Search result for sequence:
TACGGAGGGTCCGAGCGTTATCCGGAATCATTGGGTTTAAAGGGTCCGCAGGCGGTCAATTAAGTCAGAGGTGAAATCCCATAGCTTAACTATGGAACTGCCTTTGATACTGGTTGACTTGAGTCATATGGAAGTAGATAGAATGTGTAG
common ontology terms
term enrichment score
TermScore
pacific ocean0.601893
sea water0.477999
canada0.466667
state of california0.387097
monterey bay0.334975
ocean0.326633
saline water0.321429
water0.303030
calvert island0.296296
alga0.269231
province of british columbia0.258065
surface water0.235043
beach0.191489
atlantic ocean0.111940
mastocarpus0.097561
depth 5m0.095238
bodega bay0.095238
depth 100m0.074534
nan'ao island0.073171
depth 20m0.073171
estuary0.073171
estuary water0.073171
bilbao0.073171
north america0.073171
depth 25cm0.073171
red abalone0.073171
haliotis rufescens0.073171
saanich inlet0.073171
kingdom of spain0.055046
mastocarpus alaskensis0.050000
crustose sporophyte0.050000
size < 1um0.050000
portuguese republic0.050000
salinity >20 ppt0.050000
coastal water0.050000
size 1-80um0.050000
aerosol0.050000
depth 200m0.050000
haliotis sorenseni0.050000
white abalone0.050000
shell0.050000
red alga0.050000
marine water body0.048780
commonwealth of massachusetts0.048780
particle bound0.048780
foot0.048780
zostera marina0.048780
marine eelgrass0.048780
early time points0.047619
LOWER IN late time points0.047619
vancouver0.047619
free floating0.046512
LOWER IN winter0.044444
summer0.042553
air0.040816
united states of america0.039409
root0.039216
LOWER IN upright gametophyte0.025641
laminaria setchelli0.025641
laminaria0.025641
starfish0.025641
patiria pectinifera0.025641
LOWER IN coral reef0.025641
LOWER IN coral0.025641
LOWER IN eunicella labiata0.025641
LOWER IN gorgonian coral0.025641
chitin beads0.025641
cape cod canal0.025641
LOWER IN vancouver0.025641
LOWER IN pacific ocean0.025641
odonthalia floccosa0.025641
odonthalia0.025641
ralfsia sp.4gws0.025641
ralfsia0.025641
low tide zone0.025641
LOWER IN salinity <5 ppt0.025641
ptilota filicina0.025641
ptilota0.025641
antithamnionella floccosa0.025641
antithamnionella0.025641
gulf of naples0.025641
colpomenia0.025641
colpomenia sp. 1peregrina0.025641
LOWER IN air0.025641
LOWER IN aerosol0.025641
deth 5-100m0.025641
depth 30m0.025641
LOWER IN depth 200m0.025641
acrosiphonia0.025641
acrosiphonia coalita0.025641
salinity <5 ppt0.025641
neorhodomela0.025641
neorhodomela larix0.025641
red pine algae0.025641
depth 60m0.025641
kelp forest0.025641
ecklonia radiata0.025641
algae0.025641
marine biome0.025641
corallina vancouveriensis0.025641
Fraction of dbbact annotations with this term covered by the query
TermScore
canada1.500000
monterey bay0.666667
mastocarpus0.666667
depth 100m0.666667
surface water0.625000
pacific ocean0.529412
beach0.500000
depth 5m0.500000
calvert island0.500000
alga0.500000
mastocarpus alaskensis0.500000
crustose sporophyte0.500000
LOWER IN upright gametophyte0.500000
nan'ao island0.500000
bodega bay0.500000
laminaria setchelli0.500000
laminaria0.500000
starfish0.500000
patiria pectinifera0.500000
size < 1um0.500000
depth 20m0.500000
portuguese republic0.500000
saline water0.500000
LOWER IN coral reef0.500000
LOWER IN coral0.500000
LOWER IN eunicella labiata0.500000
LOWER IN gorgonian coral0.500000
estuary0.500000
estuary water0.500000
salinity >20 ppt0.500000
bilbao0.500000
coastal water0.500000
chitin beads0.500000
north america0.500000
depth 25cm0.500000
cape cod canal0.500000
LOWER IN vancouver0.500000
LOWER IN pacific ocean0.500000
odonthalia floccosa0.500000
odonthalia0.500000
ralfsia sp.4gws0.500000
ralfsia0.500000
low tide zone0.500000
size 1-80um0.500000
LOWER IN salinity <5 ppt0.500000
ptilota filicina0.500000
ptilota0.500000
antithamnionella floccosa0.500000
antithamnionella0.500000
