Search result for sequence:
TACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTCTGTCAAGTCGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCCGAAACTGGCAGGCTAGAGTCTTGTAGAGGGGGGTAGAATTCCAGG
common ontology terms
term enrichment score
TermScore
digestive system0.190476
united states of america0.188106
feces0.178524
skin0.178458
snake0.176991
frog0.168067
intestine0.151899
china0.149211
adult0.143577
farm0.140380
pond0.139241
homo sapiens0.131751
research facility0.123119
hunan province0.103448
brazil0.101266
southern united states0.098160
ethiopia0.098160
osteopilus septentrionalis0.088889
snake farm0.086957
adula0.086957
ensete ventricosum0.086957
ethiopian banana0.086957
water0.081081
caecum0.077419
tadpole0.075472
colon0.073171
state of florida0.070175
food (fermented)0.068966
united kingdom0.068966
infant0.068376
fish0.064516
turtle farm0.063694
hainan autonomous prefecture0.061728
texas0.059880
kingdom of spain0.059289
city0.058997
fresh water0.055970
child0.053957
rana pipiens0.051613
northern leopard frog0.051613
red-eared slider turtle0.051613
trachemys scripta elegans0.051613
days 30-600.051613
anaerobic fermentation0.051613
digesta0.050314
state of wisconsin0.050314
kingdom of denmark0.049689
late timepoint0.049080
sprague dawley0.048485
pig0.048485
sus scrofa0.048485
state of california0.046422
rat0.045714
control0.044944
canada0.039604
clostridium difficile intestinal infectious disease0.039474
LOWER IN tadpole0.039474
fossorial snake0.039216
aerobic fermentation0.039216
days 1-150.039216
state of minnesota0.039216
nile tilapia0.039216
cambridgeshire0.039216
wastewater treatment plant0.039216
diarrhea0.038961
pond water0.038835
oreochromis niloticus0.038462
newt0.038462
gallus gallus0.037736
chicken0.037736
early timepoint0.037736
duodenum0.037383
ileum0.037383
rural community0.037383
japan0.036697
switzerland0.036364
river0.036364
age0.036145
rattus norvegicus0.034483
dog0.032787
canis lupus familiaris0.030769
mouse0.026667
age 3 days0.026490
cleanroom0.026490
elaphe carinata0.026490
king ratsnake0.026490
naja atra0.026490
chinese cobra0.026490
scinax fuscovarius0.026490
astyanax paranae0.026490
astyanax0.026490
ptyas mucosa0.026490
oriental ratsnake0.026490
storeria dekayi0.026490
ground snake0.026490
anaxyrus terrestris0.026490
southern toad0.026490
lithobates catesbeianus0.026490
ursus arctos0.026490
brown bear0.026490
Fraction of dbbact annotations with this term covered by the query
TermScore
pond1.000000
caecum0.750000
frog0.714286
snake0.666667
osteopilus septentrionalis0.666667
canada0.666667
clostridium difficile intestinal infectious disease0.600000
LOWER IN tadpole0.600000
rana pipiens0.500000
northern leopard frog0.500000
age 3 days0.500000
cleanroom0.500000
urbanus teleus0.500000
snake farm0.500000
adula0.500000
elaphe carinata0.500000
king ratsnake0.500000
red-eared slider turtle0.500000
trachemys scripta elegans0.500000
turtle farm0.500000
anoplophora glabripennis0.500000
naja atra0.500000
chinese cobra0.500000
scinax fuscovarius0.500000
tadpole0.500000
astyanax paranae0.500000
astyanax0.500000
LOWER IN schizophrenia0.500000
ptyas mucosa0.500000
oriental ratsnake0.500000
southern united states0.500000
fossorial snake0.500000
storeria dekayi0.500000
ground snake0.500000
anaxyrus terrestris0.500000
southern toad0.500000
inflammatory bowel disease0.500000
lithobates catesbeianus0.500000
liolaemus ruibali0.500000
ursus arctos0.500000
brown bear0.500000
poecilia reticulata0.500000
guppy0.500000
age 0 days0.500000
neonate stage0.500000
age one month0.500000
age one week0.500000
ethiopia0.500000
ensete ventricosum0.500000
ethiopian banana0.500000
aerobic fermentation0.500000
days 1-150.500000
state of minnesota0.500000
days 30-600.500000
anaerobic fermentation0.500000
andrias japonicus0.500000
japanese giant salamander0.500000
LOWER IN amphibian larval stage0.500000
LOWER IN non c. diff diarrhea0.500000
ranatra0.500000
water stick-insect0.500000
carphophis amoenus0.500000
worm snake0.500000
