus1.000000
tonsil surface1.000000
takahe1.000000
porphyrio hochstetteri1.000000
LOWER IN wild diet1.000000
feed supplement diet1.000000
cinnamomum camphora1.000000
anxi county1.000000
juvenile oyster containing diet1.000000
qingdao city prefecture1.000000
veined rapa whelk1.000000
rapana venosa1.000000
river water1.000000
fuzhou city prefecture1.000000
xiyuan river1.000000
LOWER IN fall1.000000
depth (soil) 0-30 cm0.750000
maize field0.750000
nicotiana tabacum0.666667
park0.666667
ph<60.666667
LOWER IN ph&gt;60.666667
black soil0.666667
mollisol0.666667
silt loam0.666667
unamended0.666667
unamended soil0.666667
saccharum0.666667
sugarcane0.666667
loess plateau0.666667
cucumis sativus0.666667
rangifer tarandus0.666667
reindeer0.666667
cow milk (raw)0.666667
cow milk (fluid)0.666667
milk0.666667
ph 80.666667
loam soil0.666667
land snail0.666667
luancheng county0.666667
triticum aestivum0.636364
wheat0.600000
agricultural field0.583333
bulk soil0.571429
rhizosphere0.510638
field soil0.500000
vero beach, fl0.500000
quincy, fl0.500000
immokalee, fl0.500000
Fraction of annotations for the query sequences containing the term
TermScore
soil0.386010
china0.230570
canada0.202073
rhizosphere0.160622
skin0.142487
united states of america0.103627
agricultural field0.082902
captive0.082902
zoological garden0.077720
province of ontario0.072539
depth (soil) 0-20cm0.064767
farm0.054404
homo sapiens0.054404
grand river watershed0.051813
cambridge0.051813
rare charitable research reserve0.051813
adult0.049223
root0.046632
germany0.046632
research facility0.046632
depth (soil) 0-10cm0.044041
israel0.041451
african lion safari0.041451
triticum aestivum0.038860
luvisol0.036269
toronto zoo0.031088
fertilized soil0.031088
feces0.031088
land snail0.031088
body proper0.031088
pot expreiment0.031088
wheat0.028497
state of california0.028497
brazil0.028497
french republic0.028497
stomach0.028497
luancheng county0.028497
water0.025907
forested area0.025907
kingdom of spain0.025907
state of sabah0.025907
malaysia0.025907
gastrointestinal system0.025907
ph 60.023316
silt loam0.023316
surface water0.023316
quercus velutina0.023316
quercus alba0.023316
quercus rubra0.023316
acer saccharum0.023316
acer saccharum subsp. nigrum0.023316
fagus grandifolia0.023316
forest0.023316
citrus0.020725
winter0.020725
zea mays0.020725
cannabis sativa0.020725
kingdom of denmark0.020725
italy0.020725
maize field0.020725
ph 80.020725
loam soil0.020725
epidermis0.020725
whole body0.020725
thyrow0.020725
lettuce0.020725
flood plain0.020725
sacramento0.020725
cosumnes river preserve0.020725
topsoil0.018135
cultivated environment0.018135
loess plateau0.018135
switzerland0.018135
neve yaar0.018135
la rioja province0.018135
tick0.018135
depth 0-15cm0.018135
dipsacus fullonum0.018135
solidago0.018135
apocynum0.018135
daucus carota0.018135
decomissioned agricultural field0.018135
meadow ecosystem0.018135
caecum0.018135
calcic chernozem0.018135
czech republic0.018135
south moravian region0.018135
colluvial soil0.018135
jejunum0.018135
nicotiana tabacum0.015544
bulk soil0.015544
state of idaho0.015544
agricultural feature0.015544
wild0.015544
depth (soil) 0-30 cm0.015544
fresh water0.015544
ph 70.015544
ph 7.60.015544
drinking water0.015544
irrigated0.015544
Exp. ID User ID Description Date Region Flag Sequences
727amnondominant red sheep tick, haemaphysalis punctata, body proper, whole body, la rioja province, kingdom of spain, tick2021-01-03v3No1 / 2
727amnondominant ornate sheep tick, dermacentor marginatus, body proper, whole body, la rioja province, kingdom of spain, tick2021-01-03v3No1 / 3
765sheryoDominant in wheat field in the loess plateau in china (dominant triticum aestivum, ph 7.7, loess plateau, silt loam, chromic cambisol, shanxi province, china, soil)2021-04-12v3No1 / 5
854sheryoDominant in soil depth of 25-50cm of colluvial soil, Czech rebuplic (dominant calcic chernozem, colluvial soil, depth 25-50cm, ph 8, south moravian region, czech republic, soil)2021-12-23v3No1 / 6
565amnondominant skin, canada, equus caballus, horse, farm2019-11-21v3No1 / 7
565amnondominant skin, canada, canis lupus familiaris, dog2019-11-21v3No1 / 7
727amnoncommon brown dog tick, rhipicephalus sanguineus, body proper, whole body, la rioja province, kingdom of spain, tick2021-01-03v3No1 / 7
565amnondominant skin, canada, felis catus, cat2019-11-21v3No1 / 8
727amnoncommon red sheep tick, haemaphysalis punctata, body proper, whole body, la rioja province, kingdom of spain, tick2021-01-03v3No1 / 8
882amnondominant antarctic hairgrass, deschampsia antarctica, king george island, antarctica, rhizosphere2022-03-20v3No1 / 8
565amnondominant skin, canada, macropus rufus, red kangaroo, zoological garden, captive, african lion safari2019-11-21v3No1 / 9
565amnondominant skin, canada, zoological garden, captive, toronto zoo, equus przewalskii, wild horse2019-11-21v3No1 / 9
565amnondominant skin, canada, zoological garden, captive, toronto zoo, arctic wolf, canis lupus arctos2019-11-21v3No1 / 9
565amnondominant skin, canada, zoological garden, captive, tragelaphus oryx, eland, toronto zoo2019-11-21v3No1 / 10
565amnondominant skin, canada, equus asinus africanus, donkey, farm2019-11-21v3No1 / 10
662amnondominant loam soil, loam, irrigated, neve yaar, depth (soil) 0-10cm, soil, agricultural field, israel2020-09-22v3No1 / 10
727amnoncommon ornate sheep tick, dermacentor marginatus, body proper, whole body, la rioja province, kingdom of spain, tick2021-01-03v3No1 / 10
565amnondominant skin, canada, sciurus carolinensis, eastern gray squirrel2019-11-21v3No1 / 11
565amnondominant skin, canada, ammotragus lervia, barbary sheep, zoological garden, captive, african lion safari2019-11-21v3No1 / 11
565amnondominant skin, canada, captive, panthera leo, lion, zoological garden, toronto zoo2019-11-21v3No1 / 11
662amnondominant clay soil, irrigated, neve yaar, depth (soil) 0-10cm, soil, agricultural field, israel2020-09-21v3No1 / 11
981amnondominant alouatta pigra, monkey, wild, guatemala, department of peten, howler monkey, ear, external acoustic meatus2022-12-25v3No1 / 11
565amnondominant skin, acinonyx jubatus, cheetah, canada, zoological garden, captive, african lion safari2019-11-21v3No1 / 12
565amnondominant skin, canada, farm, bos taurus, cow2019-11-21v3No1 / 12
691amnondominant commune of paris, french republic, water, drinking water2028-03-11v3No1 / 12
696amnondominant georissa, georissa similis, state of sabah, malaysia, gastrointestinal system, stomach, land snail2028-03-27v3No1 / 12
717amnondominant palm of hand, palmar part of manus, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v3No1 / 12
727amnondominant ixodes ricinus, body proper, whole body, la rioja province, kingdom of spain, tick2021-01-03v3No1 / 12
827sheryoDominant in soil at 575cm depth in clayey till loam soil, Lund Denmark (dominant depth 550-600cm, lund, kingdom of denmark, agricultural field, clayey till, late weichselian glaciation, loam soil)2021-09-13v3No1 / 12
752sheryoDominant in soil planted with Panax notoginseng (dominant panax notoginseng, sanqi plants, ph 6, xundian county, yunnan province, china, pot expreiment, soil)2021-03-11v3No1 / 13
903amnoncommon spontaneously fermented red wine, research facility, poland, grape based wine or wine-like food product, wine food product2022-05-06v3No1 / 13
565amnondominant skin, canada, captive, zoological garden, rangifer tarandus, reindeer, african lion safari2019-11-21v3No1 / 14
654amnoncommon adana province, turkey, fermented beverage, kombucha2020-09-13v3No1 / 14
662amnondominant loamy sand soil, irrigated, neve yaar, depth (soil) 0-10cm, soil, agricultural field, israel2020-09-22v3No1 / 14
981amnoncommon howler monkey, department of peten, guatemala, wild, nasal cavity, monkey, alouatta pigra2022-12-25v3No1 / 14
934amnondominant age 7 weeks, wuhan, china, jejunal mucosa, chicken, gallus gallus, jejunum, research facility2022-09-18v3No1 / 15
934amnondominant age 7 weeks, wuhan, china, lumen of jejunum, chicken, gallus gallus, jejunum, research facility2022-09-18v3No1 / 15
565amnondominant skin, canada, zoological garden, captive, toronto zoo, pongo abelii, sumatran orangutan2019-11-21v3No1 / 16
