Search result for sequence:
TACGGAGGGAGCTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGTGCGTAGGCGGCTATTCAAGTCAGAGGTGAAAGCCTGGAGCTCAACTCCAGAACTGCCTTTGAAACTAGATAGCTAGAATCTTGGAGAGGTGAGTGGAATTCCGAG
common ontology terms
term enrichment score
TermScore
river0.557214
fresh water0.533333
mississippi river0.355932
water0.281150
sand0.235294
filtered 2.7um0.222222
upper mississippi river0.222222
fish farm0.210526
biofilter0.210526
depth 10 cm0.210526
depth 1m0.210526
upstream0.210526
jiulong river0.210526
fujian province0.210526
state of wisconsin0.190476
depth 0.5m0.190476
filtered 0.2um0.173913
middle0.166667
bottom0.166667
koshi river0.166667
LOWER IN downstream0.166667
free floating0.160000
lake0.160000
kingdom of the netherlands0.153846
nepal0.153846
particle0.153846
drinking water0.125000
lake erie0.117647
LOWER IN lower mississippi river0.117647
freshwater biome0.117647
LOWER IN free floating0.117647
freshwater lake0.111111
depth 5cm0.100000
LOWER IN dry season0.095238
wet season0.095238
sediment0.093023
LOWER IN winter0.071429
united states of america0.071066
summer0.064516
LOWER IN deposits0.062500
tributary0.062500
LOWER IN surface0.062500
near shore0.062500
LOWER IN offshore0.062500
LOWER IN water pipes0.062500
mine tailing0.062500
alkaline mine tailing0.062500
guangxi zhuang autonomous region0.062500
zone 10.062500
LOWER IN zone 2,30.062500
uppper mississippi river0.062500
photic zone0.062500
populated place0.062500
low turbidity0.062500
LOWER IN high turbidity0.062500
turbidity0.062500
latyrus pratensis0.062500
meadow pea-vine0.062500
LOWER IN other plants0.062500
southern united states0.062500
aquatic snake0.062500
LOWER IN terrestrial snake0.062500
mussel0.062500
unionidae0.062500
LOWER IN filtered 0.2um0.062500
aquatic biome0.062500
particles0.062500
LOWER IN biofilm0.060606
depth 0-1 meter0.060606
particle bound0.060606
stream0.060606
surface0.060606
snake0.060606
china0.060000
wastewater treatment plant0.058824
effluent0.058824
LOWER IN autumn0.058824
spring0.055556
biofilm0.055556
autumn0.052632
kingdom of spain0.050000
germany0.048780
canada0.045455
city0.042553
skin0.037037
rhizosphere0.035088
soil0.024691
Fraction of dbbact annotations with this term covered by the query
TermScore
mississippi river0.750000
filtered 0.2um0.666667
filtered 2.7um0.666667
upper mississippi river0.666667
river0.583333
fish farm0.500000
biofilter0.500000
middle0.500000
bottom0.500000
LOWER IN deposits0.500000
depth 10 cm0.500000
koshi river0.500000
tributary0.500000
LOWER IN surface0.500000
lake erie0.500000
near shore0.500000
LOWER IN offshore0.500000
LOWER IN water pipes0.500000
mine tailing0.500000
alkaline mine tailing0.500000
guangxi zhuang autonomous region0.500000
zone 10.500000
LOWER IN zone 2,30.500000
depth 1m0.500000
uppper mississippi river0.500000
upstream0.500000
photic zone0.500000
LOWER IN lower mississippi river0.500000
LOWER IN downstream0.500000
jiulong river0.500000
fujian province0.500000
populated place0.500000
low turbidity0.500000
LOWER IN high turbidity0.500000
turbidity0.500000
latyrus pratensis0.500000
meadow pea-vine0.500000
LOWER IN other plants0.500000
southern united states0.500000
aquatic snake0.500000
LOWER IN terrestrial snake0.500000
freshwater biome0.500000
mussel0.500000
unionidae0.500000
LOWER IN free floating0.500000
LOWER IN filtered 0.2um0.500000
aquatic biome0.500000
particles0.500000
fresh water0.444444
sand0.400000
free floating0.400000
lake0.400000
state of wisconsin0.333333
kingdom of the netherlands0.333333
nepal0.333333
freshwater lake0.333333
LOWER IN biofilm0.333333
particle0.333333
depth 0-1 meter0.333333
particle bound0.333333
depth 0.5m0.333333
stream0.333333
surface0.333333
snake0.333333
wastewater treatment plant0.250000
effluent0.250000
LOWER IN autumn0.250000
depth 5cm0.200000
water0.173913