gulf of naples0.500000
colpomenia0.500000
colpomenia sp. 1peregrina0.500000
red abalone0.500000
haliotis rufescens0.500000
LOWER IN air0.500000
LOWER IN aerosol0.500000
aerosol0.500000
saanich inlet0.500000
depth 200m0.500000
deth 5-100m0.500000
depth 30m0.500000
LOWER IN depth 200m0.500000
acrosiphonia0.500000
acrosiphonia coalita0.500000
salinity <5 ppt0.500000
neorhodomela0.500000
neorhodomela larix0.500000
red pine algae0.500000
haliotis sorenseni0.500000
white abalone0.500000
depth 60m0.500000
kelp forest0.500000
ecklonia radiata0.500000
algae0.500000
marine biome0.500000
corallina vancouveriensis0.500000
corallina0.500000
graceful coral seaweed0.500000
plocamium violaceum0.500000
plocamium0.500000
depth 80m0.500000
analipus0.500000
analipus japonicus0.500000
sea fir0.500000
egregia menziesii0.500000
egregia0.500000
santa cruz province0.500000
LOWER IN depth 75m0.500000
LOWER IN megaptera novaeangliae0.500000
LOWER IN humpback whale0.500000
LOWER IN respiratory airway0.500000
LOWER IN whale blow0.500000
LOWER IN exhaled air condensate0.500000
shell0.500000
depth 500m0.500000
red alga0.500000
LOWER IN nereocystis0.500000
LOWER IN kelp0.500000
depth 5-50m0.500000
LOWER IN depth 50-100m0.500000
Fraction of annotations for the query sequences containing the term
TermScore
pacific ocean0.697368
sea water0.565789
water0.526316
state of california0.500000
ocean0.342105
canada0.276316
united states of america0.250000
saline water0.236842
monterey bay0.223684
province of british columbia0.210526
calvert island0.210526
alga0.184211
surface water0.144737
beach0.118421
atlantic ocean0.065789
research facility0.065789
depth 5m0.052632
mastocarpus0.052632
bodega bay0.052632
nan'ao island0.039474
china0.039474
depth 20m0.039474
kingdom of spain0.039474
estuary0.039474
estuary water0.039474
bilbao0.039474
north america0.039474
depth 25cm0.039474
red abalone0.039474
haliotis rufescens0.039474
saanich inlet0.039474
depth 100m0.039474
mastocarpus alaskensis0.026316
crustose sporophyte0.026316
size < 1um0.026316
free floating0.026316
early time points0.026316
LOWER IN late time points0.026316
portuguese republic0.026316
marine water body0.026316
salinity >20 ppt0.026316
coastal water0.026316
commonwealth of massachusetts0.026316
particle bound0.026316
size 1-80um0.026316
air0.026316
aerosol0.026316
depth 200m0.026316
summer0.026316
LOWER IN winter0.026316
haliotis sorenseni0.026316
white abalone0.026316
foot0.026316
zostera marina0.026316
marine eelgrass0.026316
root0.026316
shell0.026316
vancouver0.026316
red alga0.026316
LOWER IN upright gametophyte0.013158
laminaria setchelli0.013158
laminaria0.013158
city0.013158
hokkaido0.013158
starfish0.013158
coelomic fluid0.013158
wild0.013158
patiria pectinifera0.013158
japan0.013158
LOWER IN coral reef0.013158
LOWER IN coral0.013158
LOWER IN eunicella labiata0.013158
LOWER IN gorgonian coral0.013158
chitin beads0.013158
early timepoints0.013158
LOWER IN late timepoints0.013158
cape cod canal0.013158
LOWER IN vancouver0.013158
LOWER IN pacific ocean0.013158
odonthalia floccosa0.013158
odonthalia0.013158
ralfsia sp.4gws0.013158
ralfsia0.013158
rock0.013158
low tide zone0.013158
depth 10m0.013158
LOWER IN fresh water0.013158
LOWER IN salinity <5 ppt0.013158
ptilota filicina0.013158
ptilota0.013158
antithamnionella floccosa0.013158
antithamnionella0.013158
mediterranean sea0.013158
italy0.013158
gulf of naples0.013158
depth 0-1 meter0.013158
coast0.013158
colpomenia0.013158
colpomenia sp. 1peregrina0.013158
feces0.013158
Exp. ID User ID Description Date Region Flag Sequences
304amnonhighfreq united states of america, state of california, beach, pacific ocean, water, sea water, monterey bay2018-03-12v4No1 / 15
