Search result for sequence:
TACGGAGGGGGCTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCACGTAGGCGGACCAGAAAGTTGGGGGTGAAATCCCGGGGCTCAACCTCGGAACTGCCTTCAAAACTATTGGTCTGGAGTTCGAGAGAGGTGAGTGGAATTCCGAG
common ontology terms
term enrichment score
TermScore
canada0.444444
skin0.308851
southern united states0.270270
snake0.238095
zoological garden0.204819
toronto zoo0.164948
african lion safari0.164948
captive0.153110
farm0.114723
israel0.112150
cannabis sativa0.109890
leaf0.109661
mexico0.106952
desert0.101523
air0.100671
fossorial snake0.089888
agave0.089888
dust0.070175
sandy loam soil0.068966
negev desert0.068966
guanajuato0.068966
irrigated0.066667
greenhouse0.066667
rhizosphere0.066667
leaf surface0.064516
austria0.060606
ph 7-80.058824
plant0.057143
state of california0.054795
united states of america0.053777
research facility0.049383
floor0.047619
wild horse0.047059
pantherophis obsoletus0.047059
black rat snake0.047059
arboreal snake0.047059
crotalus horridus0.047059
timber rattlesnake0.047059
thamnophis sirtalis0.047059
common garter snake0.047059
coluber constrictor0.047059
eastern racer snake0.047059
carphophis amoenus0.047059
worm snake0.047059
camelus bactrianus0.047059
bactrian camel0.047059
diadophis punctatus0.047059
ringneck snake0.047059
cow milk (raw)0.047059
cow milk (fluid)0.047059
milk0.047059
hong kong0.047059
spring water0.047059
size < 10um0.047059
early flowering stage0.047059
pongo abelii0.045977
sumatran orangutan0.045977
french republic0.045455
equus przewalskii0.044944
duodenum0.044444
nasopharynx0.043956
australia0.040404
italy0.038835
soil0.038647
child0.038462
homo sapiens0.038168
LOWER IN soil0.038095
control0.036036
state of florida0.036036
city0.034188
fresh water0.033613
nasal wash0.024096
rem sleep behavior disorder0.024096
cleanroom0.024096
perth0.024096
LOWER IN recurrent otitis media0.024096
age 2 years0.024096
LOWER IN age 7 years0.024096
gallbladder0.024096
bile0.024096
centrocercus urophasianus0.024096
greater sage-grouse0.024096
state of wyoming0.024096
food product type0.024096
vigna radiata0.024096
mung bean sprouts0.024096
producer c20.024096
eidolon helvum0.024096
fruit bat0.024096
LOWER IN kitchen0.024096
LOWER IN sink0.024096
bathroom0.024096
shower0.024096
tile0.024096
building wall0.024096
rangifer tarandus0.024096
reindeer0.024096
sciurus carolinensis0.024096
eastern gray squirrel0.024096
pteropus giganteus0.024096
Fraction of dbbact annotations with this term covered by the query
TermScore
canada0.666667
floor0.666667
dust0.666667
toronto zoo0.500000
wild horse0.500000
southern united states0.500000
pantherophis obsoletus0.500000
black rat snake0.500000
arboreal snake0.500000
crotalus horridus0.500000
timber rattlesnake0.500000
thamnophis sirtalis0.500000
common garter snake0.500000
nasal wash0.500000
rem sleep behavior disorder0.500000
coluber constrictor0.500000
eastern racer snake0.500000
carphophis amoenus0.500000
worm snake0.500000
fossorial snake0.500000
african lion safari0.500000
camelus bactrianus0.500000
bactrian camel0.500000
diadophis punctatus0.500000
ringneck snake0.500000
cleanroom0.500000
perth0.500000
LOWER IN recurrent otitis media0.500000
age 2 years0.500000
LOWER IN age 7 years0.500000
gallbladder0.500000
bile0.500000
centrocercus urophasianus0.500000
greater sage-grouse0.500000
state of wyoming0.500000
food product type0.500000
vigna radiata0.500000
mung bean sprouts0.500000
producer c20.500000
eidolon helvum0.500000
fruit bat0.500000
LOWER IN kitchen0.500000
LOWER IN sink0.500000
bathroom0.500000
