Search result for sequence:
TACGGAGGGGGCTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCACGTAGGCGGCTTTGTAAGTTAGAGGTGAAAGCCTGGTGCTCAACACCAGAACTGCCTTTAAGACTGCATCGCTTGAATCATGGAGAGGCGGGTGGAATTCCGAG
common ontology terms
term enrichment score
TermScore
soil0.286432
agricultural field0.248380
grand river watershed0.216867
rare charitable research reserve0.216867
luvisol0.166667
cambridge0.163636
rhizosphere0.158436
maize field0.152074
province of ontario0.151261
triticum aestivum0.137285
kingdom of denmark0.114286
ph 80.112676
luancheng county0.112676
ph 7.60.109589
pot expreiment0.109589
dipsacus fullonum0.109589
solidago0.109589
apocynum0.109589
decomissioned agricultural field0.109589
meadow ecosystem0.109589
fertilized soil0.106667
daucus carota0.103896
depth (soil) 0-20cm0.099909
loam soil0.099644
kaiyang county0.097222
guizhou province0.097222
depth 15-30cm0.097222
quercus velutina0.097222
quercus alba0.097222
quercus rubra0.097222
acer saccharum0.097222
acer saccharum subsp. nigrum0.097222
fagus grandifolia0.097222
forest0.097222
calcic chernozem0.097222
south moravian region0.097222
colluvial soil0.097222
canada0.096842
china0.091667
germany0.088949
forested area0.084848
after 6 years0.084507
state of sabah0.084507
depth (soil) 0-30 cm0.084507
lettuce0.084507
thyrow0.084507
late weichselian glaciation0.084507
clayey till0.084507
lund0.084507
malaysia0.081081
land snail0.081081
zea mays0.080000
switzerland0.076433
czech republic0.075269
skin0.072508
crop rotation0.071429
bernburg0.071429
dekalb county0.071429
illinois0.071429
depth 0-15cm0.071429
depth 30-45cm0.071429
brunisol0.071429
depth (soil) 0-10cm0.071006
wheat0.070175
gastrointestinal system0.069767
zoological garden0.064516
captive0.060606
united kingdom0.059406
state of illinois0.058824
oak0.057971
flood plain0.057971
sacramento0.057971
cosumnes river preserve0.057971
mature forest0.057971
LOWER IN bulk soil0.057416
park0.056338
quercus0.056338
haplic luvisol0.056338
ph 70.053333
surface water0.051948
stomach0.051724
biochar0.049383
israel0.048780
elevation 2000-3000m0.044118
neve yaar0.044118
alycaeus jagori0.044118
lower saxony0.044118
sandy soil0.044118
albic luvisol0.044118
preston flats0.044118
old growth forest0.044118
glacier0.043636
ph 60.043165
mountain0.043165
unamended soil0.043165
mollisol0.043165
irrigated0.042254
ph 50.041379
ice0.040541
silt loam0.040541
Fraction of dbbact annotations with this term covered by the query
TermScore
fully formed stage1.000000
black soldier fly1.000000
hermetia illucens1.000000
tours1.000000
LOWER IN wild diet1.000000
feed supplement diet1.000000
porphyrio hochstetteri1.000000
takahe1.000000
xiyuan river1.000000
fuzhou city prefecture1.000000
river water1.000000
maize field0.750000
cow milk (raw)0.666667
milk0.666667
ph 80.666667
loam soil0.666667
luancheng county0.666667
achatinella mustelina0.500000
cambridgeshire0.500000
lissotriton vulgaris0.500000
triturus cristatus0.500000
southern united states0.500000
terrestrial snake0.500000
LOWER IN aquatic snake0.500000
minas gerais state0.500000
campos rupestres0.500000
barbacenia macrantha0.500000
coarse-loamy soil0.500000
stover ammendment soil0.500000
day 10.500000
LOWER IN day 120.500000
substraat arabidopsis0.500000
lentse potgrond0.500000
orthic anthrosol0.500000
african lion safari0.500000
eastern gray squirrel0.500000
toronto zoo0.500000
arctic wolf0.500000
canis lupus arctos0.500000
elevation 2000-3000m0.500000
siliceous parent material0.500000
rhone river valley0.500000
ph 4.5-70.500000
canton of graubunden0.500000
calcareous parent material0.500000
alfalfa sprouts0.500000
medicago sativa0.500000
producer c20.500000
high biochar0.500000
low biochar0.500000
straw0.500000
LOWER IN alpine pasture0.500000
lowland farm0.500000
lowland pasture0.500000
kaiyang county0.500000
guizhou province0.500000
after 6 years0.500000
ph 7.60.500000
neve yaar0.500000
loam0.500000
loamy sand soil0.500000
state of sabah0.500000
opisthostoma concinnum0.500000
plectostoma concinnum0.500000
alycaeus jagori0.500000
helicarionidae0.500000
kaliella0.500000
kaliella scandens0.500000
LOWER IN georissa0.500000
LOWER IN georissa similis0.500000
LOWER IN opisthostoma concinnum0.500000