drinking water0.166667
LOWER IN dry season0.166667
wet season0.166667
spring0.166667
biofilm0.166667
autumn0.125000
kingdom of spain0.100000
germany0.090909
sediment0.086957
LOWER IN winter0.076923
canada0.071429
summer0.062500
city0.058824
skin0.041667
united states of america0.038251
rhizosphere0.037037
china0.035294
soil0.019608
Fraction of annotations for the query sequences containing the term
TermScore
water0.733333
fresh water0.666667
river0.533333
united states of america0.500000
mississippi river0.233333
china0.200000
sand0.166667
fish farm0.133333
biofilter0.133333
state of wisconsin0.133333
depth 10 cm0.133333
depth 1m0.133333
upstream0.133333
filtered 2.7um0.133333
upper mississippi river0.133333
depth 0.5m0.133333
jiulong river0.133333
fujian province0.133333
middle0.100000
bottom0.100000
kingdom of the netherlands0.100000
drinking water0.100000
koshi river0.100000
nepal0.100000
free floating0.100000
filtered 0.2um0.100000
lake0.100000
sediment0.100000
particle0.100000
LOWER IN downstream0.100000
lake erie0.066667
freshwater lake0.066667
LOWER IN lower mississippi river0.066667
summer0.066667
LOWER IN winter0.066667
LOWER IN dry season0.066667
wet season0.066667
freshwater biome0.066667
depth 5cm0.066667
LOWER IN free floating0.066667
LOWER IN deposits0.033333
tributary0.033333
LOWER IN surface0.033333
near shore0.033333
LOWER IN offshore0.033333
LOWER IN biofilm0.033333
LOWER IN water pipes0.033333
soil0.033333
mine tailing0.033333
alkaline mine tailing0.033333
guangxi zhuang autonomous region0.033333
zone 10.033333
LOWER IN zone 2,30.033333
uppper mississippi river0.033333
canada0.033333
depth 0-1 meter0.033333
photic zone0.033333
particle bound0.033333
city0.033333
populated place0.033333
stream0.033333
low turbidity0.033333
LOWER IN high turbidity0.033333
turbidity0.033333
autumn0.033333
wastewater treatment plant0.033333
effluent0.033333
spring0.033333
LOWER IN autumn0.033333
surface0.033333
rhizosphere0.033333
germany0.033333
latyrus pratensis0.033333
meadow pea-vine0.033333
LOWER IN other plants0.033333
biofilm0.033333
kingdom of spain0.033333
snake0.033333
skin0.033333
southern united states0.033333
aquatic snake0.033333
LOWER IN terrestrial snake0.033333
mussel0.033333
unionidae0.033333
LOWER IN filtered 0.2um0.033333
aquatic biome0.033333
particles0.033333
Exp. ID User ID Description Date Region Flag Sequences
459amnonhigh freq. in middle, bottom in aquaculture biofilter sand (highfreq water, fresh water, fish farm, biofilter, sand, united states of america, state of wisconsin, middle, bottom)2019-01-12v4No1 / 24
178amnonhigher in drinking water compared to loose deposits in water pipes ( high in drinking water compared to deposits in kingdom of the netherlands water )2017-08-10v4No1 / 61
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, tributary, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 80
459amnonlower in surface compared to middle and bottom in aquaculture biofilter sand ( high in middle bottom compared to surface in water fresh water fish farm biofilter sand united states of america state of wisconsin )2019-01-12v4No1 / 89
226amnonlower in offshore station compared to near shore station ( high in near shore compared to offshore in water lake lake erie united states of america freshwater lake fresh water )2017-10-29v4No1 / 106
178amnonhigher in drinking water compared to water pipe biofilm ( high in drinking water compared to biofilm water pipes in kingdom of the netherlands water )2017-08-10v4No1 / 123
178amnoncommon kingdom of the netherlands, water, drinking water2017-08-10v4No1 / 148
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 172
402amnon high in zone 1 compared to zone 2,3 in sediment soil mine tailing alkaline mine tailing guangxi zhuang autonomous region china 2018-11-18v4No1 / 189