691amnoncommon commune of paris, french republic, water, drinking water2028-03-11v3No1 / 16
696amnondominant alycaeus jagori, state of sabah, malaysia, gastrointestinal system, stomach, land snail2028-03-27v3No1 / 16
696amnondominant helicarionidae, kaliella, kaliella scandens, state of sabah, malaysia, gastrointestinal system, stomach, land snail2028-03-27v3No1 / 16
936amnoncommon uroteuthis edulis, inshore squid, south korea, offshore, caecum2022-09-19v3No1 / 16
990amnondominant rapana venosa, veined rapa whelk, body proper, larval stage, china, research facility, qingdao city prefecture, control diet2022-12-26v3No1 / 16
662amnondominant tap water, drinking water, water, israel2020-09-20v3No1 / 17
762sheryoDominant in rhizosphere soil of a pot experiment with lettuce planted in npk fertilized haplic luvisol Switzerland (dominant thyrow, switzerland, haplic luvisol, mineral fertilization, pot expreiment, lettuce, soil, rhizosphere, npk fertilization)2021-04-08v3No1 / 17
565amnondominant skin, canada, zoological garden, captive, african lion safari, giraffa camelopardalis, giraffe2019-11-21v3No1 / 18
723amnondominant adult, female, breast milk material, breast milk, homo sapiens, indonesia, municipality of yogyakarta2021-01-02v3No1 / 19
565amnondominant skin, canada, captive, zoological garden, african lion safari, camelus bactrianus, bactrian camel2019-11-21v3No1 / 20
565amnondominant skin, canada, zoological garden, captive, african lion safari, ceratotherium simum, white rhinoceros2019-11-21v3No1 / 20
677amnondominant palatine tonsil, south korea, adult, tonsil, homo sapiens2028-03-01v3No1 / 20
981amnoncommon external acoustic meatus, ear, ngamba island, uganda, chimpanzee, pan troglodytes schweinfurthii, wild, monkey2022-12-25v3No1 / 20
981amnoncommon external acoustic meatus, ear, howler monkey, department of peten, guatemala, wild, monkey, alouatta pigra2022-12-25v3No1 / 21
587amnondominant israel, food product type, alfalfa sprouts, medicago sativa, producer c22020-02-10v3No1 / 23
696amnoncommon georissa, georissa similis, state of sabah, malaysia, gastrointestinal system, stomach, land snail2028-03-27v3No1 / 24
723amnoncommon adult, female, breast milk material, breast milk, homo sapiens, indonesia, municipality of yogyakarta2021-01-02v3No1 / 25
565amnoncommon skin, canada, felis catus, cat2019-11-21v3No1 / 26
717amnoncommon inner nostril, pair of nares, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v3No1 / 27
936amnoncommon sepia esculenta, cuttlefish, south korea, offshore, caecum2022-09-19v3No1 / 31
717amnoncommon external nose, outer nose, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v3No1 / 32
696amnoncommon state of sabah, malaysia, gastrointestinal system, stomach, land snail, opisthostoma concinnum, plectostoma concinnum2028-03-27v3No1 / 36
526amnoncommon in bile of healthy controls (common homo sapiens, gallbladder, bile, adult, kingdom of spain, control)2019-07-14v3No1 / 39
986amnon high in feed supplement diet compared to wild diet in feces new zealand bird porphyrio hochstetteri takahe 2022-12-26v3No1 / 40
1011amnoncommon captive, italy, canary, serinus canaria, feces, bird2023-02-03v3No1 / 41
587amnoncommon israel, food product type, producer c1, vigna radiata, mung bean sprouts2020-02-10v3No1 / 42
763amnon high in depth 20-100cm subsurface compared to depth 0-20cm surface in filtered 0.2um ice glacier sweden 2021-04-10v3No1 / 42
986amnoncommon takahe, porphyrio hochstetteri, bird, new zealand, feces2022-12-26v3No1 / 42
696amnoncommon helicarionidae, kaliella, kaliella scandens, state of sabah, malaysia, gastrointestinal system, stomach, land snail2028-03-27v3No1 / 43
717amnoncommon dorsum, back, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v3No1 / 44
717amnoncommon upper eyelid, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v3No1 / 47
853amnon high in exclusive breastmilk diet compared to solid food diet soild food supplemented diet in hyplus rabbit age 5 weeks juvenile rabbit cecal content french republic oryctolagus cuniculus caecum research facility 2021-12-20v3No1 / 47
662amnoncommon in cucumber surface (common fruit, israel, neve yaar, cucumis sativus, cucumber, surface)2020-09-22v3No1 / 49
853amnon high in age 5 weeks compared to age 3 weeks in exclusive breastmilk diet hyplus rabbit juvenile rabbit cecal content french republic oryctolagus cuniculus caecum research facility 2021-12-18v3No1 / 49
909amnon high in lumen of colon compared to feces in manchester united kingdom mouse mus musculus research facility 2022-05-20v3No1 / 53
771amnoncommon body proper, whole body, china, cotton aphid, aphis gossypii2021-04-21v3No1 / 54
936amnoncommon common octopus, octopus vulgaris, south korea, offshore, caecum2022-09-19v3No1 / 54
717amnoncommon chest, torso, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v3No1 / 56
812amnoncommon zoological garden, feces, china, captive, chinstrap penguin, pygoscelis antarcticus2021-06-22v3No1 / 56
717amnoncommon palm of hand, palmar part of manus, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v3No1 / 57
565amnoncommon skin, canada, equus caballus, horse, farm2019-11-21v3No1 / 58
717amnoncommon plantar part of pes, bottom of foot, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v3No1 / 58
990amnon high in juvenile oyster containing diet compared to control diet in rapana venosa veined rapa whelk body proper larval stage china research facility qingdao city prefecture 2022-12-26v3No1 / 58
281amnoncommon shinisaurus crocodilurus, crocodile lizard, cloaca, china2018-01-25v4No1 / 59
374amnoncommon skin, costa rica, amphibia, oophaga pumilio, strawberry poison frog, frog2018-09-09v4No1 / 61
682amnoncommon city, madrid, kingdom of spain, air2028-03-04v3No1 / 67
840amnoncommon farm, china, ileum, broiler chicken, gallus gallus2021-11-08v3No1 / 67
727amnoncommon ixodes ricinus, body proper, whole body, la rioja province, kingdom of spain, tick2021-01-03v3No1 / 69
989amnon high in rhizosphere compared to soil in depth (soil) 0-20cm cinnamomum camphora anxi county ph 4-5 farm china 2022-12-26v3No1 / 69
742amnoncommon dalian city prefecture, captive, zoological garden, china, pygoscelis papua, gentoo penguin, bird, feces2021-02-18v3No1 / 70
763amnonhigher in blank compared to samples (contamination)2021-04-10v3No1 / 70
854sheryoHigher at soil depth of 25-100cm compared to soil depth of 125-175cm of colluvial soil, Czech rebuplic ( high in depth 25-100cm compared to depth 125-175cm in calcic chernozem colluvial soil ph 8 south moravian region czech republic soil )2021-12-23v3No1 / 70
656amnoncommon child stage, adolescent stage, age 1-18 years, sri lanka, feces, homo sapiens2020-09-13v3No1 / 71
653amnon high in tongue dermal layer of tongue compared to saliva in third decade human stage homo sapiens adult canada toronto 2020-09-13v3No1 / 72
934amnoncommon lumen of jejunum, age 7 weeks, wuhan, china, chicken, gallus gallus, jejunum, research facility2022-09-18v3No1 / 73
971amnoncommon helsinki, finland, feces, overweight body mass index status, adult, homo sapiens2022-12-23v3No1 / 73
696amnoncommon alycaeus jagori, state of sabah, malaysia, gastrointestinal system, stomach, land snail2028-03-27v3No1 / 74
948amnoncommon fully formed stage, black soldier fly, hermetia illucens, research facility, tours, french republic2022-12-05v3No1 / 74
666amnoncommon pygmy hippopotamus, hexaprotodon liberiensis, italy, feces2020-09-25v3No1 / 76
786sheryoHigher at 400-700cm depth compared to 166-200cm depth in flood plain soil near cosumnes river, california ( high in depth 400-700cm compared to depth 166-200cm in flood plain soil united states of america state of california sacramento cosumnes river preserve )2021-09-13v3No1 / 77
948amnoncommon egg chorion, black soldier fly, hermetia illucens, research facility, tours, french republic2022-12-05v3No1 / 80
983amnon high in tonsil surface tonsil compared to supragingival plaque supragingival dental plaque in child 2-5 year-old child stage china homo sapiens 2022-12-26v3No1 / 80
