Search result for sequence:
TACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGAGTACGTAGGTGGGTTATTAAGTCAGGTGTGAAATCCCTGAGCTTAACTTAGGAACTGCATTTGAAACTGATAATCTAGAGTTTCGTAGAGGGGGGTAGAATTCCAGG
common ontology terms
term enrichment score
TermScore
ants0.640000
azteca0.307692
peru0.285714
pseudomyrmex0.266667
solenopsis0.181818
carpenter ant0.181818
myrmelachista0.181818
crematogaster0.166667
camponotus0.166667
eciton0.153846
digestive system0.051282
Fraction of dbbact annotations with this term covered by the query
TermScore
ants0.500000
solenopsis0.500000
azteca0.500000
carpenter ant0.500000
myrmelachista0.500000
pseudomyrmex0.333333
crematogaster0.333333
camponotus0.333333
eciton0.250000
peru0.166667
digestive system0.026316
Fraction of annotations for the query sequences containing the term
TermScore
digestive system1.000000
peru1.000000
ants0.888889
pseudomyrmex0.222222
azteca0.222222
solenopsis0.111111
crematogaster0.111111
eciton0.111111
camponotus0.111111
carpenter ant0.111111
myrmelachista0.111111

Problems / suggestions? Please email info AT dbbact DOT org