Search result for sequence:
TACGGAGGGAGCTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGTGCGTAGGCGGCTATTCAAGTCAGAGGTGAAAGCCTGGAGCTCAACTCCAGAACTGCCTTTGAAACTAGATAGCTAGAATCTTGGAGAGGTGAGTGGAATTCCGAG
common ontology terms
term enrichment score
TermScore
fresh water0.550532
river0.512586
mississippi river0.315789
water0.287540
sand0.210526
filtered 2.7um0.195122
upper mississippi river0.195122
biofilter0.186047
depth 10 cm0.186047
depth 1m0.186047
upstream0.186047
jiulong river0.186047
fujian province0.186047
fish farm0.170213
state of wisconsin0.170213
depth 0.5m0.170213
filtered 0.2um0.151899
middle0.146341
bottom0.146341
koshi river0.146341
LOWER IN downstream0.146341
spring water0.146341
free floating0.141176
kingdom of the netherlands0.136364
nepal0.136364
lake0.136364
particle0.136364
drinking water0.113208
lake erie0.102564
LOWER IN lower mississippi river0.102564
days 30-400.102564
ryegrass0.102564
freshwater biome0.102564
LOWER IN free floating0.102564
freshwater lake0.097561
10 cm depth0.097561
depth 5cm0.088889
sediment0.086331
LOWER IN dry season0.085106
wet season0.085106
jiangsu province0.085106
ph 7-80.081633
state of florida0.075000
united states of america0.074573
rhizosphere0.072289
china0.065306
LOWER IN winter0.063492
summer0.056338
LOWER IN deposits0.054054
tributary0.054054
LOWER IN surface0.054054
near shore0.054054
LOWER IN offshore0.054054
LOWER IN water pipes0.054054
mine tailing0.054054
alkaline mine tailing0.054054
guangxi zhuang autonomous region0.054054
zone 10.054054
LOWER IN zone 2,30.054054
uppper mississippi river0.054054
photic zone0.054054
populated place0.054054
low turbidity0.054054
LOWER IN high turbidity0.054054
turbidity0.054054
location 10.054054
spring0.054054
location 20.054054
location 40.054054
latyrus pratensis0.054054
meadow pea-vine0.054054
LOWER IN other plants0.054054
southern united states0.054054
aquatic snake0.054054
LOWER IN terrestrial snake0.054054
mussel0.054054
unionidae0.054054
LOWER IN filtered 0.2um0.054054
aquatic biome0.054054
particles0.054054
LOWER IN biofilm0.052632
canada0.052632
depth 0-1 meter0.052632
particle bound0.052632
stream0.052632
surface0.052632
snake0.052632
wastewater treatment plant0.051282
effluent0.051282
LOWER IN autumn0.050000
biochar0.048780
biofilm0.048780
soil0.046875
autumn0.044444
germany0.042553
kingdom of spain0.042553
city0.037736
skin0.032258
Fraction of dbbact annotations with this term covered by the query
TermScore
mississippi river0.750000
filtered 0.2um0.666667
filtered 2.7um0.666667
upper mississippi river0.666667
river0.583333
biofilter0.500000
middle0.500000
bottom0.500000
LOWER IN deposits0.500000
depth 10 cm0.500000
koshi river0.500000
tributary0.500000
LOWER IN surface0.500000
lake erie0.500000
near shore0.500000
LOWER IN offshore0.500000
LOWER IN water pipes0.500000
mine tailing0.500000
alkaline mine tailing0.500000
guangxi zhuang autonomous region0.500000
zone 10.500000
LOWER IN zone 2,30.500000
depth 1m0.500000
uppper mississippi river0.500000
upstream0.500000
photic zone0.500000
LOWER IN lower mississippi river0.500000
LOWER IN downstream0.500000
jiulong river0.500000
fujian province0.500000
populated place0.500000
low turbidity0.500000
LOWER IN high turbidity0.500000
turbidity0.500000
spring water0.500000
location 10.500000
spring0.500000
location 20.500000
location 40.500000
latyrus pratensis0.500000
meadow pea-vine0.500000
LOWER IN other plants0.500000
days 30-400.500000
ryegrass0.500000
southern united states0.500000
aquatic snake0.500000
LOWER IN terrestrial snake0.500000
freshwater biome0.500000
mussel0.500000
unionidae0.500000
LOWER IN free floating0.500000
LOWER IN filtered 0.2um0.500000
aquatic biome0.500000
particles0.500000
fresh water0.473684
sand0.400000
free floating0.400000
fish farm0.333333
state of wisconsin0.333333
kingdom of the netherlands0.333333
nepal0.333333
lake0.333333
freshwater lake0.333333
LOWER IN biofilm0.333333
particle0.333333
canada0.333333
depth 0-1 meter0.333333
particle bound0.333333
depth 0.5m0.333333
stream0.333333
surface0.333333
10 cm depth0.333333
snake0.333333
wastewater treatment plant0.250000
effluent0.250000
LOWER IN autumn0.200000
depth 5cm0.200000
water0.180000
drinking water0.166667
LOWER IN dry season0.166667
wet season0.166667
jiangsu province0.166667