LOWER IN age 28 days0.500000
peponocephala electra0.500000
stenella attenuata0.500000
trigona hyalinata0.500000
nile tilapia0.500000
cyprinus carpio0.500000
common carp0.500000
england0.500000
przewalski horse0.500000
LOWER IN zoo0.500000
area designated as a nature reserve0.500000
coluber constrictor0.500000
eastern racer snake0.500000
ensete ventricosum var. gena0.500000
LOWER IN ensete ventricosum var. maze0.500000
LOWER IN vaccination0.500000
LOWER IN salmune vaccination0.500000
age 3-60.500000
LOWER IN age 8-120.500000
LOWER IN age 13-140.500000
LOWER IN acute respiratory illness0.500000
beaucarnea recurvata0.500000
cambridgeshire0.500000
triturus cristatus0.500000
waste water0.500000
xinxiang city prefecture0.500000
eastern red backed salamander0.500000
plethodon cinereus0.500000
LOWER IN temp 20c0.500000
temp 10c0.500000
rhinella icterica0.500000
yellow cururu toad0.500000
LOWER IN age one week0.500000
LOWER IN sucram0.500000
standard feed0.500000
lissotriton vulgaris0.500000
thamnophis sirtalis0.500000
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.340136
feces0.299320
china0.190476
research facility0.183673
homo sapiens0.176871
adult0.156463
digestive system0.142857
skin0.136054
intestine0.122449
farm0.115646
snake0.102041
frog0.095238
brazil0.081633
pond0.074830
hunan province0.061224
water0.061224
southern united states0.054422
ethiopia0.054422
snake farm0.047619
adula0.047619
control0.047619
colon0.047619
ensete ventricosum0.047619
ethiopian banana0.047619
food (fermented)0.047619
osteopilus septentrionalis0.047619
state of florida0.047619
caecum0.040816
tadpole0.040816
fish0.040816
infant0.040816
united kingdom0.040816
kingdom of spain0.034014
turtle farm0.034014
hainan autonomous prefecture0.034014
texas0.034014
child0.034014
fresh water0.034014
city0.034014
rana pipiens0.027211
northern leopard frog0.027211
digesta0.027211
state of wisconsin0.027211
state of california0.027211
red-eared slider turtle0.027211
trachemys scripta elegans0.027211
rat0.027211
sprague dawley0.027211
kingdom of denmark0.027211
late timepoint0.027211
days 30-600.027211
anaerobic fermentation0.027211
pig0.027211
sus scrofa0.027211
gallus gallus0.020408
chicken0.020408
canis lupus familiaris0.020408
dog0.020408
duodenum0.020408
ileum0.020408
fossorial snake0.020408
LOWER IN control0.020408
rattus norvegicus0.020408
switzerland0.020408
pond water0.020408
diarrhea0.020408
early timepoint0.020408
aerobic fermentation0.020408
days 1-150.020408
clostridium difficile intestinal infectious disease0.020408
state of minnesota0.020408
LOWER IN tadpole0.020408
japan0.020408
mus musculus0.020408
mouse0.020408
age0.020408
oreochromis niloticus0.020408
nile tilapia0.020408
newt0.020408
cambridgeshire0.020408
wastewater treatment plant0.020408
river0.020408
canada0.020408
rural community0.020408
broiler chicken0.013605
age 3 days0.013605
floor0.013605
dust0.013605
cleanroom0.013605
elaphe carinata0.013605
king ratsnake0.013605
age 3-5 weeks0.013605
naja atra0.013605
chinese cobra0.013605
scinax fuscovarius0.013605
astyanax paranae0.013605
astyanax0.013605
ptyas mucosa0.013605
oriental ratsnake0.013605
storeria dekayi0.013605
Exp. ID User ID Description Date Region Flag Sequences
114amnondominant rana pipiens, northern leopard frog, adult, research facility, digesta, intestine, state of wisconsin, united states of america2017-04-10v4No1 / 1
495amnoncommon gallus gallus, chicken, caecum, broiler chicken, age 3 days, kingdom of spain, farm2019-03-03v4No1 / 4
308amnonhigh freq. in spacecraft assembly cleanroom floor (dominant united states of america, state of california, floor, dust, cleanroom)2018-03-31v4No1 / 5
501amnondominant costa rica, butterfly, digestive system, urbanus teleus2019-03-08v4No1 / 8
301amnondominant canis lupus familiaris, dog, united states of america, duodenum2018-03-05v4No1 / 9
177amnonblooming bacteria (grows in storage at room temp.) (contamination)2017-07-30v4No1 / 10
