Search result for sequence:
TACGGAGGGGGCTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCACGTAGGCGGACCAGAAAGTTGGGGGTGAAATCCCGGGGCTCAACCTCGGAACTGCCTTCAAAACTATTGGTCTGGAGTTCGAGAGAGGTGAGTGGAATTCCGAG
common ontology terms
term enrichment score
TermScore
canada0.403670
skin0.347703
southern united states0.315789
snake0.272727
zoological garden0.255639
captive0.198758
toronto zoo0.197531
african lion safari0.197531
mexico0.129032
leaf0.128049
desert0.121212
air0.120000
israel0.111111
fossorial snake0.109589
agave0.109589
dust0.086331
sandy loam soil0.084507
negev desert0.084507
greenhouse0.084507
guanajuato0.084507
irrigated0.081081
leaf surface0.081081
ph 7-80.077922
austria0.072289
plant0.067416
state of california0.064171
floor0.058824
wild horse0.057971
pantherophis obsoletus0.057971
black rat snake0.057971
arboreal snake0.057971
crotalus horridus0.057971
timber rattlesnake0.057971
sumatran orangutan0.057971
pongo abelii0.057971
thamnophis sirtalis0.057971
common garter snake0.057971
coluber constrictor0.057971
eastern racer snake0.057971
carphophis amoenus0.057971
worm snake0.057971
bactrian camel0.057971
camelus bactrianus0.057971
diadophis punctatus0.057971
ringneck snake0.057971
hong kong0.057971
size < 10um0.057971
french republic0.055556
equus przewalskii0.054795
duodenum0.054054
united states of america0.048994
soil0.047337
LOWER IN soil0.045977
farm0.044776
city0.040404
control0.030928
research facility0.030888
cleanroom0.029851
gallbladder0.029851
bile0.029851
centrocercus urophasianus0.029851
greater sage-grouse0.029851
state of wyoming0.029851
fruit bat0.029851
eidolon helvum0.029851
LOWER IN kitchen0.029851
LOWER IN sink0.029851
bathroom0.029851
shower0.029851
tile0.029851
building wall0.029851
reindeer0.029851
rangifer tarandus0.029851
eastern gray squirrel0.029851
sciurus carolinensis0.029851
indian flying fox0.029851
pteropus giganteus0.029851
aquatic snake0.029851
nerodia sipedon0.029851
northern water snake0.029851
canis lupus arctos0.029851
arctic wolf0.029851
artificial wastewater irrigation0.029851
LOWER IN tap water irrigation0.029851
LOWER IN fertilized water irrigation0.029851
LOWER IN treated wastewater irrigation0.029851
cambridgeshire0.029851
triturus cristatus0.029851
dracaena marginata0.029851
asian elephant0.029851
elephas maximus0.029851
howea forsteriana0.029851
dracaena draco0.029851
subway0.029851
barbary sheep0.029851
ammotragus lervia0.029851
agave tequiliana0.029851
agkistrodon contortrix0.029851
copperhead snake0.029851
cloud0.029851
Fraction of dbbact annotations with this term covered by the query
TermScore
floor0.666667
dust0.666667
wild horse0.500000
toronto zoo0.500000
canada0.500000
southern united states0.500000
pantherophis obsoletus0.500000
black rat snake0.500000
arboreal snake0.500000
crotalus horridus0.500000
timber rattlesnake0.500000
sumatran orangutan0.500000
pongo abelii0.500000
thamnophis sirtalis0.500000
common garter snake0.500000
coluber constrictor0.500000
eastern racer snake0.500000
carphophis amoenus0.500000
worm snake0.500000
fossorial snake0.500000
bactrian camel0.500000
camelus bactrianus0.500000
african lion safari0.500000
diadophis punctatus0.500000
ringneck snake0.500000
cleanroom0.500000
gallbladder0.500000
bile0.500000
centrocercus urophasianus0.500000
greater sage-grouse0.500000
state of wyoming0.500000
fruit bat0.500000
eidolon helvum0.500000
LOWER IN kitchen0.500000
LOWER IN sink0.500000
bathroom0.500000
shower0.500000
tile0.500000
building wall0.500000
reindeer0.500000
rangifer tarandus0.500000
eastern gray squirrel0.500000
sciurus carolinensis0.500000
indian flying fox0.500000
pteropus giganteus0.500000
aquatic snake0.500000
nerodia sipedon0.500000
northern water snake0.500000
canis lupus arctos0.500000
arctic wolf0.500000
sandy loam soil0.500000
negev desert0.500000
artificial wastewater irrigation0.500000
LOWER IN tap water irrigation0.500000
LOWER IN fertilized water irrigation0.500000
LOWER IN treated wastewater irrigation0.500000
cambridgeshire0.500000
