Search result for sequence:
TACGGAGGGGGTTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCACGTAGGCGGATCGGAAAGTTGGGGGTGAAATCCCGGGGCTCAACCCCGGAACGGCCTCCAAAACTATCGGTCTAGAGTTCGAGAGAGGTGAGTGGAATTCCGAG
common ontology terms
term enrichment score
TermScore
shenzhen city prefecture0.500000
litopenaeus vannamei0.333333
pacific white shrimp0.333333
portunus trituberculatus0.333333
horse crab0.333333
leizhou nature reserve0.333333
mangrove biome0.333333
spartina alterniflora0.285714
guangdong province0.285714
mangrove swamp0.250000
depth 0-20cm0.222222
marine sediment0.111111
intestine0.083333
digestive system0.066667
sea water0.064516
china0.060606
soil0.034483
research facility0.019048
Fraction of dbbact annotations with this term covered by the query
TermScore
shenzhen city prefecture0.500000
portunus trituberculatus0.500000
horse crab0.500000
leizhou nature reserve0.500000
mangrove biome0.500000
spartina alterniflora0.333333
guangdong province0.333333
litopenaeus vannamei0.250000
pacific white shrimp0.250000
mangrove swamp0.250000
depth 0-20cm0.200000
marine sediment0.071429
intestine0.050000
digestive system0.035714
sea water0.034483
china0.031250
soil0.018519
research facility0.009901
Fraction of annotations for the query sequences containing the term
TermScore
china1.000000
litopenaeus vannamei0.500000
pacific white shrimp0.500000
shenzhen city prefecture0.500000
digestive system0.500000
sea water0.500000
intestine0.250000
portunus trituberculatus0.250000
horse crab0.250000
research facility0.250000
spartina alterniflora0.250000
leizhou nature reserve0.250000
guangdong province0.250000
mangrove biome0.250000
depth 0-20cm0.250000
marine sediment0.250000
mangrove swamp0.250000
soil0.250000

Problems / suggestions? Please email info AT dbbact DOT org