shower0.500000
tile0.500000
building wall0.500000
rangifer tarandus0.500000
reindeer0.500000
sciurus carolinensis0.500000
eastern gray squirrel0.500000
pteropus giganteus0.500000
indian flying fox0.500000
aquatic snake0.500000
nerodia sipedon0.500000
northern water snake0.500000
arctic wolf0.500000
canis lupus arctos0.500000
olsztyn0.500000
poland0.500000
gut0.500000
esox lucius0.500000
pike fry0.500000
sandy loam soil0.500000
negev desert0.500000
artificial wastewater irrigation0.500000
LOWER IN tap water irrigation0.500000
LOWER IN fertilized water irrigation0.500000
LOWER IN treated wastewater irrigation0.500000
cambridgeshire0.500000
triturus cristatus0.500000
alpine pasture0.500000
alpine0.500000
cow milk (raw)0.500000
cow milk (fluid)0.500000
milk0.500000
dracaena marginata0.500000
hong kong0.500000
LOWER IN cbd shark cannabis plant0.500000
hash cannabis plant0.500000
flowering stage0.500000
cannabis sativa0.500000
howea forsteriana0.500000
dracaena draco0.500000
subway0.500000
ammotragus lervia0.500000
barbary sheep0.500000
agave0.500000
guanajuato0.500000
agave tequiliana0.500000
agkistrodon contortrix0.500000
copperhead snake0.500000
lowland pasture0.500000
lowland farm0.500000
cloud0.500000
state of rhode island0.500000
food processing factory0.500000
zoo0.500000
andrias japonicus0.500000
japanese giant salamander0.500000
Fraction of annotations for the query sequences containing the term
TermScore
skin0.506173
canada0.333333
united states of america0.259259
zoological garden0.209877
captive0.197531
snake0.185185
southern united states0.185185
farm0.123457
toronto zoo0.098765
african lion safari0.098765
leaf0.086420
israel0.074074
research facility0.074074
rhizosphere0.074074
homo sapiens0.061728
air0.061728
cannabis sativa0.061728
desert0.061728
mexico0.061728
fossorial snake0.049383
control0.049383
soil0.049383
agave0.049383
state of california0.037037
dust0.037037
sandy loam soil0.037037
negev desert0.037037
ph 7-80.037037
irrigated0.037037
austria0.037037
greenhouse0.037037
plant0.037037
leaf surface0.037037
guanajuato0.037037
equus przewalskii0.024691
wild horse0.024691
pantherophis obsoletus0.024691
black rat snake0.024691
arboreal snake0.024691
crotalus horridus0.024691
timber rattlesnake0.024691
pongo abelii0.024691
sumatran orangutan0.024691
thamnophis sirtalis0.024691
common garter snake0.024691
nasopharynx0.024691
coluber constrictor0.024691
eastern racer snake0.024691
carphophis amoenus0.024691
worm snake0.024691
camelus bactrianus0.024691
bactrian camel0.024691
diadophis punctatus0.024691
ringneck snake0.024691
floor0.024691
australia0.024691
child0.024691
adult0.024691
duodenum0.024691
italy0.024691
cow milk (raw)0.024691
cow milk (fluid)0.024691
milk0.024691
hong kong0.024691
city0.024691
china0.024691
french republic0.024691
state of florida0.024691
spring water0.024691
water0.024691
fresh water0.024691
LOWER IN soil0.024691
size < 10um0.024691
early flowering stage0.024691
germany0.012346
nasal wash0.012346
rem sleep behavior disorder0.012346
cleanroom0.012346
felis catus0.012346
cat0.012346
age 1-3 years0.012346
perth0.012346
LOWER IN recurrent otitis media0.012346
sweden0.012346
saliva0.012346
age 2 years0.012346
LOWER IN age 7 years0.012346
gallbladder0.012346
bile0.012346
kingdom of spain0.012346
equus caballus0.012346
horse0.012346
bird0.012346
centrocercus urophasianus0.012346
greater sage-grouse0.012346
state of wyoming0.012346
LOWER IN caecum0.012346
food product type0.012346
vigna radiata0.012346
mung bean sprouts0.012346