530amnondominant snake, feces, snake farm, farm, adula, hunan province, elaphe carinata, king ratsnake, china2019-07-21v4No1 / 10
590amnondominant china, red-eared slider turtle, trachemys scripta elegans, age 3-5 weeks, intestine, turtle farm, farm, hainan autonomous prefecture2020-02-10v4No1 / 11
301amnondominant canis lupus familiaris, dog, united states of america, ileum2018-03-05v4No1 / 12
495amnondominant gallus gallus, chicken, caecum, broiler chicken, age 3 days, kingdom of spain, farm2019-03-03v4No1 / 12
243amnondominant beetle, anoplophora glabripennis, digestive system, united states of america2017-11-15v4No1 / 13
530amnondominant snake, feces, snake farm, farm, adula, hunan province, naja atra, chinese cobra, china2019-07-21v4No1 / 13
499amnondominant brazil, pond, digestive system, intestine, scinax fuscovarius, frog, tadpole2019-03-05v4No1 / 14
499amnondominant brazil, pond, digestive system, intestine, astyanax paranae, fish, astyanax2019-03-05v4No1 / 14
502amnon high in control compared to schizophrenia in homo sapiens feces adult united states of america 2019-03-12v4No1 / 14
530amnondominant snake, feces, snake farm, farm, adula, hunan province, ptyas mucosa, oriental ratsnake, china2019-07-21v4No1 / 14
536amnondominant snake, skin, united states of america, southern united states, fossorial snake, storeria dekayi, ground snake2019-07-28v4No1 / 15
108amnondominant research facility, texas, united states of america, colon, anaxyrus terrestris, southern toad2017-04-07v4No1 / 16
395amnonhigher in kids with ibd compared to healthy donors ( high in child ulcerative colitis inflammatory bowel disease crohn's disease compared to control in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 16
434amnon high in fructose diet fructose compared to control diet in rat rattus norvegicus sprague dawley feces caecum research facility switzerland 2018-12-20v4No1 / 16
492amnondominant skin, adult, rana catesbeiana, lithobates catesbeianus, bullfrog, brazil, frog2019-02-27v4No1 / 16
499amnondominant brazil, pond, water, pond water, fresh water2019-03-05v4No1 / 16
71amnondominant liolaemus ruibali, argentina, research facility, feces2017-02-25v4No1 / 17
387amnon high in winter compared to summer in ursus arctos brown bear feces sweden wild 2018-11-03v4No1 / 17
499amnondominant brazil, pond, poecilia reticulata, digestive system, intestine, fish, guppy2019-03-05v4No1 / 17
590amnondominant china, turtle farm, farm, hainan autonomous prefecture, intestine, red-eared slider turtle, trachemys scripta elegans, age 0 days, neonate stage2020-02-10v4No1 / 17
207amnonhigh freq. in people hospitalized with diarrhea (dominant homo sapiens, israel, feces, diarrhea)2017-10-05v4No1 / 18
273amnondominant feces, homo sapiens, kingdom of denmark, infant, age one month2018-01-14v4No1 / 18
387amnonhigh freq. in feces of wild brown bear (dominant ursus arctos, brown bear, feces, sweden, wild)2018-11-03v4No1 / 18
516amnondominant homo sapiens, feces, united states of america, state of ohio, adult2019-05-29v4No1 / 19
273amnondominant feces, homo sapiens, kingdom of denmark, infant, age one week2018-01-14v4No1 / 20
284amnondominant homo sapiens, female, feces, state of california, infant, age 2 months2018-01-27v4No1 / 20
539amnondominant ethiopia, ensete ventricosum, ethiopian banana, early timepoint, aerobic fermentation, days 1-15, food (fermented)2019-07-31v4No1 / 20
94amnondominant homo sapiens, clostridium difficile intestinal infectious disease, feces, state of michigan, diarrhea2017-03-12v4No1 / 22
185amnonhigh freq. in patients with c. diff infection before treatment (dominant homo sapiens, feces, united states of america, state of minnesota, clostridium difficile intestinal infectious disease)2017-08-20v4No1 / 22
308amnoncommon in spacecraft assembly cleanroom floor (common united states of america, state of california, floor, dust, cleanroom)2018-03-31v4No1 / 23
539amnondominant ethiopia, ensete ventricosum, ethiopian banana, late timepoint, days 30-60, anaerobic fermentation, food (fermented)2019-07-31v4No1 / 23
