Search result for sequence:
TACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTCTGTCAAGTCGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCCGAAACTGGCAGGCTAGAGTCTTGTAGAGGGGGGTAGAATTCCAGG
common ontology terms
term enrichment score
TermScore
digestive system0.200119
united states of america0.193860
skin0.190088
feces0.186971
snake0.185759
frog0.176545
adult0.159936
china0.146769
pond0.146667
homo sapiens0.141486
research facility0.134697
intestine0.128244
hunan province0.108434
brazil0.107623
southern united states0.103226
ethiopia0.103226
osteopilus septentrionalis0.093645
farm0.092736
snake farm0.091503
adula0.091503
ensete ventricosum0.091503
ethiopian banana0.091503
tadpole0.079470
colon0.076364
state of florida0.075881
water0.074697
infant0.072289
united kingdom0.072289
food (fermented)0.071795
fish0.069767
caecum0.065574
kingdom of spain0.063559
texas0.062893
city0.062402
fresh water0.059172
child0.058027
rana pipiens0.054422
northern leopard frog0.054422
days 30-600.054422
anaerobic fermentation0.054422
digesta0.052980
state of wisconsin0.052980
kingdom of denmark0.052980
sprague dawley0.052288
late timepoint0.051613
pig0.050955
sus scrofa0.050955
rat0.049080
state of california0.048682
control0.048359
clostridium difficile intestinal infectious disease0.041667
LOWER IN tadpole0.041667
fossorial snake0.041379
aerobic fermentation0.041379
days 1-150.041379
nile tilapia0.041379
cambridgeshire0.041379
wastewater treatment plant0.041379
diarrhea0.041096
gallus gallus0.040541
chicken0.040541
oreochromis niloticus0.040541
newt0.040541
rural community0.040134
ileum0.039735
switzerland0.039735
early timepoint0.039735
duodenum0.039344
japan0.038585
river0.038217
age0.037975
rattus norvegicus0.037500
dog0.034286
canis lupus familiaris0.032086
mouse0.028235
male0.028169
age 3 days0.027972
cleanroom0.027972
elaphe carinata0.027972
king ratsnake0.027972
naja atra0.027972
chinese cobra0.027972
scinax fuscovarius0.027972
astyanax paranae0.027972
astyanax0.027972
ptyas mucosa0.027972
oriental ratsnake0.027972
storeria dekayi0.027972
ground snake0.027972
anaxyrus terrestris0.027972
southern toad0.027972
lithobates catesbeianus0.027972
ursus arctos0.027972
brown bear0.027972
poecilia reticulata0.027972
guppy0.027972
age one month0.027972
andrias japonicus0.027972
japanese giant salamander0.027972
cyprinus carpio0.027972
Fraction of dbbact annotations with this term covered by the query
TermScore
pond1.000000
frog0.714286
snake0.666667
osteopilus septentrionalis0.666667
male0.666667
clostridium difficile intestinal infectious disease0.600000
LOWER IN tadpole0.600000
rana pipiens0.500000
northern leopard frog0.500000
age 3 days0.500000
cleanroom0.500000
urbanus teleus0.500000
snake farm0.500000
adula0.500000
elaphe carinata0.500000
king ratsnake0.500000
anoplophora glabripennis0.500000
naja atra0.500000
chinese cobra0.500000
scinax fuscovarius0.500000
tadpole0.500000
astyanax paranae0.500000
astyanax0.500000
LOWER IN schizophrenia0.500000
ptyas mucosa0.500000
oriental ratsnake0.500000
southern united states0.500000
fossorial snake0.500000
storeria dekayi0.500000
ground snake0.500000
anaxyrus terrestris0.500000
southern toad0.500000
inflammatory bowel disease0.500000
lithobates catesbeianus0.500000
liolaemus ruibali0.500000
ursus arctos0.500000
brown bear0.500000
poecilia reticulata0.500000
guppy0.500000
age one month0.500000
age one week0.500000
ethiopia0.500000
ensete ventricosum0.500000
ethiopian banana0.500000
aerobic fermentation0.500000
days 1-150.500000
days 30-600.500000
anaerobic fermentation0.500000
andrias japonicus0.500000
japanese giant salamander0.500000
LOWER IN amphibian larval stage0.500000
LOWER IN non c. diff diarrhea0.500000
ranatra0.500000
water stick-insect0.500000
carphophis amoenus0.500000
worm snake0.500000
LOWER IN age 28 days0.500000