LOWER IN plectostoma concinnum0.500000
depth (soil) 0-30 cm0.500000
oak0.500000
acute oak decline0.500000
LOWER IN acute oak decline0.500000
la rioja province0.500000
pygoscelis papua0.500000
gentoo penguin0.500000
fluvo-aquic soil0.500000
panax notoginseng0.500000
sanqi plants0.500000
xundian county0.500000
pot expreiment0.500000
LOWER IN swisher sweets sweet cherry cigar0.500000
LOWER IN swisher sweets original cigar0.500000
cheyenne menthol box cigar0.500000
cheyenne full flavor cigar0.500000
tobacco0.500000
cigar0.500000
lower saxony0.500000
sandy soil0.500000
lettuce0.500000
thyrow0.500000
albic luvisol0.500000
mineral fertilization0.500000
organic fertilization0.500000
bio-dynamic fertilizer0.500000
crop rotation0.500000
mouldboard plough0.500000
Fraction of annotations for the query sequences containing the term
TermScore
soil0.600000
china0.200000
canada0.176923
agricultural field0.176923
rhizosphere0.169231
grand river watershed0.138462
province of ontario0.138462
cambridge0.138462
rare charitable research reserve0.138462
luvisol0.100000
triticum aestivum0.084615
depth (soil) 0-20cm0.084615
united states of america0.084615
maize field0.084615
germany0.084615
kingdom of denmark0.076923
skin0.061538
fertilized soil0.061538
ph 80.061538
ph 7.60.061538
luancheng county0.061538
pot expreiment0.061538
dipsacus fullonum0.061538
solidago0.061538
apocynum0.061538
daucus carota0.061538
decomissioned agricultural field0.061538
meadow ecosystem0.061538
kaiyang county0.053846
guizhou province0.053846
loam soil0.053846
depth 15-30cm0.053846
quercus velutina0.053846
quercus alba0.053846
quercus rubra0.053846
acer saccharum0.053846
acer saccharum subsp. nigrum0.053846
fagus grandifolia0.053846
forest0.053846
forested area0.053846
calcic chernozem0.053846
czech republic0.053846
south moravian region0.053846
colluvial soil0.053846
united kingdom0.046154
switzerland0.046154
depth (soil) 0-10cm0.046154
after 6 years0.046154
state of sabah0.046154
malaysia0.046154
gastrointestinal system0.046154
stomach0.046154
land snail0.046154
depth (soil) 0-30 cm0.046154
zea mays0.046154
lettuce0.046154
thyrow0.046154
late weichselian glaciation0.046154
clayey till0.046154
lund0.046154
wheat0.038462
zoological garden0.038462
captive0.038462
crop rotation0.038462
bernburg0.038462
dekalb county0.038462
illinois0.038462
state of illinois0.038462
depth 0-15cm0.038462
depth 30-45cm0.038462
brunisol0.038462
feces0.030769
LOWER IN bulk soil0.030769
israel0.030769
ph 70.030769
biochar0.030769
park0.030769
oak0.030769
quercus0.030769
haplic luvisol0.030769
flood plain0.030769
state of california0.030769
sacramento0.030769
cosumnes river preserve0.030769
surface water0.030769
mature forest0.030769
ph 60.023077
mountain0.023077
elevation 2000-3000m0.023077
italy0.023077
bulk soil0.023077
unamended soil0.023077
irrigated0.023077
neve yaar0.023077
city0.023077
alycaeus jagori0.023077
ph 50.023077
lower saxony0.023077
sandy soil0.023077
albic luvisol0.023077
Exp. ID User ID Description Date Region Flag Sequences
631sheryoDominant in maize field biochar amended rhizosphere soil (dominant ph 7.85, biochar, rhizosphere, china, guizhou province, kaiyang county, soil, maize field, after 6 years)2020-06-02v3No1 / 4
631sheryodominant in maize field unamended rhizosphere soil (dominant unamended soil, ph 7.6, rhizosphere, china, guizhou province, kaiyang county, soil, maize field, after 6 years)2020-06-02v3No1 / 6
854sheryoDominant in soil depth of 25-50cm of colluvial soil, Czech rebuplic (dominant calcic chernozem, colluvial soil, depth 25-50cm, ph 8, south moravian region, czech republic, soil)2021-12-23v3No1 / 6
761sheryoDominant in maize rhizosphere sandy soil maize field in Germany (dominant zea mays, rhizosphere, ph 5, lower saxony, sandy soil, germany, maize field)2021-04-06v3No1 / 13
811amnondominant glacial ice, south shetland glacier, shetland islands, glacier, ice2021-06-22v3No1 / 16
696amnoncommon state of sabah, malaysia, gastrointestinal system, stomach, land snail, opisthostoma concinnum, plectostoma concinnum2028-03-27v3No1 / 36
986amnon high in feed supplement diet compared to wild diet in feces new zealand bird porphyrio hochstetteri takahe 2022-12-26v3No1 / 40