618amnon high in cbd yummy cannabis plant compared to cbd shark cannabis plant in flowering stage rhizosphere canada farm cannabis sativa 2020-05-04v4No1 / 83
565amnoncommon skin, canada, canis lupus familiaris, dog2019-11-21v3No1 / 83
565amnoncommon skin, canada, eidolon helvum, fruit bat, zoological garden, toronto zoo, captive2019-11-21v3No1 / 83
662amnoncommon tap water, drinking water, water, israel2020-09-20v3No1 / 89
662amnon high in drinking water tap water compared to treated wastewater wastewater treatment plant in water israel 2020-09-20v3No1 / 89
899amnoncommon in snail intestine from heavy metal contaminated greenhouse (common greenhouse, heavy metal contaminated soil, land snail, bradybaena ravida, china, sedum alfredii, heavy metal, zhejiang province, intestine)2022-04-25v3No1 / 90
565amnoncommon skin, canada, captive, zoological garden, rangifer tarandus, reindeer, african lion safari2019-11-21v3No1 / 96
853amnoncommon age 5 weeks, exclusive breastmilk diet, hyplus rabbit, juvenile, rabbit, cecal content, french republic, oryctolagus cuniculus, caecum, research facility2021-12-20v3No1 / 96
565amnoncommon skin, canada, sciurus carolinensis, eastern gray squirrel2019-11-21v3No1 / 104
587amnoncommon israel, food product type, alfalfa sprouts, medicago sativa, producer c12020-02-10v3No1 / 106
565amnoncommon skin, canada, pteropus giganteus, indian flying fox, zoological garden, captive, african lion safari2019-11-21v3No1 / 109
899amnoncommon in snail intestine from phytoremedation field (common phytoremedation field, field, heavy metal contaminated soil, land snail, bradybaena ravida, china, sedum alfredii, heavy metal, zhejiang province, intestine)2022-04-25v3No1 / 110
855sheryoHigher in soil depth of 800cm compared to soil depth of 350cm in fertilized soil in china ( high in depth 800cm compared to depth 350cm in luancheng county china agricultural field fertilized soil soil )2021-12-27v3No1 / 111
565amnoncommon skin, canada, zoological garden, captive, toronto zoo, equus przewalskii, wild horse2019-11-21v3No1 / 112
565amnoncommon skin, canada, zoological garden, captive, toronto zoo, arctic wolf, canis lupus arctos2019-11-21v3No1 / 114
691amnon high in spring compared to summer in commune of paris french republic water drinking water 2028-03-11v3No1 / 115
758amnoncommon in cigar tobacco (common cheyenne menthol box cigar, tobacco, nicotiana tabacum, cigar)2021-03-28v3No1 / 115
789amnonhigh in unfemented compared to fermented cocoa mass ( high in time 0 compared to fermented cocoa mass time 5 days in state of tabasco mexico cocoa mass theobroma cacao )2021-06-01v3No1 / 121
565amnoncommon skin, canada, captive, zoological garden, african lion safari, camelus bactrianus, bactrian camel2019-11-21v3No1 / 122
565amnoncommon skin, canada, zoological garden, captive, african lion safari, ceratotherium simum, white rhinoceros2019-11-21v3No1 / 122
557amnoncommon lake, freshwater lake, fresh water, water, french republic, depth (water) 10m2019-09-14v3No1 / 123
565amnoncommon skin, acinonyx jubatus, cheetah, canada, zoological garden, captive, african lion safari2019-11-21v3No1 / 123
758amnoncommon in cigar tobacco (common swisher sweets original cigar, tobacco, nicotiana tabacum, cigar)2021-03-28v3No1 / 127
855sheryoCommon in soil depth of 1000cm in fertilized soil in china (common depth 1000cm, luancheng county, china, agricultural field, fertilized soil, soil)2021-12-27v3No1 / 127
934amnoncommon jejunal mucosa, age 7 weeks, wuhan, china, chicken, gallus gallus, jejunum, research facility2022-09-18v3No1 / 127
758amnoncommon in cigar tobacco (common cheyenne full flavor cigar, tobacco, nicotiana tabacum, cigar)2021-03-28v3No1 / 128
855sheryoHigher in soil depth of 800cm compared to soil depth of 1000cm in fertilized soil in china ( high in depth 800cm compared to depth 1000cm in luancheng county china agricultural field fertilized soil soil )2021-12-27v3No1 / 128
374amnoncommon skin, costa rica, amphibia, craugastor fitzingeri, common rain frog, frog2018-09-09v4No1 / 136
585amnoncommon china, pomacea canaliculata, golden apple snail, nanheng river, qingpu district, buccal mass2020-02-02v3No1 / 136
617amnoncommon alpine pasture, alpine, farm, italy, cow milk (raw), cow milk (fluid), milk2020-05-03v3No1 / 137
762sheryoHigh in rhizosphere compared bulk soil to of a pot experiment with lettuce planted in haplic luvisol Switzerland ( high in rhizosphere compared to bulk soil in thyrow switzerland haplic luvisol pot expreiment lettuce soil )2021-04-08v3No1 / 139
855sheryoCommon in soil depth of 800cm in fertilized soil in china (common depth 800cm, luancheng county, china, agricultural field, fertilized soil, soil)2021-12-27v3No1 / 142
565amnoncommon skin, canada, zoological garden, captive, african lion safari, elephas maximus, asian elephant2019-11-21v3No1 / 149
565amnoncommon skin, canada, captive, panthera leo, lion, zoological garden, toronto zoo2019-11-21v3No1 / 150
921amnoncommon turrialba canton, cane toad, rhinella marina, skin epidermis, costa rica, skin2022-07-24v4No1 / 153
936amnoncommon octopus variabilis, whiparm octupus, south korea, offshore, caecum2022-09-19v3No1 / 153
758amnoncommon in cigar tobacco (common swisher sweets sweet cherry cigar, tobacco, nicotiana tabacum, cigar)2021-03-28v3No1 / 154
526amnoncommon in bile of Cholelithiasis patients (common homo sapiens, gallbladder, bile, adult, kingdom of spain, cholelithiasis)2019-07-14v3No1 / 155
815amnoncommon lake hulun, wild, winter, mongolia, red fox, vulpes vulpes, feces2021-07-04v3No1 / 160
965amnoncommon biofilm, saccharina latissima, sugar kelp, state of connecticut, united states of america, atlantic ocean, depth (water) 5-50m2022-12-21v3No1 / 161
600sheryolower in biochar ammendment soil ( high in unamended compared to biochar in depth (soil) 0-5cm state of new york soil united states of america coarse-loamy soil ph 6 day 82 )2020-03-27v4No1 / 166
374amnoncommon skin, costa rica, amphibia, craugastor bransfordii, bransford’s litter frog, frog2018-09-09v4No1 / 171
855sheryoCommon in soil depth of 175cm in fertilized soil in china (common depth 175cm, luancheng county, china, agricultural field, fertilized soil, soil)2021-12-27v3No1 / 173
565amnoncommon skin, canada, zoological garden, captive, toronto zoo, pongo abelii, sumatran orangutan2019-11-21v3No1 / 174
842sheryoCommon in soil depth of 15-30cm in a mature forest in Ontario, Canada (common depth 15-30cm, forest, fagus grandifolia, acer saccharum subsp. nigrum, acer saccharum, quercus velutina, quercus alba, quercus rubra, mature forest, forested area, brunisol, soil, grand river watershed, canada, province of ontario, cambridge, rare charitable research reserve)2021-11-14v3No1 / 182
536amnoncommon snake, skin, united states of america, southern united states, pantherophis obsoletus, black rat snake, arboreal snake2019-07-28v4No1 / 184
990amnoncommon control diet, qingdao city prefecture, research facility, china, larval stage, body proper, veined rapa whelk, rapana venosa2022-12-26v3No1 / 187
982amnoncommon ulan bator, siberian musk deer, moschus moschiferus, china, mongolia, captive, feces2022-12-25v3No1 / 193
585amnoncommon china, pomacea canaliculata, golden apple snail, nanheng river, qingpu district, stomach2020-02-02v3No1 / 194
761sheryoHigher in maize rhizosphere compared to bulk soil in sandy soil maize field in Germany ( high in rhizosphere compared to bulk soil in ph 5 lower saxony sandy soil germany maize field )2021-04-06v3No1 / 200
878amnoncommon pm10, respirable suspended particulate matter, city, municipality of beijing, china, air2022-03-11v3No1 / 203
618amnoncommon early flowering stage, canada, farm, root, root endosphere, cannabis sativa2020-05-04v4No1 / 205
565amnoncommon skin, canada, ammotragus lervia, barbary sheep, zoological garden, captive, african lion safari2019-11-21v3No1 / 205
755sheryocommon in wild soybean (Glycine soja) rhizosphere (common ph 7, jilin province, rhizosphere, soil, black soil, china, glycine soja)2021-03-18v3No1 / 210
587amnoncommon israel, food product type, alfalfa sprouts, medicago sativa, producer c22020-02-10v3No1 / 215