322amnondominant frog, osteopilus septentrionalis, united states of america, state of florida, research facility, adult, digestive system2018-04-23v4No1 / 24
338amnon high in adult compared to tadpole amphibian larval stage larval stage in andrias japonicus japanese giant salamander skin japan 2018-05-21v4No1 / 24
390amnonhigher in patients with c. diff diarrhea compared to non-c. diff diarrhea ( high in clostridium difficile intestinal infectious disease compared to non c. diff diarrhea in homo sapiens feces australia hospital diarrhea )2018-11-04v4No1 / 24
471amnondominant digestive system, frog, osteopilus septentrionalis, research facility, united states of america, adult, state of florida2019-01-14v4No1 / 24
114amnondominant rana pipiens, northern leopard frog, research facility, digesta, intestine, state of wisconsin, united states of america, tadpole2017-04-10v4No1 / 26
499amnoncommon ranatra, water stick-insect, brazil, pond, digestive system, intestine2019-03-05v4No1 / 26
590amnoncommon china, turtle farm, farm, hainan autonomous prefecture, intestine, red-eared slider turtle, trachemys scripta elegans, age 0 days, neonate stage2020-02-10v4No1 / 29
536amnoncommon snake, skin, united states of america, southern united states, carphophis amoenus, worm snake, fossorial snake2019-07-28v4No1 / 35
539amnoncommon ethiopia, ensete ventricosum, ethiopian banana, early timepoint, aerobic fermentation, days 1-15, food (fermented)2019-07-31v4No1 / 35
219amnonhigher in pre-weaning compared to post-weaning in mouse feces ( high in age age 21 days breast milk compared to age 28 days mouse chow in mus musculus mouse feces c57bl/6 male research facility south korea )2017-10-24v4No1 / 36
79amnoncommon peponocephala electra, skin, united states of america2017-03-03v4No1 / 40
79amnoncommon skin, united states of america, stenella attenuata2017-03-03v4No1 / 40
60amnoncommon anser cygnoides, feces, china2017-02-03v4No1 / 42
59amnoncommon trigona hyalinata, digestive system2017-02-02v4No1 / 43
108amnoncommon research facility, texas, united states of america, colon, oreochromis niloticus, nile tilapia2017-04-07v4No1 / 43
396amnoncommon fish, cyprinus carpio, common carp, england, intestine, digestive system2018-11-14v4No1 / 45
406amnoncommon feces, equus przewalskii, przewalski horse, zoological garden, united states of america2018-11-21v4No1 / 50
338amnonhigher in wild salamanders compared to zoo grown salamanders ( high in pond area designated as a nature reserve compared to zoological garden zoo in andrias japonicus japanese giant salamander skin japan )2018-05-21v4No1 / 51
530amnoncommon snake, feces, snake farm, farm, adula, hunan province, elaphe carinata, king ratsnake, china2019-07-21v4No1 / 63
536amnoncommon snake, skin, united states of america, southern united states, coluber constrictor, eastern racer snake2019-07-28v4No1 / 64
539amnon high in ensete ventricosum var. gena compared to ensete ventricosum var. maze in ethiopia ensete ventricosum ethiopian banana late timepoint days 30-60 anaerobic fermentation food (fermented) 2019-07-31v4No1 / 65
114amnoncommon rana pipiens, northern leopard frog, adult, research facility, digesta, intestine, state of wisconsin, united states of america2017-04-10v4No1 / 72
127amnonhigher in non-vaccinated chickens ( high in control compared to vaccination salmune vaccination in gallus gallus chicken united states of america caecum )2017-04-14v4No1 / 72
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, skin, nipple, adult2018-11-04v4No1 / 72
322amnoncommon frog, osteopilus septentrionalis, united states of america, state of florida, research facility, adult, digestive system2018-04-23v4No1 / 76
438amnonhigher in kindergarten compared to primary and middle school kids ( high in age 3-6 compared to age 8-12 age 13-14 in homo sapiens feces china )2018-12-30v4No1 / 76