peponocephala electra0.500000
stenella attenuata0.500000
trigona hyalinata0.500000
nile tilapia0.500000
cyprinus carpio0.500000
common carp0.500000
england0.500000
przewalski horse0.500000
LOWER IN zoo0.500000
area designated as a nature reserve0.500000
coluber constrictor0.500000
eastern racer snake0.500000
ensete ventricosum var. gena0.500000
LOWER IN ensete ventricosum var. maze0.500000
LOWER IN vaccination0.500000
LOWER IN salmune vaccination0.500000
age 3-60.500000
LOWER IN age 8-120.500000
LOWER IN age 13-140.500000
LOWER IN acute respiratory illness0.500000
greenhouse0.500000
beaucarnea recurvata0.500000
cambridgeshire0.500000
triturus cristatus0.500000
waste water0.500000
xinxiang city prefecture0.500000
eastern red backed salamander0.500000
plethodon cinereus0.500000
LOWER IN temp 20c0.500000
temp 10c0.500000
rhinella icterica0.500000
yellow cururu toad0.500000
LOWER IN age one week0.500000
LOWER IN sucram0.500000
standard feed0.500000
lissotriton vulgaris0.500000
thamnophis sirtalis0.500000
common garter snake0.500000
LOWER IN days 30-600.500000
LOWER IN anaerobic fermentation0.500000
aquatic snake0.500000
nerodia sipedon0.500000
northern water snake0.500000
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.352518
feces0.309353
research facility0.194245
homo sapiens0.187050
adult0.165468
china0.165468
digestive system0.151079
skin0.143885
snake0.107914
intestine0.100719
frog0.100719
brazil0.086331
pond0.079137
farm0.071942
hunan province0.064748
southern united states0.057554
water0.057554
ethiopia0.057554
snake farm0.050360
adula0.050360
control0.050360
colon0.050360
ensete ventricosum0.050360
ethiopian banana0.050360
food (fermented)0.050360
osteopilus septentrionalis0.050360
state of florida0.050360
caecum0.043165
tadpole0.043165
fish0.043165
infant0.043165
united kingdom0.043165
kingdom of spain0.035971
texas0.035971
child0.035971
fresh water0.035971
city0.035971
rana pipiens0.028777
northern leopard frog0.028777
digesta0.028777
state of wisconsin0.028777
state of california0.028777
rat0.028777
sprague dawley0.028777
kingdom of denmark0.028777
late timepoint0.028777
days 30-600.028777
anaerobic fermentation0.028777
pig0.028777
sus scrofa0.028777
gallus gallus0.021583
chicken0.021583
canis lupus familiaris0.021583
dog0.021583
duodenum0.021583
ileum0.021583
fossorial snake0.021583
LOWER IN control0.021583
rattus norvegicus0.021583
switzerland0.021583
diarrhea0.021583
early timepoint0.021583
aerobic fermentation0.021583
days 1-150.021583
clostridium difficile intestinal infectious disease0.021583
LOWER IN tadpole0.021583
japan0.021583
mus musculus0.021583
mouse0.021583
age0.021583
oreochromis niloticus0.021583
nile tilapia0.021583
newt0.021583
cambridgeshire0.021583
wastewater treatment plant0.021583
river0.021583
rural community0.021583
broiler chicken0.014388
age 3 days0.014388
floor0.014388
dust0.014388
cleanroom0.014388
elaphe carinata0.014388
king ratsnake0.014388
naja atra0.014388
chinese cobra0.014388
scinax fuscovarius0.014388
astyanax paranae0.014388
astyanax0.014388
ptyas mucosa0.014388
oriental ratsnake0.014388
storeria dekayi0.014388
ground snake0.014388
anaxyrus terrestris0.014388
southern toad0.014388
rana catesbeiana0.014388
lithobates catesbeianus0.014388
bullfrog0.014388
pond water0.014388
ursus arctos0.014388
Exp. ID User ID Description Date Region Flag Sequences
114amnonhighfreq rana pipiens, northern leopard frog, adult, research facility, digesta, intestine, state of wisconsin, united states of america2017-04-10v4No1 / 1
495amnoncommon gallus gallus, chicken, caecum, broiler chicken, age 3 days, kingdom of spain, farm2019-03-03v4No1 / 4
308amnonhigh freq. in spacecraft assembly cleanroom floor (highfreq united states of america, state of california, floor, dust, cleanroom)2018-03-31v4No1 / 5