triturus cristatus0.500000
greenhouse0.500000
dracaena marginata0.500000
hong kong0.500000
asian elephant0.500000
elephas maximus0.500000
howea forsteriana0.500000
dracaena draco0.500000
subway0.500000
barbary sheep0.500000
ammotragus lervia0.500000
agave0.500000
guanajuato0.500000
agave tequiliana0.500000
agkistrodon contortrix0.500000
copperhead snake0.500000
cloud0.500000
state of rhode island0.500000
food processing factory0.500000
zoo0.500000
andrias japonicus0.500000
japanese giant salamander0.500000
LOWER IN area designated as a nature reserve0.500000
bank vole0.500000
myodes glareolus0.500000
ukraine0.500000
LOWER IN no human contact0.500000
LOWER IN chernobyl exclusion zone0.500000
donkey0.500000
equus asinus africanus0.500000
red kangaroo0.500000
macropus rufus0.500000
kuwait0.500000
oil contaminated soil0.500000
agave salmiana0.500000
new delhi0.500000
myrtillocactus geometrizans0.500000
opuntia robusta0.500000
terrestrial snake0.500000
LOWER IN aquatic snake0.500000
size < 10um0.500000
clear day0.500000
LOWER IN wound0.500000
Fraction of annotations for the query sequences containing the term
TermScore
skin0.630769
canada0.338462
united states of america0.292308
zoological garden0.261538
captive0.246154
snake0.230769
southern united states0.230769
toronto zoo0.123077
african lion safari0.123077
leaf0.107692
israel0.076923
air0.076923
desert0.076923
mexico0.076923
fossorial snake0.061538
soil0.061538
research facility0.061538
agave0.061538
state of california0.046154
dust0.046154
homo sapiens0.046154
control0.046154
farm0.046154
sandy loam soil0.046154
negev desert0.046154
ph 7-80.046154
irrigated0.046154
austria0.046154
greenhouse0.046154
plant0.046154
leaf surface0.046154
guanajuato0.046154
wild horse0.030769
equus przewalskii0.030769
pantherophis obsoletus0.030769
black rat snake0.030769
arboreal snake0.030769
crotalus horridus0.030769
timber rattlesnake0.030769
sumatran orangutan0.030769
pongo abelii0.030769
thamnophis sirtalis0.030769
common garter snake0.030769
coluber constrictor0.030769
eastern racer snake0.030769
carphophis amoenus0.030769
worm snake0.030769
bactrian camel0.030769
camelus bactrianus0.030769
diadophis punctatus0.030769
ringneck snake0.030769
floor0.030769
adult0.030769
duodenum0.030769
hong kong0.030769
city0.030769
french republic0.030769
LOWER IN soil0.030769
size < 10um0.030769
cleanroom0.015385
cat0.015385
felis catus0.015385
gallbladder0.015385
bile0.015385
kingdom of spain0.015385
horse0.015385
equus caballus0.015385
bird0.015385
centrocercus urophasianus0.015385
greater sage-grouse0.015385
state of wyoming0.015385
LOWER IN caecum0.015385
fruit bat0.015385
eidolon helvum0.015385
dog0.015385
canis lupus familiaris0.015385
building0.015385
urban biome0.015385
LOWER IN kitchen0.015385
LOWER IN sink0.015385
bathroom0.015385
shower0.015385
tile0.015385
building wall0.015385
reindeer0.015385
rangifer tarandus0.015385
eastern gray squirrel0.015385
sciurus carolinensis0.015385
indian flying fox0.015385
pteropus giganteus0.015385
aquatic snake0.015385
nerodia sipedon0.015385
northern water snake0.015385
canis lupus arctos0.015385
arctic wolf0.015385
cheetah0.015385
acinonyx jubatus0.015385
artificial wastewater irrigation0.015385
LOWER IN tap water irrigation0.015385
LOWER IN fertilized water irrigation0.015385
Exp. ID User ID Description Date Region Flag Sequences
565amnonhighfreq wild horse, equus przewalskii, toronto zoo, captive, zoological garden, canada, skin2019-11-21v3No1 / 9
536amnonhighfreq snake, skin, united states of america, southern united states, pantherophis obsoletus, black rat snake, arboreal snake2019-07-28v4No1 / 13
536amnonhighfreq crotalus horridus, snake, skin, united states of america, southern united states, timber rattlesnake2019-07-28v4No1 / 16
565amnonhighfreq sumatran orangutan, pongo abelii, toronto zoo, captive, zoological garden, canada, skin2019-11-21v3No1 / 16
536amnonhighfreq snake, skin, united states of america, southern united states, thamnophis sirtalis, common garter snake2019-07-28v4No1 / 18