Exp. ID User ID Description Date Region Flag Sequences
565amnondominant skin, canada, zoological garden, captive, toronto zoo, equus przewalskii, wild horse2019-11-21v3No1 / 9
536amnondominant snake, skin, united states of america, southern united states, pantherophis obsoletus, black rat snake, arboreal snake2019-07-28v4No1 / 13
536amnondominant crotalus horridus, snake, skin, united states of america, southern united states, timber rattlesnake2019-07-28v4No1 / 16
565amnondominant skin, canada, zoological garden, captive, toronto zoo, pongo abelii, sumatran orangutan2019-11-21v3No1 / 16
536amnondominant snake, skin, united states of america, southern united states, thamnophis sirtalis, common garter snake2019-07-28v4No1 / 18
607amnondominant germany, homo sapiens, nasopharynx, nasal wash, rem sleep behavior disorder2020-04-19v4No1 / 18
536amnondominant snake, skin, united states of america, southern united states, coluber constrictor, eastern racer snake2019-07-28v4No1 / 20
536amnondominant snake, skin, united states of america, southern united states, carphophis amoenus, worm snake, fossorial snake2019-07-28v4No1 / 20
565amnondominant skin, canada, captive, zoological garden, african lion safari, camelus bactrianus, bactrian camel2019-11-21v3No1 / 20
536amnondominant snake, skin, united states of america, southern united states, diadophis punctatus, ringneck snake, fossorial snake2019-07-28v4No1 / 21
308amnoncommon in spacecraft assembly cleanroom floor (common united states of america, state of california, floor, dust, cleanroom)2018-03-31v4No1 / 23
536amnoncommon snake, skin, united states of america, southern united states, diadophis punctatus, ringneck snake, fossorial snake2019-07-28v4No1 / 26
565amnoncommon skin, canada, felis catus, cat2019-11-21v3No1 / 26
605amnon high in control compared to recurrent otitis media in australia nasopharynx child age 1-3 years perth 2020-04-07v3No1 / 27
596amnon high in age 2 years compared to age 7 years in homo sapiens sweden saliva child 2020-03-18v3No1 / 28
536amnoncommon snake, skin, united states of america, southern united states, carphophis amoenus, worm snake, fossorial snake2019-07-28v4No1 / 35
526amnoncommon in bile of healthy controls (common homo sapiens, gallbladder, bile, adult, kingdom of spain, control)2019-07-14v3No1 / 39
565amnoncommon skin, canada, equus caballus, horse, farm2019-11-21v3No1 / 58
536amnoncommon snake, skin, united states of america, southern united states, coluber constrictor, eastern racer snake2019-07-28v4No1 / 64
558amnon high in duodenum compared to caecum in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 64
587amnoncommon israel, food product type, vigna radiata, mung bean sprouts, producer c22020-02-10v3No1 / 67
565amnoncommon skin, canada, canis lupus familiaris, dog2019-11-21v3No1 / 83
565amnoncommon skin, canada, eidolon helvum, fruit bat, zoological garden, toronto zoo, captive2019-11-21v3No1 / 83
199amnonhigher in bathroom shower compared to kitchen sink ( high in bathroom shower tile building wall compared to kitchen sink in building urban biome united states of america )2017-10-01v4No1 / 91
565amnoncommon skin, canada, captive, zoological garden, rangifer tarandus, reindeer, african lion safari2019-11-21v3No1 / 96
536amnoncommon crotalus horridus, snake, skin, united states of america, southern united states, timber rattlesnake2019-07-28v4No1 / 101
565amnoncommon skin, canada, sciurus carolinensis, eastern gray squirrel2019-11-21v3No1 / 104
