Search result for sequence:
TACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTCTGTCAAGTCGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATTCGAAACTGGCAGGCTAGAGTCTTGTAGAGGGGGGTAGAATTCCAGG
common ontology terms
term enrichment score
TermScore
china0.374750
feces0.355175
homo sapiens0.326101
united states of america0.299100
adult0.216169
soil0.159206
skin0.140327
research facility0.135959
rhizosphere0.110191
digestive system0.101790
infant0.096635
body proper0.095641
state of california0.085315
whole body0.080367
female0.079130
brazil0.077912
panama0.073605
costa rica0.072890
mexico0.071889
water0.067214
desert0.063158
butterfly0.061905
child0.059918
leaf0.058373
frog0.056537
larval stage0.056537
mus musculus0.055188
cultivated environment0.054309
fresh water0.051512
mouse0.051417
city0.050049
bird0.044685
root0.043321
LOWER IN control0.042596
river0.041279
state of florida0.040615
control0.039268
india0.038863
jiangsu province0.038268
united kingdom0.037490
canis lupus familiaris0.037191
greenhouse0.036541
forest ecosystem0.035939
agave0.033776
depth (soil) 0-20cm0.033299
hospital0.031724
mucus0.031563
guanajuato0.031439
canada0.030403
caecum0.030250
dog0.030204
farm0.029579
rural community0.029273
citrus0.029091
australia0.028335
food (fermented)0.026875
heliconius erato0.026731
tropical and subtropical moist broadleaf forest biome0.026731
finch0.026731
obsolete_juvenile stage0.026731
chicken0.026495
gallus gallus0.026437
galapagos islands0.026379
kingdom of spain0.026379
germany0.025439
los angeles district0.024661
newt0.024510
guangzhou city prefecture0.024460
1-month-old human stage0.024067
hispanic0.024067
state of new york0.024067
hispanic or latin american0.023781
poland0.023687
intestine0.023162
diarrhea0.022346
cactus0.022099
ulcerative colitis0.022075
state of tennessee0.022059
crohn's disease0.022047
kingdom of denmark0.021978
argentina0.021978
liolaemus ruibali0.021978
glycine max0.021898
silt loam0.021739
sea water0.021419
pair of nares0.021352
plant0.020050
cambridgeshire0.019584
state of rhode island0.019584
reforestation0.019584
shaanxi province0.019584
robinia pseudoacacia0.019584
solanum lycopersicum0.019520
pond0.019457
orchard0.019394
ph 60.019394
loess plateau0.019394
french republic0.019347
israel0.019319
japan0.019208
Fraction of dbbact annotations with this term covered by the query
TermScore
china31.000000
mexico5.000000
diarrhea2.000000
colon1.666667
cuba1.000000
pupa1.000000
LOWER IN colon1.000000
los angeles district1.000000
LOWER IN pupa1.000000
acute pancreatitis1.000000
pancreatitis1.000000
atherosclerosis1.000000
austin1.000000
jordan1.000000
namibia1.000000
malaria1.000000
bermuda1.000000
boston1.000000
train1.000000
LOWER IN moor1.000000
schistosomiasis1.000000
urinary schistosomiasis1.000000
glasgow1.000000
atlanta1.000000
LOWER IN spring1.000000
coelomic fluid1.000000
spring1.000000
sand1.000000
central park1.000000
panama0.750000
leaf endosphere0.750000
greenhouse0.750000
urban biome0.750000
taiwan0.750000
river0.750000
hunter gatherer0.750000
mississippi river0.750000
body proper0.727273
india0.714286
hospital0.700000
butterfly0.666667
seed0.666667
cactus0.666667
2-month-old human stage0.666667
whole plant0.666667
newt0.666667
ninth decade human stage0.666667
two weeks0.666667
salamandra salamandra0.666667
beetle0.666667
apis mellifera0.666667
clostridium difficile intestinal infectious disease0.666667
rana catesbeiana0.666667
bullfrog0.666667