696amnoncommon helicarionidae, kaliella, kaliella scandens, state of sabah, malaysia, gastrointestinal system, stomach, land snail2028-03-27v3No1 / 43
812amnoncommon zoological garden, feces, china, captive, chinstrap penguin, pygoscelis antarcticus2021-06-22v3No1 / 56
682amnoncommon city, madrid, kingdom of spain, air2028-03-04v3No1 / 67
727amnoncommon ixodes ricinus, body proper, whole body, la rioja province, kingdom of spain, tick2021-01-03v3No1 / 69
742amnoncommon dalian city prefecture, captive, zoological garden, china, pygoscelis papua, gentoo penguin, bird, feces2021-02-18v3No1 / 70
763amnonhigher in blank compared to samples (contamination)2021-04-10v3No1 / 70
696amnoncommon alycaeus jagori, state of sabah, malaysia, gastrointestinal system, stomach, land snail2028-03-27v3No1 / 74
565amnoncommon skin, canada, canis lupus familiaris, dog2019-11-21v3No1 / 83
764sheryoHigh in rapeseed pre-crop compared to maize pre-crop leoss soil in wheat field grown under conventional tillage and crop rotation in germany ( high in brassica napus rapeseed pre-crop compared to maize pre-crop zea mays in soil germany bernburg loess chernozem conventional tillage mouldboard plough ph 7.6 triticum aestivum crop rotation )2021-04-12v3No1 / 91
854sheryoHigher at soil depth of 125-175cm compared to soil depth of 200-250cm of colluvial soil, Czech rebuplic ( high in depth 125-175cm compared to depth 200-250cm in calcic chernozem colluvial soil ph 8 south moravian region czech republic soil )2021-12-23v3No1 / 96
565amnoncommon skin, canada, sciurus carolinensis, eastern gray squirrel2019-11-21v3No1 / 104
565amnoncommon skin, canada, zoological garden, captive, toronto zoo, arctic wolf, canis lupus arctos2019-11-21v3No1 / 114
565amnoncommon skin, acinonyx jubatus, cheetah, canada, zoological garden, captive, african lion safari2019-11-21v3No1 / 123
762sheryoHigh in rhizosphere compared bulk soil to of a pot experiment with lettuce planted in haplic luvisol Switzerland ( high in rhizosphere compared to bulk soil in thyrow switzerland haplic luvisol pot expreiment lettuce soil )2021-04-08v3No1 / 139
855sheryoCommon in soil depth of 800cm in fertilized soil in china (common depth 800cm, luancheng county, china, agricultural field, fertilized soil, soil)2021-12-27v3No1 / 142
662amnon high in irrigated compared to dry in neve yaar depth (soil) 0-10cm soil agricultural field israel 2020-09-21v3No1 / 146
631sheryoHigher in maize field biochar amended bulk soil, after 6 years of biochar amended, compared to unamended soil ( high in biochar compared to unamended soil in china guizhou province kaiyang county soil maize field bulk soil after 6 years )2020-06-02v3No1 / 188
827sheryoHigher in soil depth of 275cm compared to soil depth of 465cm in clayey till loam soil, Lund Denmark ( high in depth 200-350cm compared to depth 450-600cm in lund kingdom of denmark agricultural field clayey till late weichselian glaciation loam soil )2021-09-13v3No1 / 197
761sheryoHigher in maize rhizosphere compared to bulk soil in sandy soil maize field in Germany ( high in rhizosphere compared to bulk soil in ph 5 lower saxony sandy soil germany maize field )2021-04-06v3No1 / 200
587amnoncommon israel, food product type, alfalfa sprouts, medicago sativa, producer c22020-02-10v3No1 / 215
855sheryoHigher in soil depth of 350cm compared to soil depth of 75cm in fertilized soil in china ( high in depth 350cm compared to depth 75cm in luancheng county china agricultural field fertilized soil soil )2021-12-27v3No1 / 217
762sheryoHigh in rhizosphere compared to bulk soil of a pot experiment with lettuce planted in albic luvisol Germany ( high in rhizosphere compared to bulk soil in thyrow albic luvisol germany haplic luvisol pot expreiment lettuce soil )2021-04-08v3No1 / 226
583amnoncommon soil, mountain, switzerland, ph 4-6, depth (soil) 0-10cm, elevation 2000-3000m, siliceous parent material, rhone river valley2020-01-27v3No1 / 234
811amnoncommon glacial ice, south shetland glacier, shetland islands, ice, glacier2021-06-22v3No1 / 234
855sheryoCommon in soil depth of 350cm in fertilized soil in china (common depth 350cm, luancheng county, china, agricultural field, fertilized soil, soil)2021-12-27v3No1 / 242
