Search result for sequence:
TACGGAGGGTGCAAGCGTTAATCAGAATTACTGGGCGTAAAGAGCGCGTAGGCGGTAATTTAAGTCAGATGTGAAATCCCTGGGCTCAACCTAGGAACTGCATTTGAAACTAAATTACTAGAGTTTCGTAGAGGGAGGTAGAATTCTAGG
common ontology terms
term enrichment score
TermScore
cinara0.615385
cinara fornacula0.285714
cinara obscura0.285714
cinara sp0.285714
cinara unknown0.285714
LOWER IN soilwater0.285714
province of quebec0.250000
tree0.200000
LOWER IN water0.111111
LOWER IN soil0.100000
leaf0.080000
canada0.076923
Fraction of dbbact annotations with this term covered by the query
TermScore
cinara0.500000
cinara fornacula0.500000
cinara obscura0.500000
cinara sp0.500000
cinara unknown0.500000
LOWER IN soilwater0.500000
province of quebec0.333333
tree0.200000
LOWER IN water0.076923
LOWER IN soil0.066667
leaf0.050000
canada0.047619
Fraction of annotations for the query sequences containing the term
TermScore
cinara0.800000
cinara fornacula0.200000
cinara obscura0.200000
cinara sp0.200000
cinara unknown0.200000
leaf0.200000
tree0.200000
LOWER IN soil0.200000
LOWER IN water0.200000
LOWER IN soilwater0.200000
canada0.200000
province of quebec0.200000

Problems / suggestions? Please email info AT dbbact DOT org