855sheryoHigher in soil depth of 350cm compared to soil depth of 75cm in fertilized soil in china ( high in depth 350cm compared to depth 75cm in luancheng county china agricultural field fertilized soil soil )2021-12-27v3No1 / 217
762sheryoHigh in rhizosphere compared to bulk soil of a pot experiment with lettuce planted in albic luvisol Germany ( high in rhizosphere compared to bulk soil in thyrow albic luvisol germany haplic luvisol pot expreiment lettuce soil )2021-04-08v3No1 / 226
842sheryoCommon in soil depth of 30-45cm in a mature forest in Ontario, Canada (common depth 30-45cm, mature forest, brunisol, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 227
499amnoncommon brazil, pond, water, pond water, fresh water2019-03-05v4No1 / 228
583amnoncommon soil, mountain, switzerland, ph 4-6, depth (soil) 0-10cm, elevation 2000-3000m, siliceous parent material, rhone river valley2020-01-27v3No1 / 234
755sheryocommon in domesticated soybean (Glycine max) rhizosphere (common glycine max, china, black soil, soil, rhizosphere, jilin province, ph 7)2021-03-18v3No1 / 234
951amnon high in mirs bay compared to deep bay in depth (water) 20-100cm coast china surface water sea water 2022-12-08v3No1 / 236
585amnoncommon china, pomacea canaliculata, golden apple snail, nanheng river, qingpu district, intestine2020-02-02v3No1 / 240
855sheryoCommon in soil depth of 350cm in fertilized soil in china (common depth 350cm, luancheng county, china, agricultural field, fertilized soil, soil)2021-12-27v3No1 / 242
990amnoncommon juvenile oyster containing diet, qingdao city prefecture, research facility, china, larval stage, body proper, veined rapa whelk, rapana venosa2022-12-26v3No1 / 246
618amnon high in cbd yummy cannabis plant compared to hash cannabis plant in flowering stage rhizosphere canada farm cannabis sativa 2020-05-04v4No1 / 250
602sheryohigher in rhizoshere of tomato plant roots planted in unamended potting mix ( high in unamended compared to amended with biochar in potting mix rhizosphere israel solanum lycopersicum )2020-04-05v4No1 / 252
996amnoncommon in river water without anthropogenic effect (common river water, china, upstream, fuzhou city prefecture, xiyuan river, fresh water, surface water, river)2022-12-28v3No1 / 254
617amnoncommon lowland pasture, lowland farm, farm, italy, cow milk (raw), cow milk (fluid), milk2020-05-03v3No1 / 257
842sheryoCommon in soil depth of 0-15cm in a mature forest in Ontario, Canada (common mature forest, brunisol, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 261
951amnoncommon mirs bay, depth (water) 20-100cm, coast, china, surface water, sea water2022-12-08v3No1 / 263
948amnon high in fully formed stage compared to larva larval stage in black soldier fly hermetia illucens research facility tours french republic 2022-12-05v3No1 / 272
499amnoncommon brazil, pond, digestive system, intestine, astyanax paranae, fish, astyanax2019-03-05v4No1 / 273
752sheryoHigher in treatments without biochar compared to treatments with biochar in soil planted with Panax notoginseng amended with 2% biochar ( high in without biochar compared to biochar in panax notoginseng sanqi plants ph 6 xundian county yunnan province china pot expreiment soil )2021-03-11v3No1 / 273
762sheryoCommon in rhizosphere soil of a pot experiment with lettuce planted in npk fertilized haplic luvisol Switzerland (common thyrow, switzerland, haplic luvisol, mineral fertilization, pot expreiment, lettuce, soil, rhizosphere, npk fertilization)2021-04-08v3No1 / 286
996amnoncommon city, anthropogenic environmental material, downstream, river, surface water, fresh water, xiyuan river, fuzhou city prefecture, china, river water2022-12-28v3No1 / 291
882amnoncommon antarctic hairgrass, deschampsia antarctica, king george island, antarctica, rhizosphere2022-03-20v3No1 / 299
751sheryoCommon in tomato soil infected with Fusarium oxysporum (common china, shandong province, luojiazhuang, fusarium oxysporum, solanum lycopersicum, soil)2021-03-11v3No1 / 305
653amnon high in tongue dermal layer of tongue compared to dentition supragingival plaque supragingival dental plaque in third decade human stage toronto canada adult homo sapiens 2020-09-13v3No1 / 306
432amnoncommon united states of america, plant, state of north carolina, stem, tsuga dumosa, himalayan hemlock2018-12-19v4No1 / 309
565amnoncommon skin, canada, zoological garden, captive, african lion safari, giraffa camelopardalis, giraffe2019-11-21v3No1 / 310
309amnon high in other plants compared to meadow pea-vine lathyrus pratensis in rhizosphere germany 2018-04-05v4No1 / 316
618amnoncommon pre-vegetative stage, canada, farm, root, root endosphere, cannabis sativa2020-05-04v4No1 / 318
565amnoncommon skin, canada, farm, bos taurus, cow2019-11-21v3No1 / 318
827sheryoCommon in soil at 575cm depth in clayey till loam soil, Lund Denmark (common depth 550-600cm, lund, kingdom of denmark, agricultural field, clayey till, late weichselian glaciation, loam soil)2021-09-13v3No1 / 318
882amnoncommon king george island, antarctic pearlwort, colobanthus quitensis, antarctica, rhizosphere2022-03-20v3No1 / 325
932amnon high in cuticle chitin-based cuticle compared to stomach gaster in atlantic rainforest parque estadual serra do mar-núcleo picinguaba odontomachus hastatus sao paulo state ant brazil tropical moist broadleaf forest biome 2022-08-30v4No1 / 334
565amnoncommon skin, canada, equus asinus africanus, donkey, farm2019-11-21v3No1 / 335
750sheryoCommon in soil of wheat field in China (common fluvo-aquic soil, ph 7.6, hebei province, luancheng county, china, triticum aestivum, soil)2021-03-11v3No1 / 337
129amnoncommon mexico, myrtillocactus geometrizans, opuntia robusta, cactus, rhizosphere, semi-arid2017-04-15v4No1 / 338
979amnoncommon south island, aldabra atoll, seychelles, sediment surface, sediment2022-12-24v3No1 / 345
618amnoncommon late flowering stage, canada, farm, root, root endosphere, cannabis sativa2020-05-04v4No1 / 352
762sheryoCommon in rhizosphere soil of a pot experiment with lettuce planted in npk fertilized albic luvisol Germany (common pot expreiment, lettuce, soil, rhizosphere, germany, thyrow, albic luvisol, mineral fertilization, npk fertilization)2021-04-08v3No1 / 353
888amnoncommon milk collection tanker, cow milk (raw), cow milk (fluid), ireland, milk2022-03-30v3No1 / 353
309amnon high in other plants compared to common sainfoin onobrychis viciifolia in rhizosphere germany 2018-04-05v4No1 / 355
583amnoncommon soil, mountain, switzerland, depth (soil) 0-10cm, elevation 2000-3000m, siliceous parent material, ph 4.5-7, canton of graubunden2020-01-27v3No1 / 359
762sheryoCommon in rhizosphere soil of a pot experiment with lettuce planted in organic fertilized albic luvisol Germany (common organic fertilization, manure fertilization, manured soil, albic luvisol, thyrow, germany, rhizosphere, soil, lettuce, pot expreiment)2021-04-08v3No1 / 359
565amnoncommon skin, canada, macropus rufus, red kangaroo, zoological garden, captive, african lion safari2019-11-21v3No1 / 360
565amnoncommon skin, canada, papio anubis, olive baboon, zoological garden, captive, toronto zoo2019-11-21v3No1 / 368
888amnoncommon bulk tank milk, cow milk (raw), milk, ireland2022-03-30v3No1 / 388
842sheryoCommon in soil depth of 30-45cm in an old growth forest in Ontario, Canada (common depth 30-45cm, old growth forest, luvisol, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 390
842sheryoCommon in soil depth of 30-45cm in a mature forest in Ontario, Canada (common depth 30-45cm, luvisol, mature forest, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 393
662amnoncommon clay soil, irrigated, neve yaar, depth (soil) 0-10cm, soil, agricultural field, israel2020-09-21v3No1 / 402
309amnon high in other plants compared to germander speedwell veronica chamaedrys in rhizosphere germany 2018-04-05v4No1 / 404
755sheryocommon in domesticated rice (Oryza stavia) rhizosphere (common oryza sativa, ph 7, jilin province, rhizosphere, soil, black soil, china)2021-03-18v3No1 / 415
