Search result for sequence:
TACGGAGGGGGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTACGCAGGCGGTCTGTTAAGTCAGATGTGAAATCCCCAGGCTTAACCTGAAAACTGCATTTGAAACTGGCAGGCTAGAGTCTCGTAGAGGGGGGTAAAATTCCAGG
common ontology terms
term enrichment score
TermScore
cinara0.666667
cinara watsoni0.500000
cinara taeda0.500000
Fraction of dbbact annotations with this term covered by the query
TermScore
cinara0.500000
cinara watsoni0.500000
cinara taeda0.500000
Fraction of annotations for the query sequences containing the term
TermScore
cinara1.000000
cinara watsoni0.500000
cinara taeda0.500000
Exp. ID User ID Description Date Region Flag Sequences
68amnondominant cinara, cinara watsoni2017-02-20v4No1 / 1
68amnondominant cinara, cinara taeda2017-02-20v4No1 / 1

Problems / suggestions? Please email info AT dbbact DOT org