565amnoncommon skin, canada, pteropus giganteus, indian flying fox, zoological garden, captive, african lion safari2019-11-21v3No1 / 109
536amnoncommon snake, skin, united states of america, southern united states, thamnophis sirtalis, common garter snake2019-07-28v4No1 / 110
536amnoncommon snake, skin, united states of america, southern united states, aquatic snake, nerodia sipedon, northern water snake2019-07-28v4No1 / 111
565amnoncommon skin, canada, zoological garden, captive, toronto zoo, equus przewalskii, wild horse2019-11-21v3No1 / 112
565amnoncommon skin, canada, zoological garden, captive, toronto zoo, arctic wolf, canis lupus arctos2019-11-21v3No1 / 114
613amnoncommon olsztyn, poland, aquarium, research facility, gastrointestinal system, gut, esox lucius, pike fry, fish2020-04-25v3No1 / 116
565amnoncommon skin, canada, captive, zoological garden, african lion safari, camelus bactrianus, bactrian camel2019-11-21v3No1 / 122
565amnoncommon skin, acinonyx jubatus, cheetah, canada, zoological garden, captive, african lion safari2019-11-21v3No1 / 123
263amnonhigher in soils irrigated with artificial wastewater compared to other methods ( high in artificial wastewater irrigation compared to tap water irrigation fertilized water irrigation treated wastewater irrigation in soil israel sandy loam soil negev desert ph 7-8 irrigated research facility )2017-12-11v4No1 / 127
353amnonhigher in captive compared to wild caught Lissotriton vulgaris newts skin ( high in research facility compared to wild in newt adult skin cambridgeshire triturus cristatus united kingdom )2018-07-30v4No1 / 135
617amnoncommon alpine pasture, alpine, farm, italy, cow milk (raw), cow milk (fluid), milk2020-05-03v3No1 / 137
361amnoncommon leaf, austria, greenhouse, plant, dracaena marginata2018-08-21v4No1 / 146
475amnoncommon in air next to subway stations in hong kong (common air, hong kong, city)2019-01-20v4No1 / 147
565amnoncommon skin, canada, zoological garden, captive, african lion safari, elephas maximus, asian elephant2019-11-21v3No1 / 149
565amnoncommon skin, canada, captive, panthera leo, lion, zoological garden, toronto zoo2019-11-21v3No1 / 150
618amnon high in hash cannabis plant compared to cbd shark cannabis plant in flowering stage rhizosphere canada farm cannabis sativa 2020-05-04v4No1 / 152
361amnoncommon leaf, austria, greenhouse, plant, howea forsteriana2018-08-21v4No1 / 154
361amnoncommon leaf, austria, greenhouse, plant, dracaena draco2018-08-21v4No1 / 155
475amnoncommon in air in subway train in hong kong (common air, hong kong, city, subway)2019-01-20v4No1 / 161
565amnoncommon skin, canada, zoological garden, captive, toronto zoo, pongo abelii, sumatran orangutan2019-11-21v3No1 / 174
536amnoncommon snake, skin, united states of america, southern united states, pantherophis obsoletus, black rat snake, arboreal snake2019-07-28v4No1 / 184
604amnoncommon chicken, gallus gallus, cecal content, caecum, china, research facility2020-04-06v3No1 / 185
565amnoncommon skin, canada, ammotragus lervia, barbary sheep, zoological garden, captive, african lion safari2019-11-21v3No1 / 205
360amnoncommon agave, desert, leaf, leaf surface, mexico, guanajuato, agave tequiliana, cultivated environment2018-08-21v4No1 / 210
536amnoncommon snake, skin, united states of america, southern united states, agkistrodon contortrix, copperhead snake2019-07-28v4No1 / 236
617amnoncommon lowland pasture, lowland farm, farm, italy, cow milk (raw), cow milk (fluid), milk2020-05-03v3No1 / 257
253amnoncommon in clouds in puy de dome mountain in france (common cloud, french republic, air, autumn)2017-11-22v4No1 / 267