842sheryoCommon in soil depth of 0-15cm in a mature forest in Ontario, Canada (common mature forest, brunisol, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 261
948amnon high in fully formed stage compared to larva larval stage in black soldier fly hermetia illucens research facility tours french republic 2022-12-05v3No1 / 272
752sheryoHigher in treatments without biochar compared to treatments with biochar in soil planted with Panax notoginseng amended with 2% biochar ( high in without biochar compared to biochar in panax notoginseng sanqi plants ph 6 xundian county yunnan province china pot expreiment soil )2021-03-11v3No1 / 273
762sheryoCommon in rhizosphere soil of a pot experiment with lettuce planted in npk fertilized haplic luvisol Switzerland (common thyrow, switzerland, haplic luvisol, mineral fertilization, pot expreiment, lettuce, soil, rhizosphere, npk fertilization)2021-04-08v3No1 / 286
996amnoncommon city, anthropogenic environmental material, downstream, river, surface water, fresh water, xiyuan river, fuzhou city prefecture, china, river water2022-12-28v3No1 / 291
827sheryoHigher in soil depth of 60cm compared to soil depth of 275cm in clayey till loam soil, Lund Denmark ( high in depth 20-120cm compared to depth 200-350cm in lund kingdom of denmark agricultural field clayey till late weichselian glaciation loam soil )2021-09-13v3No1 / 295
882amnoncommon antarctic hairgrass, deschampsia antarctica, king george island, antarctica, rhizosphere2022-03-20v3No1 / 299
882amnoncommon king george island, antarctic pearlwort, colobanthus quitensis, antarctica, rhizosphere2022-03-20v3No1 / 325
750sheryoCommon in soil of wheat field in China (common fluvo-aquic soil, ph 7.6, hebei province, luancheng county, china, triticum aestivum, soil)2021-03-11v3No1 / 337
762sheryoCommon in rhizosphere soil of a pot experiment with lettuce planted in npk fertilized albic luvisol Germany (common pot expreiment, lettuce, soil, rhizosphere, germany, thyrow, albic luvisol, mineral fertilization, npk fertilization)2021-04-08v3No1 / 353
583amnoncommon soil, mountain, switzerland, depth (soil) 0-10cm, elevation 2000-3000m, siliceous parent material, ph 4.5-7, canton of graubunden2020-01-27v3No1 / 359
762sheryoCommon in rhizosphere soil of a pot experiment with lettuce planted in organic fertilized albic luvisol Germany (common organic fertilization, manure fertilization, manured soil, albic luvisol, thyrow, germany, rhizosphere, soil, lettuce, pot expreiment)2021-04-08v3No1 / 359
565amnoncommon skin, canada, papio anubis, olive baboon, zoological garden, captive, toronto zoo2019-11-21v3No1 / 368
888amnoncommon bulk tank milk, cow milk (raw), milk, ireland2022-03-30v3No1 / 388
842sheryoCommon in soil depth of 30-45cm in an old growth forest in Ontario, Canada (common depth 30-45cm, old growth forest, luvisol, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 390
842sheryoCommon in soil depth of 30-45cm in a mature forest in Ontario, Canada (common depth 30-45cm, luvisol, mature forest, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 393
28amnon high in feces achatinella mustelina compared to whole plant leaf in hawaii 2016-12-05v4No1 / 413
842sheryoHigher in soil depth of 15-30cm compared to soil depth of 0-15cm in a Decomissioned Agricultural Field in Ontario, Canada ( high in depth 15-30cm compared to depth 0-15cm in dipsacus fullonum solidago apocynum daucus carota brunisol decomissioned agricultural field meadow ecosystem grand river watershed rare charitable research reserve cambridge province of ontario canada soil )2021-11-14v3No1 / 432
842sheryoCommon in soil depth of 15-30cm in a mature forest in Ontario, Canada (common depth 15-30cm, luvisol, mature forest, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 433
829sheryohigher soil depth of 44-108cm compared to 12-44cm in Alfisol soil, Dekalb, Illinois, united states of america ( high in depth 44-108cm compared to depth 12-44cm in sandy loam sandy loam soil hapludalf alfisol united states of america soil state of illinois illinois dekalb county )2021-08-26v3No1 / 442