842sheryoCommon in soil depth of 15-30cm in a mature forest in Ontario, Canada (common depth 15-30cm, luvisol, mature forest, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 433
577amnon high in hypersaline water high salinity depth (water) 4-9m monimolimnion compared to depth (water) 20-100cm depth (water) 1-5m depth (water) 0-3m mixolimnion low salinity in lake romania ursu lake water lake water 2020-01-09v3No1 / 439
829sheryohigher soil depth of 44-108cm compared to 12-44cm in Alfisol soil, Dekalb, Illinois, united states of america ( high in depth 44-108cm compared to depth 12-44cm in sandy loam sandy loam soil hapludalf alfisol united states of america soil state of illinois illinois dekalb county )2021-08-26v3No1 / 442
758amnon high in cheyenne menthol box cigar cheyenne full flavor cigar compared to swisher sweets sweet cherry cigar swisher sweets original cigar in tobacco nicotiana tabacum cigar 2021-03-28v3No1 / 452
762sheryocommon in rhizosphere soil of a pot experiment with lettuce planted in organic fertilized haplic luvisol Switzerland (common bio-dynamic fertilizer, manured soil, manure fertilization, organic fertilization, thyrow, switzerland, haplic luvisol, pot expreiment, lettuce, soil, rhizosphere)2021-04-08v3No1 / 455
415amnonhigher in citrus from humid subtropical compared to mediterranean and semi-arid climate ( high in subtropical compared to mediterranean semi-arid in rhizosphere soil citrus orchard cultivated environment )2018-11-27v4No1 / 458
842sheryoCommon in soil depth of 0-15cm in a mature forest in Ontario, Canada (common depth 0-15cm, luvisol, mature forest, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 460
964amnoncommon stratovolcano, ph 4-5, soil, depth (soil) 10-25cm, ecuador, volcan sumaco2022-12-21v3No1 / 472
662amnoncommon water, wastewater treatment plant, treated wastewater, israel2020-09-20v3No1 / 473
989amnoncommon rhizosphere, depth (soil) 0-20cm, cinnamomum camphora, anxi county, ph 4-5, farm, china2022-12-26v3No1 / 476
786sheryoCommon in flood plain soil near cosumnes river, california, at 400-700cm depth (common depth (soil) 400-700cm, flood plain, soil, united states of america, state of california, sacramento, cosumnes river preserve)2021-05-18v3No1 / 481
360amnoncommon desert, soil, rhizosphere, agave, agave salmiana, mexico, guanajuato2018-08-21v4No1 / 484
617amnonlower in cow milk of cows in alpine pasture compared to lowland farm ( high in lowland farm lowland pasture compared to alpine pasture alpine in farm italy cow milk (raw) cow milk (fluid) milk )2020-05-03v3No1 / 484
662amnoncommon loam soil, loam, irrigated, neve yaar, depth (soil) 0-10cm, soil, agricultural field, israel2020-09-21v3No1 / 489
373amnoncommon soil, rhizosphere, oryza sativa, rice, hunan province, rice field, china2018-09-08v4No1 / 501
979amnoncommon sediment depth 2.5cm, south island, aldabra atoll, seychelles, sediment2022-12-24v3No1 / 502
842sheryoCommon in soil depth of 15-30cm in an old growth forest in Ontario, Canada (common depth 15-30cm, old growth forest, luvisol, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 507
798amnoncommon depth (soil) 10 cm, depth (soil) 0-20cm, hay, plant litter, litter bag, orchard, apricot, prunus armeniaca, apennine mountains, italy2021-06-13v3No1 / 508
927amnon high in punta licosa compared to licosa island in lizard podarcis siculus italy feces 2022-08-15v3No1 / 509
618amnon high in root endosphere root compared to rhizosphere in canada farm cannabis sativa 2020-05-04v4No1 / 510
971amnon high in helsinki finland compared to auckland city new zealand in homo sapiens adult overweight body mass index status feces 2022-12-23v3No1 / 520
755sheryocommon in wild rice (Oryza rufipogon) rhizosphere (common oryza rufipogon, ph 7, jilin province, rhizosphere, soil, black soil, china)2021-03-18v3No1 / 530
762sheryocommin in bulk soil of a pot experiment with lettuce planted in npk fertilzed albic luvisol from Germany (common mineral fertilization, npk fertilization, germany, soil, bulk soil, thyrow, albic luvisol, ph 6.4, lettuce, pot expreiment)2021-04-07v3No1 / 531
98amnoncommon citrus, rhizosphere, immokalee, fl, root, state of florida2017-04-01v4No1 / 543
98amnoncommon citrus, rhizosphere, vero beach, fl, root, state of florida2017-04-01v4No1 / 544
725amnon high in subgingival dental plaque subgingival plaque compared to buccal mucosa mouth mucosa in adult municipality of beijing china homo sapiens 2021-01-03v3No1 / 544
905amnon high in jejunum ileum compared to abomasum rumen in western australia sheep age 1 year australia ovis aries research facility 2022-05-18v3No1 / 563
357amnoncommon soil, topsoil, depth (soil) 0-10cm, mediterranean forest biome, forest ecosystem, woodland area2018-08-19v4No1 / 564
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, root endosphere, root2019-08-17v4No1 / 575
696amnon high in georissa georissa similis compared to plectostoma concinnum opisthostoma concinnum in land snail stomach gastrointestinal system malaysia state of sabah 2028-03-28v3No1 / 576
777amnon high in 18-month-old human stage child compared to 3-month-old human stage infant in municipality of umea sweden saliva homo sapiens 2021-04-26v3No1 / 583
996amnon high in winter compared to fall summer in city anthropogenic environmental material downstream river surface water fresh water xiyuan river fuzhou city prefecture china river water 2022-12-28v3No1 / 588
357amnoncommon soil, topsoil, depth (soil) 0-10cm, montane forest, woodland area, forest ecosystem2018-08-19v4No1 / 592
360amnon high in rhizosphere agave compared to soil in desert mexico state of california 2018-08-21v4No1 / 593
662amnoncommon loamy sand soil, irrigated, neve yaar, depth (soil) 0-10cm, soil, agricultural field, israel2020-09-22v3No1 / 609
309amnon high in prunella vulgaris woundwort compared to other plants in rhizosphere germany 2018-04-05v4No1 / 617
698amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, ph 4-4.5, park, london, united kingdom, oak, quercus, rhizosphere2028-04-01v3No1 / 623
786sheryoHigher at 0-30cm depth compared to 30-60cm depth in flood plain soil near cosumnes river, california ( high in depth (soil) 0-30 cm depth (soil) 0-20cm compared to depth 30-60cm in flood plain soil united states of america state of california sacramento cosumnes river preserve )2021-09-13v3No1 / 627
813amnoncommon severed branch, epiphytic material, united states of america, state of washington, olympic national park, canopy soil, soil2021-06-22v4No1 / 633
827sheryoCommon in soil at 230cm depth in clayey till loam soil, Lund Denmark (common depth 200-260cm, loam soil, late weichselian glaciation, clayey till, agricultural field, kingdom of denmark, lund)2021-08-24v3No1 / 644
889amnon high in summer compared to winter in reindeer rangifer tarandus ruminal fluid siberia russia rumen tundra 2022-04-01v3No1 / 647
616amnon high in ph 5.5-6 fertilized soil compared to ph 6.7 non-fertilized soil in depth (soil) 0-20cm sugarcane saccharum soil topsoil china guangzhou city prefecture 2020-04-27v3No1 / 648
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, rhizosphere2019-08-17v4No1 / 651
565amnoncommon skin, canada, zoological garden, captive, tragelaphus oryx, eland, toronto zoo2019-11-21v3No1 / 674
842sheryoCommon in soil depth of 30-45cm in a zea mays agricultural field in Ontario, Canada (common depth 30-45cm, zea mays, preston flats, agricultural field, soil, luvisol, grand river watershed, canada, province of ontario, cambridge, rare charitable research reserve)2021-11-14v3No1 / 676
100amnoncommon soil, urban biome, park, new york city, central park2017-04-03v4No1 / 685
829sheryohigher soil depth of 0-12cm compared to 12-44cm in Alfisol soil, Dekalb, Illinois, united states of america ( high in depth 0-12cm compared to depth 12-44cm in sandy loam sandy loam soil hapludalf alfisol united states of america soil state of illinois illinois dekalb county )2021-08-26v3No1 / 685
357amnon high in ph>3 compared to ph<3 in soil topsoil depth (soil) 0-10cm subpolar coniferous forest biome boreal forest woodland area forest ecosystem 2018-08-19v4No1 / 719
