Search result for sequence:
TACGGAGGGTGCAAGCATTAATCGGATTTATTGGGCGTAAAGGGCGCGTAGGCGGATGGCCAAGTCAGATGTGAAATTTTGATACTCAACATCAAAACTGCATCTGAAACTAGTTATCTTGAGGGTAGGTGGAGAAAATGGAATTTCACG
common ontology terms
Fraction of dbbact annotations with this term covered by the query
TermScore
ant0.500000
pseudomyrmex elongatus0.500000
pseudomyrmex pallidus0.500000
pseudomyrmex nigropilosus0.500000
pseudomyrmex gracilis0.500000
generalist0.500000
LOWER IN pseudomyrmex nigrocinctus0.500000
LOWER IN pseudomyrmex flavicornis0.500000
LOWER IN pseudomyrmex spinicola0.500000
LOWER IN acacia ants0.500000
camponotus0.333333
pseudomyrmex0.333333
costa rica0.142857
LOWER IN stomach0.111111
larval stage0.071429
united states of america0.004132
Fraction of annotations for the query sequences containing the term
TermScore
united states of america1.000000
costa rica1.000000
ant1.000000
larval stage0.875000
camponotus0.375000
pseudomyrmex gracilis0.250000
LOWER IN stomach0.125000
pseudomyrmex elongatus0.125000
pseudomyrmex pallidus0.125000
pseudomyrmex nigropilosus0.125000
generalist0.125000
LOWER IN pseudomyrmex nigrocinctus0.125000
LOWER IN pseudomyrmex flavicornis0.125000
LOWER IN pseudomyrmex spinicola0.125000
LOWER IN acacia ants0.125000
pseudomyrmex0.125000

Problems / suggestions? Please email info AT dbbact DOT org