317amnonhighfreq water, united states of america, state of california, pacific ocean, surface water, depth 5m, sea water2018-04-15v4No1 / 17
355amnonhigher in crustose sporophyte compared to upright gametophyte phase of mastocarpus algae ( high in crustose sporophyte compared to upright gametophyte in canada province of british columbia calvert island pacific ocean ocean alga mastocarpus alaskensis mastocarpus )2018-08-01v4No1 / 18
504amnonhighfreq nan'ao island, water, sea water, china2019-03-14v4No1 / 18
236amnonhighfreq ocean, pacific ocean, state of california, bodega bay, water, sea water2017-11-07v4No1 / 21
355amnoncommon canada, province of british columbia, calvert island, pacific ocean, ocean, alga, laminaria setchelli, laminaria2018-08-01v4No1 / 42
317amnoncommon water, united states of america, state of california, pacific ocean, surface water, depth 5m, sea water2018-04-15v4No1 / 62
355amnonhigh freq. in crustose sporophyte of mastocarpus algae (common canada, province of british columbia, calvert island, pacific ocean, ocean, alga, mastocarpus alaskensis, mastocarpus, crustose sporophyte)2018-08-01v4No1 / 66
550amnoncommon city, hokkaido, starfish, coelomic fluid, wild, patiria pectinifera, japan2019-08-18v4No1 / 85
505amnon high in early time points compared to late time points in water pacific ocean state of california surface water size < 1um free floating sea water 2019-03-16v4No1 / 96
280amnon high in marine water body sea water saline water compared to coral reef coral eunicella labiata gorgonian coral in atlantic ocean depth 20m portuguese republic 2018-01-25v4No1 / 132
510amnoncommon kingdom of spain, water, estuary, estuary water, saline water, salinity >20 ppt, bilbao2019-03-20v4No1 / 158
461amnonhigher in early compared to late timepoints in chitin beads incubated in ocean water ( high in early timepoints compared to late timepoints in water atlantic ocean surface water coastal water united states of america commonwealth of massachusetts chitin beads sea water )2019-01-12v4No1 / 160
209amnon high in cape cod canal atlantic ocean compared to vancouver pacific ocean in sea water ocean north america depth 25cm 2017-10-15v4No1 / 166
355amnoncommon canada, province of british columbia, calvert island, pacific ocean, ocean, alga, odonthalia floccosa, odonthalia2018-08-01v4No1 / 178
355amnoncommon canada, province of british columbia, calvert island, pacific ocean, ocean, alga, ralfsia sp.4gws, ralfsia2018-08-01v4No1 / 200
355amnoncommon in rocks from low tide zone (common canada, province of british columbia, calvert island, pacific ocean, ocean, rock, low tide zone)2018-08-01v4No1 / 206
473amnoncommon water, saline water, pacific ocean, state of california, monterey bay, depth 10m, sea water2019-01-16v4No1 / 213
473amnoncommon water, saline water, pacific ocean, state of california, monterey bay, depth 5m, sea water2019-01-16v4No1 / 220
505amnon high in early time points compared to late time points in water pacific ocean state of california surface water particle bound size 1-80um sea water 2019-03-16v4No1 / 223
510amnon high in saline water salinity >20 ppt compared to fresh water salinity <5 ppt in kingdom of spain water estuary estuary water bilbao 2019-03-20v4No1 / 223
473amnoncommon water, saline water, pacific ocean, state of california, monterey bay, depth 20m, sea water2019-01-16v4No1 / 225
505amnoncommon water, pacific ocean, state of california, surface water, free floating, size < 1um, sea water2019-03-14v4No1 / 225
355amnoncommon canada, province of british columbia, calvert island, pacific ocean, ocean, alga, ptilota filicina, ptilota2018-08-01v4No1 / 230