752sheryoCommon in soil planted with Panax notoginseng (common panax notoginseng, sanqi plants, ph 6, xundian county, yunnan province, china, pot expreiment, soil)2021-03-11v3No1 / 730
823sheryoCommon at 0-10cm depth in ultisol soil in auburn, alabama (common depth (soil) 0-10cm, auburn, alabama, upland soil, agricultural field, ultisol, soil)2021-08-07v3No1 / 730
829sheryoCommon in soil depth of 0-12m in Alfisol soil, Dekalb, Illinois, united states of america (common depth 0-12cm, sandy loam, sandy loam soil, hapludalf, alfisol, united states of america, soil, state of illinois, illinois, dekalb county)2021-08-26v3No1 / 737
813amnoncommon forested area, temperate rainforest, united states of america, state of washington, olympic national park, soil2021-06-22v4No1 / 740
761sheryoCommon in maize rhizosphere sandy soil maize field in Germany (common zea mays, rhizosphere, ph 5, lower saxony, sandy soil, germany, maize field)2021-04-06v3No1 / 742
854sheryoCommon in soil depth of 275-325cm of colluvial soil, Czech rebuplic (common depth 275-325cm, calcic chernozem, colluvial soil, ph 8, south moravian region, czech republic, soil)2021-12-23v3No1 / 749
271amnon high in rhizosphere glycine max soybean compared to soil in depth (soil) 0-20cm china 2018-01-09v4No1 / 750
829sheryoCommon in soil depth of 44-108cm in Alfisol soil, Dekalb, Illinois, united states of america (common depth 44-108cm, sandy loam, sandy loam soil, hapludalf, alfisol, united states of america, soil, state of illinois, illinois, dekalb county)2021-08-26v3No1 / 751
357amnon high in ph>4 compared to ph<4 in soil topsoil depth (soil) 0-10cm southern temperate forest temperate broadleaf and mixed forest biome woodland area forest ecosystem 2018-08-19v4No1 / 761
813amnonlower in epiphytic materiall attached to intact branch compared to severed suspended branch ( high in severed branch compared to intact branch in epiphytic material united states of america state of washington olympic national park canopy soil soil )2021-06-22v4No1 / 768
842sheryoCommoon in soil depth of 30-45cm in a Decomissioned Agricultural Field in Ontario, Canada (common depth 30-45cm, dipsacus fullonum, solidago, apocynum, daucus carota, brunisol, decomissioned agricultural field, meadow ecosystem, grand river watershed, rare charitable research reserve, cambridge, province of ontario, canada, soil)2021-11-14v3No1 / 768
171amnon high in drought environment compared to control in soil united states of america state of california rhizosphere oryza sativa rice 2017-07-25v4No1 / 770
615amnoncommon endosphere, root, saccharum, sugarcane, campinas, brazil, greenhouse2020-04-27v4No1 / 776
615amnoncommon in control soil with no sugarcane (common campinas, brazil, greenhouse, soil)2020-04-27v4No1 / 780
309amnon high in red fescue grass festuca rubra compared to other plants in rhizosphere germany 2018-04-05v4No1 / 781
823sheryoCommon at 90-100cm depth in foot slope ultisol soil in auburn, alabama (common depth 90-100cm, foot slope , alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 782
752sheryoCommon in soil planted with Panax notoginseng amended with2% biochar (common biochar, panax notoginseng, sanqi plants, ph 6, xundian county, yunnan province, china, pot expreiment, soil)2021-03-11v3No1 / 783
827sheryoCommon in soil at 465cm depth in clayey till loam soil, Lund Denmark (common depth 450-480cm, lund, kingdom of denmark, agricultural field, clayey till, late weichselian glaciation, loam soil)2021-09-13v3No1 / 786
829sheryoCommon in soil depth of 0-27cm in Mollisol soil, Dekalb, Illinois, united states of america (common depth 0-27cm, dekalb county, illinois, state of illinois, mollisol, silt loam, soil, united states of america)2021-08-26v3No1 / 798
823sheryoCommon at 50-90cm depth in foot slope ultisol soil in auburn, alabama (common depth 50-90cm, foot slope , alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 815
618amnoncommon late flowering stage, rhizosphere, canada, farm, cannabis sativa2020-05-04v4No1 / 819
415amnoncommon rhizosphere, soil, citrus, orchard, china, cultivated environment2018-11-27v4No1 / 830
583amnoncommon soil, mountain, switzerland, depth (soil) 0-10cm, elevation 2000-3000m, canton of graubunden, calcareous parent material, ph 7-82020-01-28v3No1 / 830
842sheryoCommon in soil depth of 0-15cm in an old growth forest in Ontario, Canada (common depth 0-15cm, old growth forest, luvisol, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 834
761sheryoCommon in bulk sandy soil maize field in Germany (common ph 5, lower saxony, sandy soil, germany, maize field, bulk soil)2021-04-06v3No1 / 835
266amnoncommon in roots in JAM garden (common brassicaceae, boechera stricta, plant, united states of america, state of idaho, root)2017-12-19v4No1 / 843
698amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, ph 5-6, disease, plant disease, acute oak decline, park, united kingdom, oak, quercus, rhizosphere2028-04-01v3No1 / 848
827sheryoCommon in soil at 325cm depth in clayey till loam soil, Lund Denmark (common lund, kingdom of denmark, agricultural field, clayey till, late weichselian glaciation, loam soil, depth 300-350cm)2021-08-24v3No1 / 866
829sheryoCommon in soil depth of 108-140cm in Alfisol soil, Dekalb, Illinois, united states of america (common depth 108-140cm, sandy loam, sandy loam soil, hapludalf, alfisol, united states of america, soil, state of illinois, illinois, dekalb county)2021-08-26v3No1 / 871
618amnoncommon early flowering stage, rhizosphere, canada, farm, cannabis sativa2020-05-04v4No1 / 873
855sheryoCommon in soil depth of 75cm in fertilized soil in china (common depth 75cm, luancheng county, china, agricultural field, fertilized soil, soil)2021-12-27v3No1 / 873
854sheryoCommon in soil depth of 75-100cm of colluvial soil, Czech rebuplic (common depth 75-100cm, calcic chernozem, colluvial soil, ph 8, south moravian region, czech republic, soil)2021-12-23v3No1 / 879
996amnon high in city anthropogenic environmental material downstream compared to upstream in river water china fuzhou city prefecture xiyuan river fresh water surface water river 2022-12-28v3No1 / 890
854sheryoCommon in soil depth of 200-250cm of colluvial soil, Czech rebuplic (common depth 200-250cm, calcic chernozem, colluvial soil, ph 8, south moravian region, czech republic, soil)2021-12-23v3No1 / 894
786sheryoCommon in flood plain soil near cosumnes river, california, at 133-166cm depth (common depth (soil) 133-166cm, cosumnes river preserve, sacramento, state of california, united states of america, soil, flood plain)2021-05-18v3No1 / 898
807amnoncommon tropical storm, summer, okinawa islands, japan, filtered 0.2um, near shore, sea water, surface water2021-06-20v3No1 / 905
842sheryoCommon in soil depth of 15-30cm in a Decomissioned Agricultural Field in Ontario, Canada (common depth 15-30cm, dipsacus fullonum, solidago, apocynum, daucus carota, brunisol, decomissioned agricultural field, meadow ecosystem, grand river watershed, rare charitable research reserve, cambridge, province of ontario, canada, soil)2021-11-14v3No1 / 905
854sheryoCommon in soil depth of 25-50cm of colluvial soil, Czech rebuplic (common ph 8, calcic chernozem, czech republic, south moravian region, colluvial soil, depth 25-50cm, soil)2021-12-23v3No1 / 905
462amnoncommon depth (soil) 20-60cm, united states of america, state of tennessee, depth 30-75cm, silt clay loam, rhizosphere, populus, tree, cultivated environment2019-01-13v4No1 / 908
548amnoncommon minas gerais state, campos rupestres, brazil, rock2019-08-17v4No1 / 924
842sheryoHigher in soil depth of 0-15cm compared to soil depth 15-30cm in a zea mays agricultural field in Ontario, Canada ( high in depth 0-15cm compared to depth 15-30cm in zea mays preston flats agricultural field soil luvisol grand river watershed canada province of ontario cambridge rare charitable research reserve )2021-11-14v3No1 / 924
786sheryoCommon in flood plain soil near cosumnes river, california, at 166-200cm depth (common depth (soil) 166-200cm, flood plain, soil, united states of america, state of california, sacramento, cosumnes river preserve)2021-05-18v3No1 / 936