443amnoncommon mississippi river, water, river, fresh water, depth 1m, united states of america, uppper mississippi river, upstream, particle, filtered 2.7um2019-01-07v4No1 / 201
169amnoncommon lake, fresh water, water, canada, depth 0-1 meter, photic zone2017-07-24v4No1 / 234
459amnoncommon in middle, bottom in aquaculture biofilter sand (common water, fresh water, fish farm, biofilter, sand, united states of america, state of wisconsin, middle, bottom)2019-01-12v4No1 / 262
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, nepal, particle bound, filtered 2.7um2019-07-22v4No1 / 315
226amnoncommon water, lake, lake erie, united states of america, freshwater lake, fresh water2017-10-29v4No1 / 316
443amnonlower in lower mississippi river (downstream) compared to upper mississippi river ( high in upper mississippi river upstream compared to lower mississippi river downstream in mississippi river water river fresh water depth 1m united states of america free floating filtered 0.2um )2019-01-07v4No1 / 335
254amnoncommon river, water, fresh water, depth 0.5m, jiulong river, fujian province, china2017-11-23v4No1 / 347
254amnonhigher in river when close to populated region compared to downstream ( high in city populated place upstream compared to downstream in river water fresh water depth 0.5m jiulong river fujian province china )2017-11-23v4No1 / 356
170amnonhigher in low turbidity river water ( high in low turbidity turbidity compared to high turbidity in river water fresh water depth 10 cm united states of america stream )2017-07-24v4No1 / 395
443amnonlower in lower mississippi river (downstream) compared to upper mississippi river ( high in upstream upper mississippi river compared to downstream lower mississippi river in mississippi river water river fresh water depth 1m united states of america particle filtered 2.7um )2019-01-07v4No1 / 425
254amnon high in summer wet season autumn compared to winter dry season in river water fresh water depth 0.5m jiulong river fujian province china 2017-11-23v4No1 / 571
160amnoncommon in wastewater treatment plant effluent in spring in china (common wastewater treatment plant, effluent, spring, china)2017-07-12v4No1 / 573
254amnon high in summer wet season compared to winter dry season autumn in river water fresh water depth 0.5m jiulong river fujian province china 2017-11-23v4No1 / 581
459amnoncommon in surface in aquaculture biofilter sand (common water, fresh water, fish farm, biofilter, sand, united states of america, state of wisconsin, surface)2019-01-12v4No1 / 622
309amnon high in latyrus pratensis meadow pea-vine compared to other plants in rhizosphere germany 2018-04-05v4No1 / 680
252amnoncommon in river sand biofilm (common river, biofilm, kingdom of spain, sand)2017-11-22v4No1 / 1181
536amnon high in aquatic snake compared to terrestrial snake in snake skin united states of america southern united states 2019-07-28v4No1 / 1772
166amnoncommon in river sediment (5cm) with mussels (common united states of america, river, sediment, freshwater biome, mississippi river, depth 5cm, upper mississippi river, mussel, unionidae)2017-07-18v4No1 / 2254
443amnon high in particle filtered 2.7um compared to free floating filtered 0.2um in water river fresh water depth 1m united states of america mississippi river 2019-01-07v4No1 / 2266
166amnoncommon in river sediment (5cm) without mussels (common freshwater biome, river, united states of america, sediment, mississippi river, depth 5cm, upper mississippi river)2017-07-18v4No1 / 2877
103amnonhigher in particle bound fraction compared to free floating bacteria in mississippi river ( high in particles compared to free floating in river united states of america mississippi river fresh water aquatic biome )2017-04-05v4No1 / 3559

Problems / suggestions? Please email info AT dbbact DOT org