501amnonhighfreq costa rica, butterfly, digestive system, urbanus teleus2019-03-08v4No1 / 8
301amnonhighfreq canis lupus familiaris, dog, united states of america, duodenum2018-03-05v4No1 / 9
177amnonblooming bacteria (grows in storage at room temp.) (contamination)2017-07-30v4No1 / 10
530amnonhighfreq snake, feces, snake farm, farm, adula, hunan province, elaphe carinata, king ratsnake, china2019-07-21v4No1 / 10
301amnonhighfreq canis lupus familiaris, dog, united states of america, ileum2018-03-05v4No1 / 12
495amnonhighfreq gallus gallus, chicken, caecum, broiler chicken, age 3 days, kingdom of spain, farm2019-03-03v4No1 / 12
243amnonhighfreq beetle, anoplophora glabripennis, digestive system, united states of america2017-11-15v4No1 / 13
530amnonhighfreq snake, feces, snake farm, farm, adula, hunan province, naja atra, chinese cobra, china2019-07-21v4No1 / 13
499amnonhighfreq brazil, pond, digestive system, intestine, scinax fuscovarius, frog, tadpole2019-03-05v4No1 / 14
499amnonhighfreq brazil, pond, digestive system, intestine, astyanax paranae, fish, astyanax2019-03-05v4No1 / 14
502amnon high in control compared to schizophrenia in homo sapiens feces adult united states of america 2019-03-12v4No1 / 14
530amnonhighfreq snake, feces, snake farm, farm, adula, hunan province, ptyas mucosa, oriental ratsnake, china2019-07-21v4No1 / 14
536amnonhighfreq snake, skin, united states of america, southern united states, fossorial snake, storeria dekayi, ground snake2019-07-28v4No1 / 15
108amnonhighfreq research facility, texas, united states of america, colon, anaxyrus terrestris, southern toad2017-04-07v4No1 / 16
395amnonhigher in kids with ibd compared to healthy donors ( high in child ulcerative colitis inflammatory bowel disease crohn's disease compared to control in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 16
434amnon high in fructose diet fructose compared to control diet in rat rattus norvegicus sprague dawley feces caecum research facility switzerland 2018-12-20v4No1 / 16
492amnonhighfreq skin, adult, rana catesbeiana, lithobates catesbeianus, bullfrog, brazil, frog2019-02-27v4No1 / 16
499amnonhighfreq brazil, pond, water, pond water, fresh water2019-03-05v4No1 / 16
71amnonhighfreq liolaemus ruibali, argentina, research facility, feces2017-02-25v4No1 / 17
387amnon high in winter compared to summer in ursus arctos brown bear feces sweden wild 2018-11-03v4No1 / 17
499amnonhighfreq brazil, pond, poecilia reticulata, digestive system, intestine, fish, guppy2019-03-05v4No1 / 17
207amnonhigh freq. in people hospitalized with diarrhea (highfreq homo sapiens, israel, feces, diarrhea)2017-10-05v4No1 / 18
273amnonhighfreq feces, homo sapiens, kingdom of denmark, infant, age one month2018-01-14v4No1 / 18
387amnonhigh freq. in feces of wild brown bear (highfreq ursus arctos, brown bear, feces, sweden, wild)2018-11-03v4No1 / 18
516amnonhighfreq homo sapiens, feces, united states of america, state of ohio, adult2019-05-29v4No1 / 19
273amnonhighfreq feces, homo sapiens, kingdom of denmark, infant, age one week2018-01-14v4No1 / 20
284amnonhighfreq homo sapiens, female, feces, state of california, infant, age 2 months2018-01-27v4No1 / 20
539amnonhighfreq ethiopia, ensete ventricosum, ethiopian banana, early timepoint, aerobic fermentation, days 1-15, food (fermented)2019-07-31v4No1 / 20
94amnonhighfreq homo sapiens, clostridium difficile intestinal infectious disease, feces, state of michigan, diarrhea2017-03-12v4No1 / 22
185amnonhigh freq. in patients with c. diff infection before treatment (highfreq homo sapiens, feces, united states of america, state of minnesota, clostridium difficile intestinal infectious disease)2017-08-20v4No1 / 22
308amnoncommon in spacecraft assembly cleanroom floor (common united states of america, state of california, floor, dust, cleanroom)2018-03-31v4No1 / 23