698amnon high in ph 6-7 control compared to ph 5-6 disease plant disease acute oak decline in depth (soil) 0-30 cm depth (soil) 0-20cm park united kingdom oak quercus rhizosphere 2028-04-01v3No1 / 452
758amnon high in cheyenne menthol box cigar cheyenne full flavor cigar compared to swisher sweets sweet cherry cigar swisher sweets original cigar in tobacco nicotiana tabacum cigar 2021-03-28v3No1 / 452
762sheryocommon in rhizosphere soil of a pot experiment with lettuce planted in organic fertilized haplic luvisol Switzerland (common bio-dynamic fertilizer, manured soil, manure fertilization, organic fertilization, thyrow, switzerland, haplic luvisol, pot expreiment, lettuce, soil, rhizosphere)2021-04-08v3No1 / 455
842sheryoCommon in soil depth of 0-15cm in a mature forest in Ontario, Canada (common depth 0-15cm, luvisol, mature forest, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 460
617amnonlower in cow milk of cows in alpine pasture compared to lowland farm ( high in lowland farm lowland pasture compared to alpine pasture alpine in farm italy cow milk (raw) cow milk (fluid) milk )2020-05-03v3No1 / 484
662amnoncommon loam soil, loam, irrigated, neve yaar, depth (soil) 0-10cm, soil, agricultural field, israel2020-09-21v3No1 / 489
842sheryoCommon in soil depth of 15-30cm in an old growth forest in Ontario, Canada (common depth 15-30cm, old growth forest, luvisol, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 507
798amnoncommon depth (soil) 10 cm, depth (soil) 0-20cm, hay, plant litter, litter bag, orchard, apricot, prunus armeniaca, apennine mountains, italy2021-06-13v3No1 / 508
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, root endosphere, root2019-08-17v4No1 / 575
536amnon high in terrestrial snake compared to aquatic snake in snake skin united states of america southern united states 2019-07-28v4No1 / 590
696amnon high in opisthostoma concinnum plectostoma concinnum compared to georissa georissa similis in land snail stomach gastrointestinal system malaysia state of sabah 2028-03-28v3No1 / 606
662amnoncommon loamy sand soil, irrigated, neve yaar, depth (soil) 0-10cm, soil, agricultural field, israel2020-09-22v3No1 / 609
698amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, ph 4-4.5, park, london, united kingdom, oak, quercus, rhizosphere2028-04-01v3No1 / 623
786sheryoHigher at 0-30cm depth compared to 30-60cm depth in flood plain soil near cosumnes river, california ( high in depth (soil) 0-30 cm depth (soil) 0-20cm compared to depth 30-60cm in flood plain soil united states of america state of california sacramento cosumnes river preserve )2021-09-13v3No1 / 627
829sheryoHigher in soil depth of 0-56cm compared to soil depth of 56-140cm in Mollisol soil, Dekalb, Illinois, united states of america ( high in depth 0-56 compared to depth 56-140 in united states of america soil silt loam mollisol state of illinois illinois dekalb county )2021-08-26v3No1 / 631
827sheryoCommon in soil at 230cm depth in clayey till loam soil, Lund Denmark (common depth 200-260cm, loam soil, late weichselian glaciation, clayey till, agricultural field, kingdom of denmark, lund)2021-08-24v3No1 / 644
842sheryoCommon in soil depth of 30-45cm in a zea mays agricultural field in Ontario, Canada (common depth 30-45cm, zea mays, preston flats, agricultural field, soil, luvisol, grand river watershed, canada, province of ontario, cambridge, rare charitable research reserve)2021-11-14v3No1 / 676
752sheryoCommon in soil planted with Panax notoginseng (common panax notoginseng, sanqi plants, ph 6, xundian county, yunnan province, china, pot expreiment, soil)2021-03-11v3No1 / 730
761sheryoCommon in maize rhizosphere sandy soil maize field in Germany (common zea mays, rhizosphere, ph 5, lower saxony, sandy soil, germany, maize field)2021-04-06v3No1 / 742
600sheryoDecreases after 12 days of stover ammendment in soil ( high in day 1 compared to day 12 in depth (soil) 0-5cm state of new york soil united states of america coarse-loamy soil ph 6 stover ammendment soil )2020-03-27v4No1 / 747
854sheryoCommon in soil depth of 275-325cm of colluvial soil, Czech rebuplic (common depth 275-325cm, calcic chernozem, colluvial soil, ph 8, south moravian region, czech republic, soil)2021-12-23v3No1 / 749