biochar0.166667
biofilm0.166667
ph 7-80.142857
autumn0.100000
sediment0.086957
germany0.083333
kingdom of spain0.083333
LOWER IN winter0.071429
state of florida0.066667
rhizosphere0.062500
city0.055556
summer0.055556
united states of america0.040201
china0.038095
skin0.037037
soil0.032258
Fraction of annotations for the query sequences containing the term
TermScore
water0.714286
fresh water0.657143
united states of america0.514286
river0.457143
china0.228571
mississippi river0.200000
sand0.142857
fish farm0.114286
biofilter0.114286
state of wisconsin0.114286
depth 10 cm0.114286
depth 1m0.114286
upstream0.114286
filtered 2.7um0.114286
upper mississippi river0.114286
depth 0.5m0.114286
jiulong river0.114286
fujian province0.114286
middle0.085714
bottom0.085714
kingdom of the netherlands0.085714
drinking water0.085714
koshi river0.085714
nepal0.085714
free floating0.085714
filtered 0.2um0.085714
lake0.085714
sediment0.085714
soil0.085714
particle0.085714
LOWER IN downstream0.085714
state of florida0.085714
spring water0.085714
rhizosphere0.085714
lake erie0.057143
freshwater lake0.057143
LOWER IN lower mississippi river0.057143
summer0.057143
LOWER IN winter0.057143
LOWER IN dry season0.057143
wet season0.057143
days 30-400.057143
ryegrass0.057143
ph 7-80.057143
10 cm depth0.057143
jiangsu province0.057143
freshwater biome0.057143
depth 5cm0.057143
LOWER IN free floating0.057143
LOWER IN deposits0.028571
tributary0.028571
LOWER IN surface0.028571
near shore0.028571
LOWER IN offshore0.028571
LOWER IN biofilm0.028571
LOWER IN water pipes0.028571
mine tailing0.028571
alkaline mine tailing0.028571
guangxi zhuang autonomous region0.028571
zone 10.028571
LOWER IN zone 2,30.028571
uppper mississippi river0.028571
canada0.028571
depth 0-1 meter0.028571
photic zone0.028571
particle bound0.028571
city0.028571
populated place0.028571
stream0.028571
low turbidity0.028571
LOWER IN high turbidity0.028571
turbidity0.028571
location 10.028571
autumn0.028571
wastewater treatment plant0.028571
effluent0.028571
spring0.028571
LOWER IN autumn0.028571
location 20.028571
surface0.028571
location 40.028571
germany0.028571
latyrus pratensis0.028571
meadow pea-vine0.028571
LOWER IN other plants0.028571
biochar0.028571
biofilm0.028571
kingdom of spain0.028571
snake0.028571
skin0.028571
southern united states0.028571
aquatic snake0.028571
LOWER IN terrestrial snake0.028571
mussel0.028571
unionidae0.028571
LOWER IN filtered 0.2um0.028571
aquatic biome0.028571
particles0.028571
Exp. ID User ID Description Date Region Flag Sequences
459amnonhigh freq. in middle, bottom in aquaculture biofilter sand (dominant water, fresh water, fish farm, biofilter, sand, united states of america, state of wisconsin, middle, bottom)2019-01-12v4No1 / 24
178amnonhigher in drinking water compared to loose deposits in water pipes ( high in drinking water compared to deposits in kingdom of the netherlands water )2017-08-10v4No1 / 61
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, tributary, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 80
459amnonlower in surface compared to middle and bottom in aquaculture biofilter sand ( high in middle bottom compared to surface in water fresh water fish farm biofilter sand united states of america state of wisconsin )2019-01-12v4No1 / 89
226amnonlower in offshore station compared to near shore station ( high in near shore compared to offshore in water lake lake erie united states of america freshwater lake fresh water )2017-10-29v4No1 / 106
178amnonhigher in drinking water compared to water pipe biofilm ( high in drinking water compared to biofilm water pipes in kingdom of the netherlands water )2017-08-10v4No1 / 123
178amnoncommon kingdom of the netherlands, water, drinking water2017-08-10v4No1 / 148
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 172
402amnon high in zone 1 compared to zone 2,3 in sediment soil mine tailing alkaline mine tailing guangxi zhuang autonomous region china 2018-11-18v4No1 / 189
443amnoncommon mississippi river, water, river, fresh water, depth 1m, united states of america, uppper mississippi river, upstream, particle, filtered 2.7um2019-01-07v4No1 / 201
169amnoncommon lake, fresh water, water, canada, depth 0-1 meter, photic zone2017-07-24v4No1 / 234