133amnonhigher in healthy babies (<1yr) compared to acute respiratory illness ( high in control compared to acute respiratory illness respiratory system disease in homo sapiens infant nasopharynx australia )2017-04-16v4No1 / 80
108amnonincreases during fasting in nile tilapia colon ( high in fasting late timepoints compared to early timepoints in research facility texas united states of america colon oreochromis niloticus nile tilapia )2017-04-07v4No1 / 81
361amnoncommon leaf, austria, greenhouse, plant, beaucarnea recurvata2018-08-21v4No1 / 81
590amnoncommon china, red-eared slider turtle, trachemys scripta elegans, age 3-5 weeks, intestine, turtle farm, farm, hainan autonomous prefecture2020-02-10v4No1 / 83
114amnoncommon rana pipiens, northern leopard frog, research facility, digesta, intestine, state of wisconsin, united states of america, tadpole2017-04-10v4No1 / 84
353amnoncommon in captive Triturus cristatus newts skin (common newt, adult, skin, cambridgeshire, triturus cristatus, research facility, united kingdom)2018-07-30v4No1 / 84
513amnoncommon waste water, hospital, city, xinxiang city prefecture, china2019-03-25v4No1 / 86
530amnoncommon snake, feces, snake farm, farm, adula, hunan province, ptyas mucosa, oriental ratsnake, china2019-07-21v4No1 / 86
530amnoncommon snake, feces, snake farm, farm, adula, hunan province, naja atra, chinese cobra, china2019-07-21v4No1 / 90
471amnoncommon digestive system, frog, osteopilus septentrionalis, research facility, united states of america, adult, state of florida2019-01-14v4No1 / 94
427amnonlower in salamanders kept at 20C compared to 10C ( high in temp 10c compared to temp 20c in united states of america eastern red backed salamander plethodon cinereus salamander feces commonwealth of virginia )2018-12-08v4No1 / 95
492amnoncommon brazil, skin, adult, rhinella icterica, toad, yellow cururu toad2019-02-27v4No1 / 95
536amnoncommon snake, skin, united states of america, southern united states, fossorial snake, storeria dekayi, ground snake2019-07-28v4No1 / 101
499amnoncommon brazil, pond, digestive system, intestine, dendropsophus minutus, frog, tadpole2019-03-05v4No1 / 102
108amnon high in colon compared to caecum in research facility texas united states of america oreochromis niloticus nile tilapia 2017-04-07v4No1 / 103
301amnoncommon canis lupus familiaris, dog, united states of america, colon2018-03-05v4No1 / 105
273amnon high in age age one month compared to age one week in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 107
256amnonhigher in control diet compared to diet enriched with sucram in pig gut ( high in diet standard feed compared to sucram in gastrointestinal system sus scrofa pig united kingdom )2017-11-26v4No1 / 109
353amnonhigher in captive compared to wild caught Lissotriton vulgaris newts skin ( high in research facility compared to wild in newt adult skin cambridgeshire lissotriton vulgaris united kingdom )2018-07-30v4No1 / 110
536amnoncommon snake, skin, united states of america, southern united states, thamnophis sirtalis, common garter snake2019-07-28v4No1 / 110
539amnon high in early timepoint days 1-15 aerobic fermentation compared to late timepoint days 30-60 anaerobic fermentation in ethiopia ensete ventricosum ethiopian banana food (fermented) 2019-07-31v4No1 / 110
536amnoncommon snake, skin, united states of america, southern united states, aquatic snake, nerodia sipedon, northern water snake2019-07-28v4No1 / 111
269amnoncommon in fresh yao meat food (common china, foodon product type)2018-01-09v4No1 / 113
567amnon high in control compared to chronic rhinosinusitis sinusitis in homo sapiens adult belgium nasopharynx 2019-12-05v4No1 / 114
48amnonhigher in 3 months compared to 1 week in infant hypopharynx ( high in age age 3 months compared to age 1 week in homo sapiens kingdom of denmark hypopharynx infant )2017-01-19v4No1 / 117
315amnonlower in frog pond water compared to frog gut ( high in quasipaa spinosa giant spiny frog frog compared to water fresh water in hunan province jiangxi province china )2018-04-10v4No1 / 119