536amnonhighfreq snake, skin, united states of america, southern united states, coluber constrictor, eastern racer snake2019-07-28v4No1 / 20
536amnonhighfreq snake, skin, united states of america, southern united states, carphophis amoenus, worm snake, fossorial snake2019-07-28v4No1 / 20
565amnonhighfreq bactrian camel, camelus bactrianus, african lion safari, zoological garden, captive, canada, skin2019-11-21v3No1 / 20
536amnonhighfreq snake, skin, united states of america, southern united states, diadophis punctatus, ringneck snake, fossorial snake2019-07-28v4No1 / 21
308amnoncommon in spacecraft assembly cleanroom floor (common united states of america, state of california, floor, dust, cleanroom)2018-03-31v4No1 / 23
536amnoncommon snake, skin, united states of america, southern united states, diadophis punctatus, ringneck snake, fossorial snake2019-07-28v4No1 / 26
565amnoncommon cat, felis catus, canada, skin2019-11-21v3No1 / 26
536amnoncommon snake, skin, united states of america, southern united states, carphophis amoenus, worm snake, fossorial snake2019-07-28v4No1 / 35
526amnoncommon in bile of healthy controls (common homo sapiens, gallbladder, bile, adult, kingdom of spain, control)2019-07-14v3No1 / 39
565amnoncommon farm, horse, equus caballus, canada, skin2019-11-21v3No1 / 58
536amnoncommon snake, skin, united states of america, southern united states, coluber constrictor, eastern racer snake2019-07-28v4No1 / 64
558amnon high in duodenum compared to caecum in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 64
565amnoncommon captive, toronto zoo, zoological garden, fruit bat, eidolon helvum, canada, skin2019-11-21v3No1 / 83
565amnoncommon dog, canis lupus familiaris, canada, skin2019-11-21v3No1 / 83
199amnonhigher in bathroom shower compared to kitchen sink ( high in bathroom shower tile building wall compared to kitchen sink in building urban biome united states of america )2017-10-01v4No1 / 91
565amnoncommon african lion safari, reindeer, rangifer tarandus, zoological garden, captive, canada, skin2019-11-21v3No1 / 96
536amnoncommon crotalus horridus, snake, skin, united states of america, southern united states, timber rattlesnake2019-07-28v4No1 / 101
565amnoncommon eastern gray squirrel, sciurus carolinensis, canada, skin2019-11-21v3No1 / 104
565amnoncommon african lion safari, captive, zoological garden, indian flying fox, pteropus giganteus, canada, skin2019-11-21v3No1 / 109
536amnoncommon snake, skin, united states of america, southern united states, thamnophis sirtalis, common garter snake2019-07-28v4No1 / 110
536amnoncommon snake, skin, united states of america, southern united states, aquatic snake, nerodia sipedon, northern water snake2019-07-28v4No1 / 111
565amnoncommon wild horse, equus przewalskii, toronto zoo, captive, zoological garden, canada, skin2019-11-21v3No1 / 112
565amnoncommon canis lupus arctos, arctic wolf, toronto zoo, captive, zoological garden, canada, skin2019-11-21v3No1 / 114
565amnoncommon bactrian camel, camelus bactrianus, african lion safari, zoological garden, captive, canada, skin2019-11-21v3No1 / 122
565amnoncommon african lion safari, captive, zoological garden, canada, cheetah, acinonyx jubatus, skin2019-11-21v3No1 / 123
263amnonhigher in soils irrigated with artificial wastewater compared to other methods ( high in artificial wastewater irrigation compared to tap water irrigation fertilized water irrigation treated wastewater irrigation in soil israel sandy loam soil negev desert ph 7-8 irrigated research facility )2017-12-11v4No1 / 127
353amnonhigher in captive compared to wild caught Lissotriton vulgaris newts skin ( high in research facility compared to wild in newt adult skin cambridgeshire triturus cristatus united kingdom )2018-07-30v4No1 / 135
361amnoncommon leaf, austria, greenhouse, plant, dracaena marginata2018-08-21v4No1 / 146
475amnoncommon in air next to subway stations in hong kong (common air, hong kong, city)2019-01-20v4No1 / 147
