Search result for sequence:
TACGGAGGGAGCTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCACGTAGGCGGCGATTCAAGTCGGGGGTGAAATCCCGGGGCTCAACCCCGGAACTGCCTCCGAAACTAGATTGCTAGAATCCTGGAGAGGCGAGTGGAATTCCGAG
common ontology terms
term enrichment score
TermScore
southern united states0.666667
aquatic snake0.666667
snake0.500000
agkistrodon piscivorus0.444444
nerodia sipedon0.444444
northern water snake0.444444
LOWER IN terrestrial snake0.285714
skin0.076923
united states of america0.010638
Fraction of dbbact annotations with this term covered by the query
TermScore
southern united states0.500000
agkistrodon piscivorus0.500000
aquatic snake0.500000
nerodia sipedon0.500000
northern water snake0.500000
LOWER IN terrestrial snake0.500000
snake0.333333
skin0.040000
united states of america0.005348
Fraction of annotations for the query sequences containing the term
TermScore
snake1.000000
skin1.000000
united states of america1.000000
southern united states1.000000
aquatic snake1.000000
agkistrodon piscivorus0.400000
nerodia sipedon0.400000
northern water snake0.400000
LOWER IN terrestrial snake0.200000

Problems / suggestions? Please email info AT dbbact DOT org