Search result for sequence:
TACGGAGGGTCCGAGCGTTATCCGGAATTATTGGGTTTAAAGGGTCCGTAGGCGGATGATTAAGTCAGGGGTGAAAGTTTGCAGCTCAACTGTAAAATTGCCTTTGATACTGGTTATCTTGAGTTGTATTGAAGTAGGCGGAATATGTAG
common ontology terms
term enrichment score
TermScore
sea water0.306483
lytechinus variegatus0.285714
surface water0.283019
water0.262295
sea urchin0.214286
nan'ao island0.214286
estuary0.214286
estuary water0.214286
bilbao0.214286
beach0.214286
saline water0.210526
pacific ocean0.155039
artificial seawater0.153846
gulf of naples0.153846
size < 1um0.153846
salinity >20 ppt0.153846
state of florida0.153846
state of california0.143885
depth 0-1 meter0.142857
jiangxi province0.142857
mediterranean sea0.133333
coast0.133333
free floating0.125000
hunan province0.117647
kingdom of spain0.098361
fresh water0.097561
italy0.090909
quasipaa spinosa0.083333
giant spiny frog0.083333
romania0.083333
ursu lake0.083333
depth 0-3m0.083333
mixolimnion0.083333
LOWER IN depth 4-9m0.083333
LOWER IN monimolimnion0.083333
LOWER IN hypersaline water0.083333
LOWER IN salinity &lt;5 ppt0.083333
eagle harbor0.083333
LOWER IN air0.083333
LOWER IN aerosol0.083333
pond0.083333
LOWER IN particle bound0.083333
LOWER IN size 1-80um0.083333
salinity <5 ppt0.083333
coastal water0.083333
santa cruz county0.083333
futian national nature reserve0.083333
mudflat0.083333
lake water0.080000
low salinity0.080000
LOWER IN high salinity0.080000
aquarium0.076923
LOWER IN marine sediment0.076923
LOWER IN sand0.076923
mangrove swamp0.076923
early time points0.074074
LOWER IN late time points0.074074
commonwealth of massachusetts0.074074
LOWER IN sediment0.074074
lake0.071429
LOWER IN fresh water0.071429
zhejiang province0.071429
frog0.068966
depth 0-20cm0.068966
atlantic ocean0.066667
marine sediment0.055556
china0.051282
colon0.048780
digestive system0.040000
united states of america0.028649
soil0.023529
research facility0.017341
feces0.016000
Fraction of dbbact annotations with this term covered by the query
TermScore
lytechinus variegatus0.666667
sea urchin0.500000
artificial seawater0.500000
nan'ao island0.500000
gulf of naples0.500000
size < 1um0.500000
quasipaa spinosa0.500000
giant spiny frog0.500000
estuary0.500000
estuary water0.500000
salinity >20 ppt0.500000
bilbao0.500000
romania0.500000
ursu lake0.500000
depth 0-3m0.500000
mixolimnion0.500000
LOWER IN depth 4-9m0.500000
LOWER IN monimolimnion0.500000
LOWER IN hypersaline water0.500000
LOWER IN salinity &lt;5 ppt0.500000
eagle harbor0.500000
beach0.500000
LOWER IN air0.500000
LOWER IN aerosol0.500000
pond0.500000
LOWER IN particle bound0.500000
LOWER IN size 1-80um0.500000
salinity <5 ppt0.500000
coastal water0.500000
santa cruz county0.500000
futian national nature reserve0.500000
mudflat0.500000
surface water0.375000
depth 0-1 meter0.333333
jiangxi province0.333333
lake water0.333333
low salinity0.333333
LOWER IN high salinity0.333333
aquarium0.250000
saline water0.250000
mediterranean sea0.250000
coast0.250000
LOWER IN marine sediment0.250000
LOWER IN sand0.250000
mangrove swamp0.250000
sea water0.206897
free floating0.200000
early time points0.200000
LOWER IN late time points0.200000
commonwealth of massachusetts0.200000
LOWER IN sediment0.200000
hunan province0.166667
lake0.166667
LOWER IN fresh water0.166667
zhejiang province0.166667
water0.160000
frog0.142857
depth 0-20cm0.142857
state of florida0.133333
atlantic ocean0.125000
pacific ocean0.117647
state of california0.105263
fresh water0.105263
italy0.090909
kingdom of spain0.076923
marine sediment0.071429
colon0.052632
digestive system0.035714
china0.028302
soil0.015873
united states of america0.015000
research facility0.009259
feces0.008772
Fraction of annotations for the query sequences containing the term
TermScore
water0.727273
sea water0.590909
united states of america0.318182
china0.272727
surface water0.227273
pacific ocean0.227273
state of california0.227273
lytechinus variegatus0.181818
state of florida0.181818
saline water0.181818
sea urchin0.136364
research facility0.136364
nan'ao island0.136364
kingdom of spain0.136364
estuary0.136364
estuary water0.136364
bilbao0.136364
beach0.136364
artificial seawater0.090909
mediterranean sea0.090909
italy0.090909
gulf of naples0.090909
depth 0-1 meter0.090909
coast0.090909
size < 1um0.090909
free floating0.090909
hunan province0.090909
jiangxi province0.090909
salinity >20 ppt0.090909
feces0.090909
fresh water0.090909
aquarium0.045455