539amnon high in ensete ventricosum var. gena compared to ensete ventricosum var. ketishe in ethiopia ensete ventricosum ethiopian banana late timepoint days 30-60 anaerobic fermentation food (fermented) 2019-07-31v4No1 / 123
590amnoncommon in turtle pond water (common china, turtle farm, farm, hainan autonomous prefecture, pond water, water)2020-02-10v4No1 / 127
625amnoncommon emperor tamarin, saguinus imperator, state of minnesota, como zoo, united states of america, zoological garden, feces2020-05-16v4No1 / 132
108amnoncommon research facility, texas, united states of america, colon, anaxyrus terrestris, southern toad2017-04-07v4No1 / 132
353amnonhigher in captive compared to wild caught Lissotriton vulgaris newts skin ( high in research facility compared to wild in newt adult skin cambridgeshire triturus cristatus united kingdom )2018-07-30v4No1 / 135
315amnoncommon in frog gut (common hunan province, jiangxi province, quasipaa spinosa, giant spiny frog, frog, colon, digestive system, china)2018-04-10v4No1 / 138
255amnoncommon in fish feed (common united states of america, state of minnesota, research facility, fish feed)2017-11-24v4No1 / 141
471amnoncommon digestive system, frog, osteopilus septentrionalis, research facility, united states of america, tadpole, state of florida2019-01-14v4No1 / 147
53amnonhigher in sewer and wastewater influent comapred to feces in low income south america ( high in sewer wastewater treatment plant compared to feces in south america city low income )2017-01-21v4No1 / 148
539amnoncommon ethiopia, ensete ventricosum, ethiopian banana, late timepoint, days 30-60, anaerobic fermentation, food (fermented)2019-07-31v4No1 / 161
337amnonhigher in manhattan compared to queens in feces of house mice from new york city ( high in manhatten region compared to queens region in mus musculus house mice mouse new york city united states of america city )2018-05-18v4No1 / 162
322amnon high in adult compared to tadpole in frog osteopilus septentrionalis united states of america state of florida research facility digestive system 2018-04-23v4No1 / 163
462amnon high in populus deltoides compared to populus trichocarpa x deltoides in united states of america state of tennessee populus tree stem cultivated environment 2019-01-13v4No1 / 166
499amnoncommon brazil, pond, digestive system, intestine, scinax fuscovarius, frog, tadpole2019-03-05v4No1 / 176
530amnoncommon snake, deinagkistrodon acutus, pit viper, feces, snake farm, farm, adula, hunan province, china2019-07-21v4No1 / 178
396amnon high in common carp cyprinus carpio compared to rainbow trout oncorhynchus mykiss in fish england intestine digestive system 2018-11-14v4No1 / 184
536amnoncommon snake, skin, united states of america, southern united states, pantherophis obsoletus, black rat snake, arboreal snake2019-07-28v4No1 / 184
567amnon high in control compared to sinusitis chronic rhinosinusitis in homo sapiens adult belgium anterior naris pair of nares 2019-12-05v4No1 / 191
438amnonlower in centenarians compared to adults ( high in age 30-50 age 60-79 compared to age >94 in homo sapiens feces china )2018-12-30v4No1 / 203
520amnonhigher in gastric cancer compared to paired normal tissue ( high in gastric carcinoma stomach neoplasm compared to control in homo sapiens zhejiang province stomach adult china )2019-06-26v3No1 / 214
499amnoncommon brazil, pond, water, pond water, fresh water2019-03-05v4No1 / 228
331amnon high in dry season compared to wet season in feces monkey theropithecus gelada ethiopia 2018-05-13v4No1 / 232
349amnoncommon rattus, rat, feces, research facility, sprague dawley, male, china2018-07-29v4No1 / 235
492amnoncommon skin, adult, rana catesbeiana, bullfrog, lithobates catesbeianus, frog, japan2019-02-27v4No1 / 236
536amnoncommon snake, skin, united states of america, southern united states, agkistrodon contortrix, copperhead snake2019-07-28v4No1 / 236
404amnon high in medellin metropolitan area bogota compared to municipality of santiago de cali bucaramanga barranquilla in homo sapiens feces adult colombia city 2018-11-20v4No1 / 237
