Search result for sequence:
TACGGAGGGGACTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCACGTAGGCGGACCAGAAAGTTGGGGGTGAAATCCCGGGGCTCAACCCCGGAACTGCCTTCAAAACTATTGGTCTGGAGTTCGAGAGAGGTGAGTGGAATTCCGAG
common ontology terms
term enrichment score
TermScore
southern united states0.666667
snake0.500000
aquatic snake0.400000
fossorial snake0.400000
pantherophis obsoletus0.307692
black rat snake0.307692
arboreal snake0.307692
nerodia sipedon0.307692
northern water snake0.307692
diadophis punctatus0.307692
ringneck snake0.307692
crotalus horridus0.181818
timber rattlesnake0.181818
carphophis amoenus0.181818
worm snake0.181818
LOWER IN terrestrial snake0.181818
skin0.076923
united states of america0.010638
Fraction of dbbact annotations with this term covered by the query
TermScore
southern united states0.500000
pantherophis obsoletus0.500000
black rat snake0.500000
arboreal snake0.500000
aquatic snake0.500000
nerodia sipedon0.500000
northern water snake0.500000
crotalus horridus0.500000
timber rattlesnake0.500000
diadophis punctatus0.500000
ringneck snake0.500000
fossorial snake0.500000
carphophis amoenus0.500000
worm snake0.500000
LOWER IN terrestrial snake0.500000
snake0.333333
skin0.040000
united states of america0.005348
Fraction of annotations for the query sequences containing the term
TermScore
snake1.000000
skin1.000000
united states of america1.000000
southern united states1.000000
aquatic snake0.333333
fossorial snake0.333333
pantherophis obsoletus0.222222
black rat snake0.222222
arboreal snake0.222222
nerodia sipedon0.222222
northern water snake0.222222
diadophis punctatus0.222222
ringneck snake0.222222
crotalus horridus0.111111
timber rattlesnake0.111111
carphophis amoenus0.111111
worm snake0.111111
LOWER IN terrestrial snake0.111111

Problems / suggestions? Please email info AT dbbact DOT org