459amnoncommon in middle, bottom in aquaculture biofilter sand (common water, fresh water, fish farm, biofilter, sand, united states of america, state of wisconsin, middle, bottom)2019-01-12v4No1 / 262
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, nepal, particle bound, filtered 2.7um2019-07-22v4No1 / 315
226amnoncommon water, lake, lake erie, united states of america, freshwater lake, fresh water2017-10-29v4No1 / 316
443amnonlower in lower mississippi river (downstream) compared to upper mississippi river ( high in upper mississippi river upstream compared to lower mississippi river downstream in mississippi river water river fresh water depth 1m united states of america free floating filtered 0.2um )2019-01-07v4No1 / 335
254amnoncommon river, water, fresh water, depth 0.5m, jiulong river, fujian province, china2017-11-23v4No1 / 347
254amnonhigher in river when close to populated region compared to downstream ( high in city populated place upstream compared to downstream in river water fresh water depth 0.5m jiulong river fujian province china )2017-11-23v4No1 / 356
170amnonhigher in low turbidity river water ( high in low turbidity turbidity compared to high turbidity in river water fresh water depth 10 cm united states of america stream )2017-07-24v4No1 / 395
443amnonlower in lower mississippi river (downstream) compared to upper mississippi river ( high in upstream upper mississippi river compared to downstream lower mississippi river in mississippi river water river fresh water depth 1m united states of america particle filtered 2.7um )2019-01-07v4No1 / 425
612amnoncommon state of florida, united states of america, spring water, water, fresh water, location 12020-04-22v4No1 / 518
254amnon high in summer wet season autumn compared to winter dry season in river water fresh water depth 0.5m jiulong river fujian province china 2017-11-23v4No1 / 571
160amnoncommon in wastewater treatment plant effluent in spring in china (common wastewater treatment plant, effluent, spring, china)2017-07-12v4No1 / 573
254amnon high in summer wet season compared to winter dry season autumn in river water fresh water depth 0.5m jiulong river fujian province china 2017-11-23v4No1 / 581
612amnoncommon state of florida, united states of america, spring water, water, fresh water, location 22020-04-22v4No1 / 596
459amnoncommon in surface in aquaculture biofilter sand (common water, fresh water, fish farm, biofilter, sand, united states of america, state of wisconsin, surface)2019-01-12v4No1 / 622
612amnoncommon state of florida, united states of america, spring water, water, fresh water, location 42020-04-22v4No1 / 655
309amnon high in latyrus pratensis meadow pea-vine compared to other plants in rhizosphere germany 2018-04-05v4No1 / 680
624sheryoCommon in ryegrass rhizosphere soil after 30-40 days (common days 30-40, rhizosphere, ryegrass, ph 7-8, 10 cm depth, soil, jiangsu province, china)2020-05-11v4No1 / 966
624sheryocommon in ryegrass rhizosphere soil amended with biochar after 30-40 days (common china, jiangsu province, soil, 10 cm depth, ph 7-8, ryegrass, rhizosphere, days 30-40, biochar)2020-05-11v4No1 / 1017
252amnoncommon in river sand biofilm (common river, biofilm, kingdom of spain, sand)2017-11-22v4No1 / 1181
536amnon high in aquatic snake compared to terrestrial snake in snake skin united states of america southern united states 2019-07-28v4No1 / 1772
166amnoncommon in river sediment (5cm) with mussels (common united states of america, river, sediment, freshwater biome, mississippi river, depth 5cm, upper mississippi river, mussel, unionidae)2017-07-18v4No1 / 2254
443amnon high in particle filtered 2.7um compared to free floating filtered 0.2um in water river fresh water depth 1m united states of america mississippi river 2019-01-07v4No1 / 2266
166amnoncommon in river sediment (5cm) without mussels (common freshwater biome, river, united states of america, sediment, mississippi river, depth 5cm, upper mississippi river)2017-07-18v4No1 / 2877
103amnonhigher in particle bound fraction compared to free floating bacteria in mississippi river ( high in particles compared to free floating in river united states of america mississippi river fresh water aquatic biome )2017-04-05v4No1 / 3559

Problems / suggestions? Please email info AT dbbact DOT org