434amnonlower in antibiotics treated rats compared to controls ( high in control compared to antibiotic neomycin ampicillin in rat rattus norvegicus sprague dawley feces caecum research facility switzerland )2018-12-20v4No1 / 238
434amnoncommon rat, rattus norvegicus, sprague dawley, feces, caecum, research facility, switzerland2018-12-20v4No1 / 238
161amnoncommon in barn swallows in colorado (common hirundo rustica, feces, united states of america, colorado, barn swallow)2017-07-12v4No1 / 245
219amnoncommon in mother mice feces (common mus musculus, mouse, feces, c57bl/6, research facility, female, south korea)2017-10-24v4No1 / 250
499amnoncommon brazil, pond, digestive system, intestine, astyanax paranae, fish, astyanax2019-03-05v4No1 / 273
160amnoncommon in river water upstream of WTP effluent in spring in china (common river, water, spring, china)2017-07-12v4No1 / 278
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 288
499amnoncommon brazil, pond, poecilia reticulata, digestive system, intestine, fish, guppy2019-03-05v4No1 / 308
510amnoncommon kingdom of spain, water, estuary, estuary water, fresh water, salinity <5 ppt, bilbao2019-03-20v4No1 / 317
618amnoncommon pre-vegetative stage, canada, farm, root, root endosphere, cannabis sativa2020-05-04v4No1 / 318
471amnon high in adult compared to tadpole in digestive system frog osteopilus septentrionalis research facility united states of america state of florida 2019-01-14v4No1 / 328
341amnonhigher in fresh drinking water compared to week old water ( high in fresh water compared to stagnant water in water drinking water united states of america tap water state of illinois )2018-05-28v4No1 / 365
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
160amnoncommon in river water upstream of WTP effluent in autumn in china (common river, water, autumn, china)2017-07-12v4No1 / 376
400amnonhigher in people from thailand compared to 2nd generation immigrants to usa ( high in thailand rural community compared to united states of america in homo sapiens feces )2018-11-18v4No1 / 378
256amnoncommon sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 380
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
160amnoncommon in wastewater treatment plant effluent in autumn in china (common autumn, wastewater treatment plant, effluent, china)2017-07-12v4No1 / 469
462amnon high in stem compared to leaf in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 477
618amnoncommon pre-vegetative stage, rhizosphere, canada, farm, cannabis sativa2020-05-04v4No1 / 530
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in kingdom of spain water estuary estuary water bilbao 2019-03-20v4No1 / 592
518amnonhigher in end of experiment (older steers) ( high in days 14-28 compared to days 1-2 in bos taurus cow feces united states of america state of georgia post-weaning angus steer )2019-06-11v4No1 / 609
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in homo sapiens feces china )2018-12-30v4No1 / 617
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 752
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014
304amnoncommon united states of america, state of california, beach, pacific ocean, water, sea water, san francisco bay2018-03-12v4No1 / 1166
252amnoncommon in river sand biofilm (common river, biofilm, kingdom of spain, sand)2017-11-22v4No1 / 1181
40amnoncommon soil, field soil, nicotiana tabacum, rhizosphere, china2016-12-09v4No1 / 1420
507amnonhigher in mine tailing contaminated sediment compared to uncontaminated control ( high in contaminated sediment compared to control in lake sediment sediment canada quesnel lake province of british columbia )2019-03-17v4No1 / 1681
155amnonlower in tightly bound root soil compared to loose soil and bulk soil ( high in bulk soil compared to root in triticum aestivum wheat soil china )2017-07-02v4No1 / 2933

Problems / suggestions? Please email info AT dbbact DOT org