565amnoncommon asian elephant, elephas maximus, african lion safari, captive, zoological garden, canada, skin2019-11-21v3No1 / 149
565amnoncommon toronto zoo, zoological garden, lion, panthera leo, captive, canada, skin2019-11-21v3No1 / 150
361amnoncommon leaf, austria, greenhouse, plant, howea forsteriana2018-08-21v4No1 / 154
361amnoncommon leaf, austria, greenhouse, plant, dracaena draco2018-08-21v4No1 / 155
475amnoncommon in air in subway train in hong kong (common air, hong kong, city, subway)2019-01-20v4No1 / 161
565amnoncommon sumatran orangutan, pongo abelii, toronto zoo, captive, zoological garden, canada, skin2019-11-21v3No1 / 174
536amnoncommon snake, skin, united states of america, southern united states, pantherophis obsoletus, black rat snake, arboreal snake2019-07-28v4No1 / 184
565amnoncommon african lion safari, captive, zoological garden, barbary sheep, ammotragus lervia, canada, skin2019-11-21v3No1 / 205
360amnoncommon agave, desert, leaf, leaf surface, mexico, guanajuato, agave tequiliana, cultivated environment2018-08-21v4No1 / 210
536amnoncommon snake, skin, united states of america, southern united states, agkistrodon contortrix, copperhead snake2019-07-28v4No1 / 236
253amnoncommon in clouds in puy de dome mountain in france (common cloud, french republic, air, autumn)2017-11-22v4No1 / 267
565amnoncommon cow, bos taurus, farm, canada, skin2019-11-21v3No1 / 318
311amnoncommon in floor of kimchi production facility (common united states of america, state of rhode island, floor, food processing factory)2018-04-09v4No1 / 324
338amnonlower in wild salamanders compared to zoo grown salamanders ( high in zoological garden zoo compared to pond area designated as a nature reserve in skin andrias japonicus japanese giant salamander japan )2018-05-21v4No1 / 334
423amnon high in human contact compared to no human contact chernobyl exclusion zone in bank vole myodes glareolus ukraine skin 2018-12-05v4No1 / 334
565amnoncommon farm, donkey, equus asinus africanus, canada, skin2019-11-21v3No1 / 335
565amnoncommon african lion safari, captive, zoological garden, red kangaroo, macropus rufus, canada, skin2019-11-21v3No1 / 360
565amnoncommon toronto zoo, captive, zoological garden, olive baboon, papio anubis, canada, skin2019-11-21v3No1 / 368
29amnon high in seed compared to seedling in brassica oleracea french republic 2016-12-05v4No1 / 379
375amnoncommon in oil contaminated desert soil (common soil, kuwait, desert, oil contaminated soil)2018-09-09v4No1 / 490
360amnoncommon agave, desert, leaf, leaf surface, agave salmiana, mexico, guanajuato2018-08-21v4No1 / 492
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
129amnoncommon mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, leaf2017-04-15v4No1 / 562
536amnon high in terrestrial snake compared to aquatic snake in snake skin united states of america southern united states 2019-07-28v4No1 / 590
360amnon high in rhizosphere agave compared to soil in desert mexico state of california 2018-08-21v4No1 / 593
360amnonhigher in leaf surface compared to soil in agave plants ( high in leaf leaf surface compared to soil in desert state of california mexico guanajuato agave )2018-08-21v4No1 / 645
206amnoncommon in air from israel particles <10um size (common air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 765
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 836
206amnoncommon in dust storm air from israel particles <10um size (common israel, air, size < 10um, dust, dust storm)2017-10-04v4No1 / 902
263amnoncommon in desert soil irrigated daily in lab (common soil, israel, sandy loam soil, negev desert, ph 7-8, irrigated, research facility)2017-12-11v4No1 / 1076
263amnonlower in heat stressed soil (65C) compared to control ( high in control compared to heat stressed soil in soil israel sandy loam soil negev desert ph 7-8 irrigated research facility )2017-12-11v4No1 / 1893

Problems / suggestions? Please email info AT dbbact DOT org