539amnonhighfreq ethiopia, ensete ventricosum, ethiopian banana, late timepoint, days 30-60, anaerobic fermentation, food (fermented)2019-07-31v4No1 / 23
322amnonhighfreq frog, osteopilus septentrionalis, united states of america, state of florida, research facility, adult, digestive system2018-04-23v4No1 / 24
338amnon high in adult compared to tadpole amphibian larval stage larval stage in andrias japonicus japanese giant salamander skin japan 2018-05-21v4No1 / 24
390amnonhigher in patients with c. diff diarrhea compared to non-c. diff diarrhea ( high in clostridium difficile intestinal infectious disease compared to non c. diff diarrhea in homo sapiens feces australia hospital diarrhea )2018-11-04v4No1 / 24
471amnonhighfreq digestive system, frog, osteopilus septentrionalis, research facility, united states of america, adult, state of florida2019-01-14v4No1 / 24
114amnonhighfreq rana pipiens, northern leopard frog, research facility, digesta, intestine, state of wisconsin, united states of america, tadpole2017-04-10v4No1 / 26
499amnoncommon ranatra, water stick-insect, brazil, pond, digestive system, intestine2019-03-05v4No1 / 26
536amnoncommon snake, skin, united states of america, southern united states, carphophis amoenus, worm snake, fossorial snake2019-07-28v4No1 / 35
539amnoncommon ethiopia, ensete ventricosum, ethiopian banana, early timepoint, aerobic fermentation, days 1-15, food (fermented)2019-07-31v4No1 / 35
219amnonhigher in pre-weaning compared to post-weaning in mouse feces ( high in age age 21 days breast milk compared to age 28 days mouse chow in mus musculus mouse feces c57bl/6 male research facility south korea )2017-10-24v4No1 / 36
79amnoncommon peponocephala electra, skin, united states of america2017-03-03v4No1 / 40
79amnoncommon skin, united states of america, stenella attenuata2017-03-03v4No1 / 40
60amnoncommon anser cygnoides, feces, china2017-02-03v4No1 / 42
59amnoncommon trigona hyalinata, digestive system2017-02-02v4No1 / 43
108amnoncommon research facility, texas, united states of america, colon, oreochromis niloticus, nile tilapia2017-04-07v4No1 / 43
396amnoncommon fish, cyprinus carpio, common carp, england, intestine, digestive system2018-11-14v4No1 / 45
406amnoncommon feces, equus przewalskii, przewalski horse, zoological garden, united states of america2018-11-21v4No1 / 50
338amnonhigher in wild salamanders compared to zoo grown salamanders ( high in pond area designated as a nature reserve compared to zoological garden zoo in andrias japonicus japanese giant salamander skin japan )2018-05-21v4No1 / 51
530amnoncommon snake, feces, snake farm, farm, adula, hunan province, elaphe carinata, king ratsnake, china2019-07-21v4No1 / 63
536amnoncommon snake, skin, united states of america, southern united states, coluber constrictor, eastern racer snake2019-07-28v4No1 / 64
539amnon high in ensete ventricosum var. gena compared to ensete ventricosum var. maze in ethiopia ensete ventricosum ethiopian banana late timepoint days 30-60 anaerobic fermentation food (fermented) 2019-07-31v4No1 / 65
114amnoncommon rana pipiens, northern leopard frog, adult, research facility, digesta, intestine, state of wisconsin, united states of america2017-04-10v4No1 / 72
127amnonhigher in non-vaccinated chickens ( high in control compared to vaccination salmune vaccination in gallus gallus chicken united states of america caecum )2017-04-14v4No1 / 72
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, skin, nipple, adult2018-11-04v4No1 / 72
322amnoncommon frog, osteopilus septentrionalis, united states of america, state of florida, research facility, adult, digestive system2018-04-23v4No1 / 76
438amnonhigher in kindergarten compared to primary and middle school kids ( high in age 3-6 compared to age 8-12 age 13-14 in homo sapiens feces china )2018-12-30v4No1 / 76