271amnon high in rhizosphere glycine max soybean compared to soil in depth (soil) 0-20cm china 2018-01-09v4No1 / 750
829sheryoCommon in soil depth of 44-108cm in Alfisol soil, Dekalb, Illinois, united states of america (common depth 44-108cm, sandy loam, sandy loam soil, hapludalf, alfisol, united states of america, soil, state of illinois, illinois, dekalb county)2021-08-26v3No1 / 751
709sheryoCommon in potting mix soil from the Netherlands, substraat arabidopsis, Lentse Potgrond (common substraat arabidopsis, lentse potgrond, soil, potting mix, kingdom of the netherlands)2028-05-16v4No1 / 752
842sheryoCommoon in soil depth of 30-45cm in a Decomissioned Agricultural Field in Ontario, Canada (common depth 30-45cm, dipsacus fullonum, solidago, apocynum, daucus carota, brunisol, decomissioned agricultural field, meadow ecosystem, grand river watershed, rare charitable research reserve, cambridge, province of ontario, canada, soil)2021-11-14v3No1 / 768
829sheryoCommon in soil depth of 0-27cm in Mollisol soil, Dekalb, Illinois, united states of america (common depth 0-27cm, dekalb county, illinois, state of illinois, mollisol, silt loam, soil, united states of america)2021-08-26v3No1 / 798
583amnoncommon soil, mountain, switzerland, depth (soil) 0-10cm, elevation 2000-3000m, canton of graubunden, calcareous parent material, ph 7-82020-01-28v3No1 / 830
842sheryoCommon in soil depth of 0-15cm in an old growth forest in Ontario, Canada (common depth 0-15cm, old growth forest, luvisol, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 834
698amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, ph 5-6, disease, plant disease, acute oak decline, park, united kingdom, oak, quercus, rhizosphere2028-04-01v3No1 / 848
827sheryoCommon in soil at 325cm depth in clayey till loam soil, Lund Denmark (common lund, kingdom of denmark, agricultural field, clayey till, late weichselian glaciation, loam soil, depth 300-350cm)2021-08-24v3No1 / 866
855sheryoCommon in soil depth of 75cm in fertilized soil in china (common depth 75cm, luancheng county, china, agricultural field, fertilized soil, soil)2021-12-27v3No1 / 873
786sheryoCommon in flood plain soil near cosumnes river, california, at 60-100cm depth (common depth (soil) 60-100cm, cosumnes river preserve, sacramento, state of california, united states of america, soil, flood plain)2021-05-18v3No1 / 878
854sheryoCommon in soil depth of 75-100cm of colluvial soil, Czech rebuplic (common depth 75-100cm, calcic chernozem, colluvial soil, ph 8, south moravian region, czech republic, soil)2021-12-23v3No1 / 879
996amnon high in city anthropogenic environmental material downstream compared to upstream in river water china fuzhou city prefecture xiyuan river fresh water surface water river 2022-12-28v3No1 / 890
854sheryoCommon in soil depth of 200-250cm of colluvial soil, Czech rebuplic (common depth 200-250cm, calcic chernozem, colluvial soil, ph 8, south moravian region, czech republic, soil)2021-12-23v3No1 / 894
807amnoncommon tropical storm, summer, okinawa islands, japan, filtered 0.2um, near shore, sea water, surface water2021-06-20v3No1 / 905
842sheryoCommon in soil depth of 15-30cm in a Decomissioned Agricultural Field in Ontario, Canada (common depth 15-30cm, dipsacus fullonum, solidago, apocynum, daucus carota, brunisol, decomissioned agricultural field, meadow ecosystem, grand river watershed, rare charitable research reserve, cambridge, province of ontario, canada, soil)2021-11-14v3No1 / 905
854sheryoCommon in soil depth of 25-50cm of colluvial soil, Czech rebuplic (common ph 8, calcic chernozem, czech republic, south moravian region, colluvial soil, depth 25-50cm, soil)2021-12-23v3No1 / 905
829sheryoCommon in soil depth of 27-56cm in Mollisol soil, Dekalb, Illinois, united states of america (common depth 27-56cm, united states of america, soil, silt loam, mollisol, state of illinois, illinois, dekalb county)2021-08-26v3No1 / 906
842sheryoCommon in soil depth of 15-30cm in a zea mays agricultural field in Ontario, Canada (common depth 15-30cm, zea mays, preston flats, agricultural field, soil, luvisol, grand river watershed, canada, province of ontario, cambridge, rare charitable research reserve)2021-11-14v3No1 / 944