early time points0.045455
LOWER IN late time points0.045455
quasipaa spinosa0.045455
giant spiny frog0.045455
frog0.045455
colon0.045455
digestive system0.045455
lake0.045455
romania0.045455
ursu lake0.045455
lake water0.045455
depth 0-3m0.045455
mixolimnion0.045455
low salinity0.045455
LOWER IN depth 4-9m0.045455
LOWER IN high salinity0.045455
LOWER IN monimolimnion0.045455
LOWER IN hypersaline water0.045455
LOWER IN fresh water0.045455
LOWER IN salinity &lt;5 ppt0.045455
eagle harbor0.045455
LOWER IN air0.045455
LOWER IN aerosol0.045455
pond0.045455
LOWER IN particle bound0.045455
LOWER IN size 1-80um0.045455
salinity <5 ppt0.045455
atlantic ocean0.045455
coastal water0.045455
commonwealth of massachusetts0.045455
LOWER IN sediment0.045455
LOWER IN marine sediment0.045455
LOWER IN sand0.045455
santa cruz county0.045455
soil0.045455
mangrove swamp0.045455
marine sediment0.045455
depth 0-20cm0.045455
zhejiang province0.045455
futian national nature reserve0.045455
mudflat0.045455
Exp. ID User ID Description Date Region Flag Sequences
351amnonhigh freq. in aquarium artificial sea water where sea urchins were grown (dominant sea urchin, lytechinus variegatus, research facility, state of florida, united states of america, artificial seawater, sea water, aquarium)2018-07-30v4No1 / 12
504amnondominant nan'ao island, water, sea water, china2019-03-14v4No1 / 18
485amnondominant water, saline water, mediterranean sea, italy, gulf of naples, surface water, depth 0-1 meter, coast, sea water2019-02-19v4No1 / 23
505amnon high in early time points compared to late time points in water pacific ocean state of california surface water size < 1um free floating sea water 2019-03-16v4No1 / 96
315amnoncommon in frog gut (common hunan province, jiangxi province, quasipaa spinosa, giant spiny frog, frog, colon, digestive system, china)2018-04-10v4No1 / 138
510amnoncommon kingdom of spain, water, estuary, estuary water, saline water, salinity >20 ppt, bilbao2019-03-20v4No1 / 158
577amnon high in depth 0-3m mixolimnion low salinity compared to depth 4-9m high salinity monimolimnion hypersaline water in lake romania ursu lake water lake water 2020-01-09v3No1 / 190
510amnon high in saline water salinity >20 ppt compared to fresh water salinity <5 ppt in kingdom of spain water estuary estuary water bilbao 2019-03-20v4No1 / 223
351amnoncommon sea urchin, lytechinus variegatus, research facility, eagle harbor, state of florida, united states of america, feces2018-07-30v4No1 / 233
485amnoncommon water, saline water, mediterranean sea, italy, gulf of naples, surface water, depth 0-1 meter, coast, sea water2019-02-19v4No1 / 244
304amnonhigher in seawater compared sea spray aerosol ( high in water sea water compared to air aerosol in united states of america state of california beach pacific ocean )2018-03-12v4No1 / 260
315amnoncommon in frog pond water (common hunan province, jiangxi province, water, fresh water, pond, china)2018-04-10v4No1 / 274
505amnon high in free floating size < 1um compared to particle bound size 1-80um in water pacific ocean state of california surface water sea water 2019-03-14v4No1 / 283
510amnoncommon kingdom of spain, water, estuary, estuary water, fresh water, salinity <5 ppt, bilbao2019-03-20v4No1 / 317
461amnoncommon water, atlantic ocean, surface water, coastal water, united states of america, commonwealth of massachusetts, sea water2019-01-12v4No1 / 322
351amnoncommon in artificial sea water where sea urchins were grown (common sea urchin, lytechinus variegatus, research facility, state of florida, united states of america, artificial seawater, sea water)2018-07-30v4No1 / 338
65amnoncommon feces, lytechinus variegatus, state of florida2017-02-17v4No1 / 376
504amnoncommon nan'ao island, water, sea water, china2019-03-14v4No1 / 452
504amnon high in water sea water compared to sediment marine sediment in nan'ao island china 2019-03-14v4No1 / 462
304amnonhigher in seawater compared to beach sand ( high in sea water water compared to sand in united states of america state of california beach pacific ocean )2018-03-12v4No1 / 547
304amnoncommon united states of america, state of california, beach, pacific ocean, water, sea water, santa cruz county2018-03-12v4No1 / 1425
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, zhejiang province, futian national nature reserve, mudflat2019-12-16v4No1 / 1587

Problems / suggestions? Please email info AT dbbact DOT org