133amnonhigher in healthy babies (<1yr) compared to acute respiratory illness ( high in control compared to acute respiratory illness respiratory system disease in homo sapiens infant nasopharynx australia )2017-04-16v4No1 / 80
108amnonincreases during fasting in nile tilapia colon ( high in fasting late timepoints compared to early timepoints in research facility texas united states of america colon oreochromis niloticus nile tilapia )2017-04-07v4No1 / 81
361amnoncommon leaf, austria, greenhouse, plant, beaucarnea recurvata2018-08-21v4No1 / 81
114amnoncommon rana pipiens, northern leopard frog, research facility, digesta, intestine, state of wisconsin, united states of america, tadpole2017-04-10v4No1 / 84
353amnoncommon in captive Triturus cristatus newts skin (common newt, adult, skin, cambridgeshire, triturus cristatus, research facility, united kingdom)2018-07-30v4No1 / 84
513amnoncommon waste water, hospital, city, xinxiang city prefecture, china2019-03-25v4No1 / 86
530amnoncommon snake, feces, snake farm, farm, adula, hunan province, ptyas mucosa, oriental ratsnake, china2019-07-21v4No1 / 86
530amnoncommon snake, feces, snake farm, farm, adula, hunan province, naja atra, chinese cobra, china2019-07-21v4No1 / 90
471amnoncommon digestive system, frog, osteopilus septentrionalis, research facility, united states of america, adult, state of florida2019-01-14v4No1 / 94
427amnonlower in salamanders kept at 20C compared to 10C ( high in temp 10c compared to temp 20c in united states of america eastern red backed salamander plethodon cinereus salamander feces commonwealth of virginia )2018-12-08v4No1 / 95
492amnoncommon brazil, skin, adult, rhinella icterica, toad, yellow cururu toad2019-02-27v4No1 / 95
536amnoncommon snake, skin, united states of america, southern united states, fossorial snake, storeria dekayi, ground snake2019-07-28v4No1 / 101
499amnoncommon brazil, pond, digestive system, intestine, dendropsophus minutus, frog, tadpole2019-03-05v4No1 / 102
108amnon high in colon compared to caecum in research facility texas united states of america oreochromis niloticus nile tilapia 2017-04-07v4No1 / 103
301amnoncommon canis lupus familiaris, dog, united states of america, colon2018-03-05v4No1 / 105
273amnon high in age age one month compared to age one week in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 107
256amnonhigher in control diet compared to diet enriched with sucram in pig gut ( high in diet standard feed compared to sucram in gastrointestinal system sus scrofa pig united kingdom )2017-11-26v4No1 / 109
353amnonhigher in captive compared to wild caught Lissotriton vulgaris newts skin ( high in research facility compared to wild in newt adult skin cambridgeshire lissotriton vulgaris united kingdom )2018-07-30v4No1 / 110
536amnoncommon snake, skin, united states of america, southern united states, thamnophis sirtalis, common garter snake2019-07-28v4No1 / 110
539amnon high in early timepoint days 1-15 aerobic fermentation compared to late timepoint days 30-60 anaerobic fermentation in ethiopia ensete ventricosum ethiopian banana food (fermented) 2019-07-31v4No1 / 110
536amnoncommon snake, skin, united states of america, southern united states, aquatic snake, nerodia sipedon, northern water snake2019-07-28v4No1 / 111
269amnoncommon in fresh yao meat food (common china, foodon product type)2018-01-09v4No1 / 113
567amnon high in control compared to sinusitis chronic rhinosinusitis in nasopharynx belgium adult homo sapiens 2019-12-05v4No1 / 114
48amnonhigher in 3 months compared to 1 week in infant hypopharynx ( high in age age 3 months compared to age 1 week in homo sapiens kingdom of denmark hypopharynx infant )2017-01-19v4No1 / 117