854sheryoCommon in soil depth of 125-175cm of colluvial soil, Czech rebuplic (common depth 125-175cm, calcic chernozem, colluvial soil, ph 8, south moravian region, czech republic, soil)2021-12-23v3No1 / 962
842sheryoCommon in soil depth of 30-45cm in a Decomissioned Agricultural Field in Ontario, Canada (common depth 30-45cm, luvisol, dipsacus fullonum, solidago, apocynum, daucus carota, decomissioned agricultural field, meadow ecosystem, grand river watershed, rare charitable research reserve, cambridge, province of ontario, canada, soil)2021-11-14v3No1 / 970
842sheryoCommon in soil depth of 15-30cm in a Decomissioned Agricultural Field in Ontario, Canada (common depth 15-30cm, luvisol, dipsacus fullonum, solidago, apocynum, daucus carota, decomissioned agricultural field, meadow ecosystem, grand river watershed, rare charitable research reserve, cambridge, province of ontario, canada, soil)2021-11-14v3No1 / 974
610sheryoCommon in agricultural field soil amended with straw (common straw, triticum aestivum, ph 7, wheat, kingdom of denmark, agricultural field, soil)2020-04-21v3No1 / 998
610sheryoCommon in agricultural field soil amended with low biochar (common low biochar, triticum aestivum, ph 7, wheat, kingdom of denmark, agricultural field, soil)2020-04-21v3No1 / 1009
768sheryoCommon in maize fields in Brittany, France (common zea mays, maize field, cambisol, bretagne region, french republic, soil)2021-04-18v3No1 / 1034
842sheryoHigher in soil depth of 15-30cm compared to soil depth of 0-15cm in a Decomissioned Agricultural Field in Ontario, Canada ( high in depth 15-30cm compared to depth 0-15cm in luvisol dipsacus fullonum solidago apocynum daucus carota decomissioned agricultural field meadow ecosystem grand river watershed rare charitable research reserve cambridge province of ontario canada soil )2021-11-14v3No1 / 1044
786sheryocommon in flood plain soil near cosumnes river, california, at 0-30cm depth (common depth (soil) 0-30 cm, depth (soil) 0-20cm, flood plain, soil, united states of america, state of california, sacramento, cosumnes river preserve)2021-05-18v3No1 / 1048
610sheryoCommon in agricultural field soil (common triticum aestivum, ph 7, wheat, kingdom of denmark, agricultural field, soil)2020-04-21v3No1 / 1053
610sheryoCommon in agricultural field soil amended with high biochar (common soil, agricultural field, kingdom of denmark, wheat, ph 7, high biochar, triticum aestivum)2020-04-21v3No1 / 1079
842sheryoCommon in soil depth of 0-15cm in a Decomissioned Agricultural Field in Ontario, Canada (common depth 0-15cm, dipsacus fullonum, solidago, apocynum, daucus carota, brunisol, decomissioned agricultural field, meadow ecosystem, grand river watershed, rare charitable research reserve, cambridge, province of ontario, canada, soil)2021-11-14v3No1 / 1082
827sheryoCommon in soil at 25cm depth in clayey till loam soil, Lund Denmark (common depth (soil) 20-30cm, plough layer , loam soil, late weichselian glaciation, clayey till, agricultural field, kingdom of denmark, lund)2021-08-24v3No1 / 1111
698amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, control, ph 6-7, park, united kingdom, oak, quercus, rhizosphere2028-04-01v3No1 / 1115
764sheryocommon in leoss soil in wheat field grown under crop rotation with rapeseed pre-crop in germany (common bernburg, germany, soil, triticum aestivum, crop rotation, ph 7.6, brassica napus, rapeseed pre-crop)2021-04-12v3No1 / 1129
764sheryoCommon in leoss soil in wheat field grown under conservation tillage and crop rotation in germany (common ph 7.6, crop rotation, cultivator tillage, conservation tillage, triticum aestivum, soil, germany, bernburg)2021-04-12v3No1 / 1140
827sheryoCommon in soil at 95cm depth in clayey till loam soil, Lund Denmark (common sandy till , depth 70-120cm, loam soil, late weichselian glaciation, clayey till, agricultural field, kingdom of denmark, lund)2021-08-24v3No1 / 1142
842sheryoCommon in soil depth of 0-15cm in a zea mays agricultural field in Ontario, Canada (common depth 0-15cm, zea mays, preston flats, agricultural field, soil, luvisol, grand river watershed, canada, province of ontario, cambridge, rare charitable research reserve)2021-11-14v3No1 / 1147