355amnoncommon canada, province of british columbia, calvert island, pacific ocean, ocean, alga, antithamnionella floccosa, antithamnionella2018-08-01v4No1 / 235
485amnoncommon water, saline water, mediterranean sea, italy, gulf of naples, surface water, depth 0-1 meter, coast, sea water2019-02-19v4No1 / 244
355amnoncommon canada, province of british columbia, calvert island, pacific ocean, ocean, alga, colpomenia, colpomenia sp. 1peregrina2018-08-01v4No1 / 255
308amnoncommon red abalone, haliotis rufescens, feces, united states of america, state of california, research facility2018-03-30v4No1 / 258
280amnoncommon atlantic ocean, saline water, sea water, marine water body, depth 20m, portuguese republic2018-01-25v4No1 / 259
304amnonhigher in seawater compared sea spray aerosol ( high in water sea water compared to air aerosol in united states of america state of california beach pacific ocean )2018-03-12v4No1 / 260
304amnoncommon united states of america, state of california, beach, pacific ocean, air, aerosol, monterey bay2018-03-12v4No1 / 263
355amnoncommon canada, province of british columbia, calvert island, pacific ocean, ocean, surface water, sea water2018-08-01v4No1 / 280
496amnoncommon water, canada, saanich inlet, pacific ocean, depth 200m, sea water2019-03-03v4No1 / 287
473amnon high in summer compared to winter in water saline water pacific ocean state of california monterey bay deth 5-100m sea water 2019-01-16v4No1 / 293
473amnoncommon water, saline water, pacific ocean, state of california, monterey bay, depth 30m, sea water2019-01-16v4No1 / 293
496amnon high in depth 100m compared to depth 200m in water canada saanich inlet pacific ocean sea water 2019-03-03v4No1 / 310
355amnoncommon canada, province of british columbia, calvert island, pacific ocean, ocean, alga, acrosiphonia, acrosiphonia coalita2018-08-01v4No1 / 311
510amnoncommon kingdom of spain, water, estuary, estuary water, fresh water, salinity <5 ppt, bilbao2019-03-20v4No1 / 317
461amnoncommon water, atlantic ocean, surface water, coastal water, united states of america, commonwealth of massachusetts, sea water2019-01-12v4No1 / 322
473amnoncommon water, saline water, pacific ocean, state of california, monterey bay, depth 40m, sea water2019-01-16v4No1 / 340
355amnoncommon canada, province of british columbia, calvert island, pacific ocean, ocean, alga, neorhodomela, neorhodomela larix, red pine algae2018-08-01v4No1 / 364
308amnoncommon united states of america, state of california, research facility, haliotis sorenseni, white abalone, foot2018-03-30v4No1 / 368
473amnoncommon water, saline water, pacific ocean, state of california, monterey bay, depth 60m, sea water2019-01-16v4No1 / 390
505amnoncommon water, pacific ocean, state of california, surface water, particle bound, size 1-80um, sea water2019-03-14v4No1 / 397
77amnon high in summer compared to winter in kelp forest ecklonia radiata australia algae marine biome 2017-02-28v4No1 / 399
355amnoncommon canada, province of british columbia, calvert island, pacific ocean, ocean, alga, corallina vancouveriensis, corallina, graceful coral seaweed2018-08-01v4No1 / 408
355amnoncommon canada, province of british columbia, calvert island, pacific ocean, ocean, alga, plocamium violaceum, plocamium2018-08-01v4No1 / 444
209amnoncommon sea water, ocean, north america, depth 25cm2017-10-15v4No1 / 445
504amnoncommon nan'ao island, water, sea water, china2019-03-14v4No1 / 452
473amnoncommon water, saline water, pacific ocean, state of california, monterey bay, depth 80m, sea water2019-01-16v4No1 / 454
355amnoncommon canada, province of british columbia, calvert island, pacific ocean, ocean, alga, analipus, analipus japonicus, sea fir2018-08-01v4No1 / 461