315amnonlower in frog pond water compared to frog gut ( high in quasipaa spinosa giant spiny frog frog compared to water fresh water in hunan province jiangxi province china )2018-04-10v4No1 / 119
539amnon high in ensete ventricosum var. gena compared to ensete ventricosum var. ketishe in ethiopia ensete ventricosum ethiopian banana late timepoint days 30-60 anaerobic fermentation food (fermented) 2019-07-31v4No1 / 123
108amnoncommon research facility, texas, united states of america, colon, anaxyrus terrestris, southern toad2017-04-07v4No1 / 132
353amnonhigher in captive compared to wild caught Lissotriton vulgaris newts skin ( high in research facility compared to wild in newt adult skin cambridgeshire triturus cristatus united kingdom )2018-07-30v4No1 / 135
315amnoncommon in frog gut (common hunan province, jiangxi province, quasipaa spinosa, giant spiny frog, frog, colon, digestive system, china)2018-04-10v4No1 / 138
255amnoncommon in fish feed (common united states of america, state of minnesota, research facility, fish feed)2017-11-24v4No1 / 141
471amnoncommon digestive system, frog, osteopilus septentrionalis, research facility, united states of america, tadpole, state of florida2019-01-14v4No1 / 147
53amnonhigher in sewer and wastewater influent comapred to feces in low income south america ( high in sewer wastewater treatment plant compared to feces in south america city low income )2017-01-21v4No1 / 148
539amnoncommon ethiopia, ensete ventricosum, ethiopian banana, late timepoint, days 30-60, anaerobic fermentation, food (fermented)2019-07-31v4No1 / 161
337amnonhigher in manhattan compared to queens in feces of house mice from new york city ( high in manhatten region compared to queens region in mus musculus house mice mouse new york city united states of america city )2018-05-18v4No1 / 162
322amnon high in adult compared to tadpole in frog osteopilus septentrionalis united states of america state of florida research facility digestive system 2018-04-23v4No1 / 163
462amnon high in populus deltoides compared to populus trichocarpa x deltoides in united states of america state of tennessee populus tree stem cultivated environment 2019-01-13v4No1 / 166
499amnoncommon brazil, pond, digestive system, intestine, scinax fuscovarius, frog, tadpole2019-03-05v4No1 / 176
530amnoncommon snake, deinagkistrodon acutus, pit viper, feces, snake farm, farm, adula, hunan province, china2019-07-21v4No1 / 178
396amnon high in common carp cyprinus carpio compared to rainbow trout oncorhynchus mykiss in fish england intestine digestive system 2018-11-14v4No1 / 184
536amnoncommon snake, skin, united states of america, southern united states, pantherophis obsoletus, black rat snake, arboreal snake2019-07-28v4No1 / 184
567amnon high in control compared to chronic rhinosinusitis sinusitis in pair of nares anterior naris belgium adult homo sapiens 2019-12-05v4No1 / 191
438amnonlower in centenarians compared to adults ( high in age 30-50 age 60-79 compared to age >94 in homo sapiens feces china )2018-12-30v4No1 / 203
520amnonhigher in gastric cancer compared to paired normal tissue ( high in gastric carcinoma stomach neoplasm compared to control in homo sapiens zhejiang province stomach adult china )2019-06-26v3No1 / 214
499amnoncommon brazil, pond, water, pond water, fresh water2019-03-05v4No1 / 228
331amnon high in dry season compared to wet season in feces monkey theropithecus gelada ethiopia 2018-05-13v4No1 / 232
349amnoncommon rattus, rat, feces, research facility, sprague dawley, male, china2018-07-29v4No1 / 235
492amnoncommon skin, adult, rana catesbeiana, bullfrog, lithobates catesbeianus, frog, japan2019-02-27v4No1 / 236
536amnoncommon snake, skin, united states of america, southern united states, agkistrodon contortrix, copperhead snake2019-07-28v4No1 / 236