786sheryoCommon in flood plain soil near cosumnes river, california, at 30-60cm depth (common depth (soil) 30-60cm, cosumnes river preserve, sacramento, state of california, united states of america, soil, flood plain)2021-05-18v3No1 / 1180
807amnon high in tropical storm compared to normal weather in summer okinawa islands japan filtered 0.2um near shore sea water surface water 2021-06-20v3No1 / 1191
764sheryoCommon in leoss soil in wheat field grown under conventional tillage and crop rotation in germany (common crop rotation, triticum aestivum, ph 7.6, mouldboard plough, conventional tillage, loess chernozem, bernburg, germany, soil)2021-04-12v3No1 / 1213
531amnoncommon rhizosphere, greenhouse soil, farm, orthic anthrosol, cucumis sativus, cucumber, china2019-07-21v3No1 / 1223
764sheryoCommon in leoss soil in wheat field grown under crop rotation with maize pre-crop in germany (common maize pre-crop, ph 7.6, crop rotation, triticum aestivum, soil, germany, bernburg)2021-04-12v3No1 / 1225
798amnoncommon depth (soil) 10 cm, depth (soil) 0-20cm, ph 7-8, soil, orchard, apricot, prunus armeniaca, apennine mountains, italy2021-06-13v3No1 / 1230
855sheryoCommon in soil depth of 10cm in fertilized soil in china (common luancheng county, china, depth (water) 10cm, fertilized soil, agricultural field, soil)2021-12-27v3No1 / 1253
842sheryoCommon in soil depth of 0-15cm in a Decomissioned Agricultural Field in Ontario, Canada (common depth 0-15cm, luvisol, dipsacus fullonum, solidago, apocynum, daucus carota, decomissioned agricultural field, meadow ecosystem, grand river watershed, rare charitable research reserve, cambridge, province of ontario, canada, soil)2021-11-14v3No1 / 1281
271amnoncommon depth (soil) 0-20cm, rhizosphere, glycine max, soybean, china2018-01-09v4No1 / 1459
631sheryoCommon in maize field biochar amended rhizosphere soil (common ph 7.85, biochar, rhizosphere, china, guizhou province, kaiyang county, soil, maize field, after 6 years)2020-06-02v3No1 / 1492
855sheryoHigher in soil depth of 75cm compared to soil depth of 175cm in fertilized soil in china ( high in depth 75cm compared to depth 175cm in luancheng county china agricultural field fertilized soil soil )2021-12-27v3No1 / 1522
631sheryocommon in maize field unamended rhizosphere soil (common unamended soil, ph 7.6, rhizosphere, china, guizhou province, kaiyang county, soil, maize field, after 6 years)2020-06-02v3No1 / 1637
696amnon high in alycaeus jagori compared to opisthostoma concinnum plectostoma concinnum in land snail stomach gastrointestinal system malaysia state of sabah 2028-03-28v3No1 / 1672
855sheryoHigher in soil depth of 10cm compared to soil depth of 75cm in fertilized soil in china ( high in depth (water) 10cm compared to depth 75cm in luancheng county china agricultural field fertilized soil soil )2021-12-27v3No1 / 1678
696amnon high in alycaeus jagori compared to georissa similis georissa in land snail stomach gastrointestinal system malaysia state of sabah 2028-03-28v3No1 / 1698
616amnoncommon in topsoil of PK/NP/NPK/NK fertilized sugarcane field (common depth (soil) 0-20cm, fertilized soil, ph 5.5-6, sugarcane, saccharum, soil, topsoil, china, guangzhou city prefecture)2020-04-27v3No1 / 1710
155amnonhigher in tightly bound root soil compared to loose soil and bulk soil ( high in root compared to bulk soil in triticum aestivum wheat soil china )2017-07-02v4No1 / 1714
631sheryoCommon in maize field unamended bulk soil (common bulk soil, unamended soil, ph 7.9, maize field, soil, kaiyang county, guizhou province, china)2020-06-02v3No1 / 1814
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in newt adult skin cambridgeshire triturus cristatus united kingdom )2018-07-30v4No1 / 1834
631sheryocommon in maize field biochar amended bulk soil, after 6 years of biochar amended (common ph 8, china, guizhou province, kaiyang county, soil, maize field, bulk soil, biochar, after 6 years)2020-06-02v3No1 / 1872
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in newt adult skin cambridgeshire lissotriton vulgaris united kingdom )2018-07-30v4No1 / 2162

Problems / suggestions? Please email info AT dbbact DOT org