Search result for sequence:
TACGGAGGGCGCAAGCGTTGTTCGGAATTACTGGGCGTAAAGAGCGTGTAGGCGGTTTGGTCAGTCGGATGTGAAAGCCCCGGGCTCAACTCGGGAATTGCACCCGAAACTGCCAGGCTAGAGTCCCGGAGAGGAAGGCGGAACTCCCAG
common ontology terms
Fraction of dbbact annotations with this term covered by the query
TermScore
mudflat0.500000
dongzhaigang national nature reserve0.500000
mangrove biome0.500000
kandelia candel0.500000
futian national nature reserve0.500000
leizhou nature reserve0.500000
hainan autonomous prefecture0.333333
mangrove0.333333
spartina alterniflora0.333333
guangdong province0.333333
mangrove swamp0.250000
depth 0-20cm0.200000
zhejiang province0.200000
marine sediment0.071429
soil0.018519
china0.010417
Fraction of annotations for the query sequences containing the term
TermScore
mangrove biome1.000000
depth 0-20cm1.000000
marine sediment1.000000
mangrove swamp1.000000
soil1.000000
china1.000000
futian national nature reserve0.500000
zhejiang province0.500000
mudflat0.333333
kandelia candel0.333333
mangrove0.333333
spartina alterniflora0.333333
leizhou nature reserve0.333333
guangdong province0.333333
dongzhaigang national nature reserve0.166667
hainan autonomous prefecture0.166667

Problems / suggestions? Please email info AT dbbact DOT org