404amnon high in medellin metropolitan area bogota compared to municipality of santiago de cali bucaramanga barranquilla in homo sapiens feces adult colombia city 2018-11-20v4No1 / 237
434amnonlower in antibiotics treated rats compared to controls ( high in control compared to antibiotic neomycin ampicillin in rat rattus norvegicus sprague dawley feces caecum research facility switzerland )2018-12-20v4No1 / 238
434amnoncommon rat, rattus norvegicus, sprague dawley, feces, caecum, research facility, switzerland2018-12-20v4No1 / 238
161amnoncommon in barn swallows in colorado (common hirundo rustica, feces, united states of america, colorado, barn swallow)2017-07-12v4No1 / 245
219amnoncommon in mother mice feces (common mus musculus, mouse, feces, c57bl/6, research facility, female, south korea)2017-10-24v4No1 / 250
499amnoncommon brazil, pond, digestive system, intestine, astyanax paranae, fish, astyanax2019-03-05v4No1 / 273
160amnoncommon in river water upstream of WTP effluent in spring in china (common river, water, spring, china)2017-07-12v4No1 / 278
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 288
499amnoncommon brazil, pond, poecilia reticulata, digestive system, intestine, fish, guppy2019-03-05v4No1 / 308
510amnoncommon kingdom of spain, water, estuary, estuary water, fresh water, salinity <5 ppt, bilbao2019-03-20v4No1 / 317
471amnon high in adult compared to tadpole in digestive system frog osteopilus septentrionalis research facility united states of america state of florida 2019-01-14v4No1 / 328
341amnonhigher in fresh drinking water compared to week old water ( high in fresh water compared to stagnant water in water drinking water united states of america tap water state of illinois )2018-05-28v4No1 / 365
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
160amnoncommon in river water upstream of WTP effluent in autumn in china (common river, water, autumn, china)2017-07-12v4No1 / 376
400amnonhigher in people from thailand compared to 2nd generation immigrants to usa ( high in thailand rural community compared to united states of america in homo sapiens feces )2018-11-18v4No1 / 378
256amnoncommon sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 380
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
160amnoncommon in wastewater treatment plant effluent in autumn in china (common autumn, wastewater treatment plant, effluent, china)2017-07-12v4No1 / 469
462amnon high in stem compared to leaf in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 477
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in kingdom of spain water estuary estuary water bilbao 2019-03-20v4No1 / 592
518amnonhigher in end of experiment (older steers) ( high in days 14-28 compared to days 1-2 in bos taurus cow feces united states of america state of georgia post-weaning angus steer )2019-06-11v4No1 / 609
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in homo sapiens feces china )2018-12-30v4No1 / 617
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 752
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014
304amnoncommon united states of america, state of california, beach, pacific ocean, water, sea water, san francisco bay2018-03-12v4No1 / 1166
252amnoncommon in river sand biofilm (common river, biofilm, kingdom of spain, sand)2017-11-22v4No1 / 1181
40amnoncommon soil, field soil, nicotiana tabacum, rhizosphere, china2016-12-09v4No1 / 1420
507amnonhigher in mine tailing contaminated sediment compared to uncontaminated control ( high in contaminated sediment compared to control in lake sediment sediment canada quesnel lake province of british columbia )2019-03-17v4No1 / 1681
155amnonlower in tightly bound root soil compared to loose soil and bulk soil ( high in bulk soil compared to root in triticum aestivum wheat soil china )2017-07-02v4No1 / 2933

Problems / suggestions? Please email info AT dbbact DOT org