504amnon high in water sea water compared to sediment marine sediment in nan'ao island china 2019-03-14v4No1 / 462
496amnoncommon water, canada, saanich inlet, pacific ocean, depth 100m, sea water2019-03-03v4No1 / 469
355amnoncommon canada, province of british columbia, calvert island, pacific ocean, ocean, alga, egregia menziesii, egregia2018-08-01v4No1 / 472
236amnoncommon state of california, bodega bay, ocean, zostera marina, marine eelgrass, root2017-11-07v4No1 / 483
473amnoncommon water, saline water, pacific ocean, state of california, monterey bay, depth 100m, sea water2019-01-16v4No1 / 486
473amnoncommon water, saline water, pacific ocean, state of california, monterey bay, depth 200m, sea water2019-01-16v4No1 / 492
304amnoncommon united states of america, state of california, beach, pacific ocean, air, aerosol, santa cruz province2018-03-12v4No1 / 518
317amnonlower in depth>75m compared to depth >5m in ocean water ( high in surface water depth 5m compared to depth 300m depth 150m depth 75m in water united states of america state of california pacific ocean sea water )2018-04-15v4No1 / 544
304amnonhigher in seawater compared to beach sand ( high in sea water water compared to sand in united states of america state of california beach pacific ocean )2018-03-12v4No1 / 547
209amnonlower in whale blow condensate compared to ocean water ( high in sea water ocean depth 25cm compared to megaptera novaeangliae humpback whale respiratory airway whale blow exhaled air condensate in north america )2017-10-15v4No1 / 560
308amnoncommon red abalone, haliotis rufescens, united states of america, state of california, research facility, shell2018-03-30v4No1 / 579
473amnoncommon water, saline water, pacific ocean, state of california, monterey bay, depth 500m, sea water2019-01-16v4No1 / 587
308amnoncommon red abalone, haliotis rufescens, united states of america, state of california, research facility, foot2018-03-30v4No1 / 592
318amnoncommon canada, vancouver, ocean, pacific ocean, red alga, mastocarpus2018-04-16v4No1 / 598
308amnoncommon united states of america, state of california, research facility, haliotis sorenseni, white abalone, shell2018-03-30v4No1 / 632
304amnoncommon united states of america, state of california, beach, pacific ocean, water, sea water, monterey bay2018-03-12v4No1 / 667
236amnon high in root compared to leaf in state of california bodega bay ocean zostera marina marine eelgrass 2017-11-07v4No1 / 819
318amnon high in mastocarpus red alga compared to nereocystis kelp in canada vancouver ocean pacific ocean 2018-04-16v4No1 / 827
473amnon high in depth 5-50m compared to depth 50-100m in water saline water pacific ocean state of california monterey bay sea water 2019-01-16v4No1 / 919
304amnoncommon united states of america, state of california, beach, pacific ocean, sand, monterey bay2018-03-12v4No1 / 1038
473amnon high in depth 50-100m compared to depth 150-500m in water saline water pacific ocean state of california monterey bay sea water 2019-01-16v4No1 / 1072
236amnoncommon ocean, state of california, pacific ocean, bodega bay, water, sea water2017-11-07v4No1 / 1156
304amnoncommon united states of america, state of california, beach, pacific ocean, water, sea water, san francisco bay2018-03-12v4No1 / 1166
304amnoncommon united states of america, state of california, beach, pacific ocean, water, sea water, santa cruz county2018-03-12v4No1 / 1425
486amnon high in low activity methane seep compared to oil seep active methane seep in pacific ocean ocean sediment carbonate lithified carbonate blocks depth 500-1000m hydrate ridge state of oregon 2019-02-19v4No1 / 1791

Problems / suggestions? Please email info AT dbbact DOT org