842sheryoCommon in soil depth of 15-30cm in a zea mays agricultural field in Ontario, Canada (common depth 15-30cm, zea mays, preston flats, agricultural field, soil, luvisol, grand river watershed, canada, province of ontario, cambridge, rare charitable research reserve)2021-11-14v3No1 / 944
98amnoncommon citrus, rhizosphere, quincy, fl, root, state of florida2017-04-01v4No1 / 950
854sheryoCommon in soil depth of 125-175cm of colluvial soil, Czech rebuplic (common depth 125-175cm, calcic chernozem, colluvial soil, ph 8, south moravian region, czech republic, soil)2021-12-23v3No1 / 962
414amnon high in ph<6 npk fertilizer compared to ph>6 in soil heilongjiang province agricultural feature triticum aestivum glycine max zea mays black soil mollisol china 2018-11-26v4No1 / 963
129amnoncommon ph 6-6.5, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, soil, root zone soil2017-04-15v4No1 / 968
842sheryoCommon in soil depth of 30-45cm in a Decomissioned Agricultural Field in Ontario, Canada (common depth 30-45cm, luvisol, dipsacus fullonum, solidago, apocynum, daucus carota, decomissioned agricultural field, meadow ecosystem, grand river watershed, rare charitable research reserve, cambridge, province of ontario, canada, soil)2021-11-14v3No1 / 970
931amnon high in jejunum duodenum compared to ileum feces colon caecum in tibet autonomous region riwoqe county china yak bos grunniens 2022-08-25v3No1 / 970
615amnoncommon saccharum, sugarcane, rhizosphere, campinas, brazil, greenhouse2020-04-27v4No1 / 974
842sheryoCommon in soil depth of 15-30cm in a Decomissioned Agricultural Field in Ontario, Canada (common depth 15-30cm, luvisol, dipsacus fullonum, solidago, apocynum, daucus carota, decomissioned agricultural field, meadow ecosystem, grand river watershed, rare charitable research reserve, cambridge, province of ontario, canada, soil)2021-11-14v3No1 / 974
970amnon high in winter compared to summer in depth (water) 0-20cm surface water newport river estuary town of beaufort united states of america atlantic ocean sea water 2022-12-23v3No1 / 978
462amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, united states of america, state of tennessee, rhizosphere, populus, tree, silt loam, cultivated environment2019-01-13v4No1 / 997
610sheryoCommon in agricultural field soil amended with straw (common straw, triticum aestivum, ph 7, wheat, kingdom of denmark, agricultural field, soil)2020-04-21v3No1 / 998
610sheryoCommon in agricultural field soil amended with low biochar (common low biochar, triticum aestivum, ph 7, wheat, kingdom of denmark, agricultural field, soil)2020-04-21v3No1 / 1009
786sheryoCommon in flood plain soil near cosumnes river, california, at 100-133cm depth (common depth (soil) 100-133cm, cosumnes river preserve, sacramento, state of california, united states of america, soil, flood plain)2021-05-18v3No1 / 1015
768sheryoCommon in maize fields in Brittany, France (common zea mays, maize field, cambisol, bretagne region, french republic, soil)2021-04-18v3No1 / 1034
786sheryocommon in flood plain soil near cosumnes river, california, at 0-30cm depth (common depth (soil) 0-30 cm, depth (soil) 0-20cm, flood plain, soil, united states of america, state of california, sacramento, cosumnes river preserve)2021-05-18v3No1 / 1048
842sheryoCommon in soil depth of 0-15cm in a Decomissioned Agricultural Field in Ontario, Canada (common depth 0-15cm, dipsacus fullonum, solidago, apocynum, daucus carota, brunisol, decomissioned agricultural field, meadow ecosystem, grand river watershed, rare charitable research reserve, cambridge, province of ontario, canada, soil)2021-11-14v3No1 / 1082
765sheryocommon in wheat field in the loess plateau in china (common triticum aestivum, ph 7.7, loess plateau, silt loam, chromic cambisol, shanxi province, china, soil)2021-04-12v3No1 / 1087
415amnoncommon rhizosphere, soil, citrus, orchard, brazil, cultivated environment2018-11-27v4No1 / 1091
905amnon high in ileum jejunum compared to feces colon caecum in western australia sheep age 1 year australia ovis aries research facility 2022-05-18v3No1 / 1092
101amnoncommon state of new york, merlot, vitis vinifera, grapevine, united states of america, root2017-04-03v4No1 / 1106
917amnoncommon qiao nature reserve, depth (soil) 0-20cm, sonneratia apetala, china, marsh, mangrove, ph 7-8, soil2022-07-08v3No1 / 1107
266amnoncommon in roots in MAH garden (common brassicaceae, boechera stricta, plant, united states of america, state of idaho, root)2017-12-19v4No1 / 1110
827sheryoCommon in soil at 25cm depth in clayey till loam soil, Lund Denmark (common depth (soil) 20-30cm, plough layer , loam soil, late weichselian glaciation, clayey till, agricultural field, kingdom of denmark, lund)2021-08-24v3No1 / 1111
698amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, control, ph 6-7, park, united kingdom, oak, quercus, rhizosphere2028-04-01v3No1 / 1115
764sheryocommon in leoss soil in wheat field grown under crop rotation with rapeseed pre-crop in germany (common bernburg, germany, soil, triticum aestivum, crop rotation, ph 7.6, brassica napus, rapeseed pre-crop)2021-04-12v3No1 / 1129
764sheryoCommon in leoss soil in wheat field grown under conservation tillage and crop rotation in germany (common ph 7.6, crop rotation, cultivator tillage, conservation tillage, triticum aestivum, soil, germany, bernburg)2021-04-12v3No1 / 1140
842sheryoCommon in soil depth of 0-15cm in a zea mays agricultural field in Ontario, Canada (common depth 0-15cm, zea mays, preston flats, agricultural field, soil, luvisol, grand river watershed, canada, province of ontario, cambridge, rare charitable research reserve)2021-11-14v3No1 / 1147
786sheryoCommon in flood plain soil near cosumnes river, california, at 30-60cm depth (common depth (soil) 30-60cm, cosumnes river preserve, sacramento, state of california, united states of america, soil, flood plain)2021-05-18v3No1 / 1180
615amnon high in rhizosphere compared to soil in saccharum sugarcane campinas brazil greenhouse 2020-04-27v4No1 / 1181
807amnon high in tropical storm compared to normal weather in summer okinawa islands japan filtered 0.2um near shore sea water surface water 2021-06-20v3No1 / 1191
917amnoncommon ph 7-8, futian national nature reserve, depth (soil) 0-20cm, kandelia candel, china, marsh, mangrove, soil2022-07-08v3No1 / 1197
917amnoncommon qiao nature reserve, depth (soil) 0-20cm, china, mudflat, marsh, ph 7-8, soil, saline marsh2022-07-08v3No1 / 1211
764sheryoCommon in leoss soil in wheat field grown under conventional tillage and crop rotation in germany (common crop rotation, triticum aestivum, ph 7.6, mouldboard plough, conventional tillage, loess chernozem, bernburg, germany, soil)2021-04-12v3No1 / 1213
309amnoncommon rhizosphere, germany, prunella vulgaris, woundwort2018-04-05v4No1 / 1217
531amnoncommon rhizosphere, greenhouse soil, farm, orthic anthrosol, cucumis sativus, cucumber, china2019-07-21v3No1 / 1223
764sheryoCommon in leoss soil in wheat field grown under crop rotation with maize pre-crop in germany (common maize pre-crop, ph 7.6, crop rotation, triticum aestivum, soil, germany, bernburg)2021-04-12v3No1 / 1225
423amnon high in no human contact chernobyl exclusion zone compared to human contact in bank vole myodes glareolus ukraine skin 2018-12-05v4No1 / 1229
798amnoncommon depth (soil) 10 cm, depth (soil) 0-20cm, ph 7-8, soil, orchard, apricot, prunus armeniaca, apennine mountains, italy2021-06-13v3No1 / 1230
855sheryoCommon in soil depth of 10cm in fertilized soil in china (common luancheng county, china, depth (water) 10cm, fertilized soil, agricultural field, soil)2021-12-27v3No1 / 1253
842sheryoCommon in soil depth of 0-15cm in a Decomissioned Agricultural Field in Ontario, Canada (common depth 0-15cm, luvisol, dipsacus fullonum, solidago, apocynum, daucus carota, decomissioned agricultural field, meadow ecosystem, grand river watershed, rare charitable research reserve, cambridge, province of ontario, canada, soil)2021-11-14v3No1 / 1281
917amnoncommon ph 6-6.5, futian national nature reserve, depth (soil) 0-20cm, china, mudflat, marsh, soil, saline marsh2022-07-08v3No1 / 1290