565amnoncommon skin, canada, farm, bos taurus, cow2019-11-21v3No1 / 318
311amnoncommon in floor of kimchi production facility (common united states of america, state of rhode island, floor, food processing factory)2018-04-09v4No1 / 324
338amnonlower in wild salamanders compared to zoo grown salamanders ( high in zoological garden zoo compared to pond area designated as a nature reserve in skin andrias japonicus japanese giant salamander japan )2018-05-21v4No1 / 334
423amnon high in human contact compared to no human contact chernobyl exclusion zone in bank vole myodes glareolus ukraine skin 2018-12-05v4No1 / 334
565amnoncommon skin, canada, equus asinus africanus, donkey, farm2019-11-21v3No1 / 335
565amnoncommon skin, canada, macropus rufus, red kangaroo, zoological garden, captive, african lion safari2019-11-21v3No1 / 360
565amnoncommon skin, canada, papio anubis, olive baboon, zoological garden, captive, toronto zoo2019-11-21v3No1 / 368
29amnon high in seed compared to seedling in brassica oleracea french republic 2016-12-05v4No1 / 379
375amnoncommon in oil contaminated desert soil (common soil, kuwait, desert, oil contaminated soil)2018-09-09v4No1 / 490
360amnoncommon agave, desert, leaf, leaf surface, agave salmiana, mexico, guanajuato2018-08-21v4No1 / 492
612amnoncommon state of florida, united states of america, spring water, water, fresh water, location 12020-04-22v4No1 / 518
603amnoncommon in baijiu fermentation pit mud in first 2 batches (common mud, fermentation pit mud, baijiu, china, hefei city prefecture, days 0-90)2020-04-05v3No1 / 542
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
129amnoncommon mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, leaf2017-04-15v4No1 / 562
536amnon high in terrestrial snake compared to aquatic snake in snake skin united states of america southern united states 2019-07-28v4No1 / 590
360amnon high in rhizosphere agave compared to soil in desert mexico state of california 2018-08-21v4No1 / 593
360amnonhigher in leaf surface compared to soil in agave plants ( high in leaf leaf surface compared to soil in desert state of california mexico guanajuato agave )2018-08-21v4No1 / 645
612amnoncommon state of florida, united states of america, spring water, water, fresh water, location 42020-04-22v4No1 / 655
206amnoncommon in air from israel particles <10um size (common air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 765
618amnoncommon late flowering stage, rhizosphere, canada, farm, cannabis sativa2020-05-04v4No1 / 819
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 836
618amnoncommon early flowering stage, rhizosphere, canada, farm, cannabis sativa2020-05-04v4No1 / 873
206amnoncommon in dust storm air from israel particles <10um size (common israel, air, size < 10um, dust, dust storm)2017-10-04v4No1 / 902
618amnon high in early flowering stage compared to late flowering stage in rhizosphere canada farm cannabis sativa 2020-05-04v4No1 / 1040
263amnoncommon in desert soil irrigated daily in lab (common soil, israel, sandy loam soil, negev desert, ph 7-8, irrigated, research facility)2017-12-11v4No1 / 1076
263amnonlower in heat stressed soil (65C) compared to control ( high in control compared to heat stressed soil in soil israel sandy loam soil negev desert ph 7-8 irrigated research facility )2017-12-11v4No1 / 1893
618amnon high in rhizosphere compared to root endosphere root in canada farm cannabis sativa 2020-05-04v4No1 / 3134

Problems / suggestions? Please email info AT dbbact DOT org