266amnonCommon in soil from MAH garden (common soil, united states of america, state of idaho, ph 6)2017-12-18v4No1 / 1299
98amnoncommon citrus, rhizosphere, ft. pierce, fl, root, state of florida2017-04-01v4No1 / 1340
917amnoncommon ph 6-6.5, kandelia candel, depth (soil) 0-20cm, marsh, china, qiao nature reserve, mangrove, soil2022-07-08v3No1 / 1364
98amnoncommon citrus, rhizosphere, gainesville, fl, root, state of florida2017-04-01v4No1 / 1371
917amnoncommon ph 6-7, depth (soil) 0-20cm, futian national nature reserve, sonneratia apetala, china, marsh, mangrove, soil2022-07-08v3No1 / 1379
821sheryoCommon in soil of continuous corn field at 0-10cm depth, Michigan USA (common united states of america, state of michigan, kellogg biological station, ph 5.9, mesic type hapludalf, kalamazoo loam, depth (soil) 0-10cm, continuous corn, corn, soil)2021-07-28v4No1 / 1380
266amnoncommon in soil from SIL garden (common soil, united states of america, state of idaho, ph 6)2017-12-18v4No1 / 1389
600sheryoCommon in unammended soil after 82 days (common depth (soil) 0-5cm, state of new york, soil, united states of america, coarse-loamy soil, ph 6, day 82)2020-03-27v4No1 / 1395
266amnoncoomon in roots in SIL garden (common brassicaceae, boechera stricta, plant, united states of america, state of idaho, root)2017-12-19v4No1 / 1399
40amnoncommon soil, field soil, nicotiana tabacum, rhizosphere, china2016-12-09v4No1 / 1420
462amnon high in rhizosphere compared to soil in united states of america state of tennessee populus tree cultivated environment 2019-01-12v4No1 / 1428
821sheryoCommon in soil of miscanthus field at 0-10cm depth, Michigan USA (common depth (soil) 0-10cm, miscanthus, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-07-28v4No1 / 1447
271amnoncommon depth (soil) 0-20cm, rhizosphere, glycine max, soybean, china2018-01-09v4No1 / 1459
631sheryoCommon in maize field biochar amended rhizosphere soil (common ph 7.85, biochar, rhizosphere, china, guizhou province, kaiyang county, soil, maize field, after 6 years)2020-06-02v3No1 / 1492
309amnoncommon rhizosphere, germany, festuca rubra, red fescue grass2018-04-05v4No1 / 1510
600sheryolower in stover ammendment soil ( high in unamended soil compared to stover amended in depth (soil) 0-5cm state of new york soil united states of america coarse-loamy soil ph 6 day 82 )2020-03-27v4No1 / 1612
631sheryocommon in maize field unamended rhizosphere soil (common unamended soil, ph 7.6, rhizosphere, china, guizhou province, kaiyang county, soil, maize field, after 6 years)2020-06-02v3No1 / 1637
154amnon high in control compared to uranium high uranium in soil australia kakadu national park sediment 2017-06-29v4No1 / 1663
696amnon high in alycaeus jagori compared to opisthostoma concinnum plectostoma concinnum in land snail stomach gastrointestinal system malaysia state of sabah 2028-03-28v3No1 / 1672
855sheryoHigher in soil depth of 10cm compared to soil depth of 75cm in fertilized soil in china ( high in depth (water) 10cm compared to depth 75cm in luancheng county china agricultural field fertilized soil soil )2021-12-27v3No1 / 1678
696amnon high in alycaeus jagori compared to georissa similis georissa in land snail stomach gastrointestinal system malaysia state of sabah 2028-03-28v3No1 / 1698
616amnoncommon in topsoil of PK/NP/NPK/NK fertilized sugarcane field (common depth (soil) 0-20cm, fertilized soil, ph 5.5-6, sugarcane, saccharum, soil, topsoil, china, guangzhou city prefecture)2020-04-27v3No1 / 1710
842sheryoHigher in soil depth of 0-15cm compared to 15-30cm in a Decomissioned Agricultural Field in Ontario, Canada ( high in depth 0-15cm compared to depth 15-30cm in luvisol dipsacus fullonum solidago apocynum daucus carota decomissioned agricultural field meadow ecosystem grand river watershed rare charitable research reserve cambridge province of ontario canada soil )2021-11-14v3No1 / 1723
631sheryoCommon in maize field unamended bulk soil (common bulk soil, unamended soil, ph 7.9, maize field, soil, kaiyang county, guizhou province, china)2020-06-02v3No1 / 1814
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in newt adult skin cambridgeshire triturus cristatus united kingdom )2018-07-30v4No1 / 1834
631sheryocommon in maize field biochar amended bulk soil, after 6 years of biochar amended (common ph 8, china, guizhou province, kaiyang county, soil, maize field, bulk soil, biochar, after 6 years)2020-06-02v3No1 / 1872
156amnoncommon soil, rhizosphere, brassica, brassica oleracea, china2017-07-27v4No1 / 1885
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>4, ph<5, china2018-02-11v4No1 / 1886
155amnoncommon in soil tightly bound to wheat root (common triticum aestivum, wheat, soil, root, china)2017-07-02v4No1 / 1977
101amnon high in root compared to rhizosphere in state of new york vitis vinifera united states of america merlot grapevine 2017-04-03v4No1 / 2075
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>6, ph<7, china2018-02-11v4No1 / 2223
296amnoncommon in wheat field soil (common soil, north china plain, depth 5cm, agricultural feature, wheat, winter, china)2018-02-11v4No1 / 2341
155amnoncommon in soil loosely bound to wheat root (common triticum aestivum, wheat, soil, rhizosphere, china)2017-07-02v4No1 / 2425
931amnon high in ruminal fluid rumen compared to ileum feces colon caecum in riwoqe county china yak tibet autonomous region bos grunniens 2022-08-25v3No1 / 2519
155amnoncommon in bulk soil in wheat field (common triticum aestivum, wheat, soil, bulk soil, china)2017-07-02v4No1 / 2594
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>8, china2018-02-11v4No1 / 2646
357amnon high in ph>4.5 compared to ph<4.5 in soil topsoil depth (soil) 0-10cm moist tropical forest woodland area forest ecosystem 2018-08-18v4No1 / 2773
271amnoncommon depth (soil) 0-20cm, soil, china2018-01-09v4No1 / 2856
155amnonlower in tightly bound root soil compared to loose soil and bulk soil ( high in bulk soil compared to root in triticum aestivum wheat soil china )2017-07-02v4No1 / 2933
837sheryoHigher in soil in agricultural feild compared after 10 years reforestation with Black locust trees, shaanxi, China ( high in triticum aestivum zea mays agricultural field compared to 10 years reforestation robinia pseudoacacia in silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 2994
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>5, ph<6, china2018-02-11v4No1 / 3508
837sheryoHigher in soil after 20 years compared to 30 years of reforestation with Black locust trees, shaanxi, China ( high in 20 years compared to 30 years in robinia pseudoacacia reforestation silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 3893
462amnon high in rhizosphere compared to root in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 4630
837sheryoHigher in soil after 30 years compared to 10 years of reforestation with Black locust trees, shaanxi, China ( high in 30 years compared to 10 years in robinia pseudoacacia reforestation silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 5245
837sheryoHigher in soil after 20 years compared to 10 years of reforestation with Black locust trees, shaanxi, China ( high in 20 years compared to 10 years in robinia pseudoacacia reforestation silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 5270
837sheryoHigher in soil after 20 years reforestation with Black locust trees compared agricultural feild, shaanxi, China ( high in robinia pseudoacacia reforestation 20 years compared to triticum aestivum zea mays agricultural field in silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 5661
100amnon high in ph ph<6 compared to ph>6 in soil urban biome park new york city central park 2017-04-03v4No1 / 5770
266amnon high in root compared to leaf in brassicaceae boechera stricta plant united states of america state of idaho 2017-12-19v4No1 / 5886
171amnonlower in roots compared to rhizosphere soil in rice ( high in rhizosphere soil compared to root in united states of america state of california oryza sativa rice )2017-07-25v4No1 / 7628

Problems / suggestions? Please email info AT dbbact DOT org