bombus terrestris0.666667
cebus capucinus0.666667
white-faced capuchin0.666667
high salt concentration0.666667
osteopilus septentrionalis0.666667
republic of china0.666667
oreochromis niloticus0.666667
anser cygnoides0.666667
dust0.666667
floor0.666667
nepal0.666667
toad0.666667
arm0.666667
venezuela0.666667
amerindian0.666667
particles0.666667
paddy field soil0.666667
rural community0.636364
costa rica0.625000
food (fermented)0.625000
ulcerative colitis0.625000
infant0.615385
root0.600000
wastewater treatment plant0.600000
guangzhou city prefecture0.600000
state of tennessee0.600000
depth 5cm0.600000
crohn's disease0.583333
skin0.575758
breast milk0.571429
mucus0.571429
hunan province0.571429
city0.550000
frog0.500000
eleutherodactylus atkinsi0.500000
heliconius erato0.500000
whole body0.500000
tropical and subtropical moist broadleaf forest biome0.500000
linepithema humile0.500000
argentine ant0.500000
geospiza fortis0.500000
finch0.500000
medium ground finch0.500000
low hdl0.500000
LOWER IN high hdl0.500000
age 3 days0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.327091
homo sapiens0.292135
united states of america0.244694
china0.188514
adult0.174782
soil0.103620
research facility0.089888
skin0.079900
rhizosphere0.063670
digestive system0.057428
infant0.052434
body proper0.051186
female0.049938
state of california0.047441
whole body0.043695
brazil0.042447
panama0.038702
costa rica0.038702
water0.037453
mexico0.036205
desert0.033708
butterfly0.032459
child0.032459
mus musculus0.031211
leaf0.031211
frog0.029963
larval stage0.029963
mouse0.028714
cultivated environment0.028714
fresh water0.027466
city0.026217
LOWER IN control0.026217
control0.024969
bird0.023720
root0.022472
state of florida0.021223
river0.021223
canis lupus familiaris0.019975
jiangsu province0.019975
india0.019975
depth (soil) 0-20cm0.019975
united kingdom0.019975
forest ecosystem0.018727
greenhouse0.018727
agave0.017478
farm0.016230
caecum0.016230
dog0.016230
guanajuato0.016230
hospital0.016230
mucus0.016230
canada0.016230
citrus0.014981
australia0.014981
rural community0.014981
heliconius erato0.013733
tropical and subtropical moist broadleaf forest biome0.013733
galapagos islands0.013733
finch0.013733
gallus gallus0.013733
kingdom of spain0.013733
chicken0.013733
food (fermented)0.013733
germany0.013733
obsolete_juvenile stage0.013733
intestine0.012484
poland0.012484
1-month-old human stage0.012484
hispanic or latin american0.012484
los angeles district0.012484
hispanic0.012484
newt0.012484
state of new york0.012484
guangzhou city prefecture0.012484
kingdom of denmark0.011236
cactus0.011236
glycine max0.011236
diarrhea0.011236
argentina0.011236
liolaemus ruibali0.011236
plant0.011236
ulcerative colitis0.011236
pair of nares0.011236
crohn's disease0.011236
sea water0.011236
state of tennessee0.011236
silt loam0.011236
italy0.009988
orchard0.009988
french republic0.009988
israel0.009988
cambridgeshire0.009988
japan0.009988
solanum lycopersicum0.009988
ph 60.009988
LOWER IN soil0.009988
pond0.009988
tree0.009988
state of rhode island0.009988
foodon product type0.009988
Exp. ID User ID Description Date Region Flag Sequences
492amnoncommon skin, adult, cuba, frog, eleutherodactylus atkinsi2019-02-27v4No1 / 3
118amnoncommon pupa, body proper, panama, butterfly, heliconius erato, whole body, tropical and subtropical moist broadleaf forest biome, forest ecosystem2017-04-11v4No1 / 4
182amnoncolony specific high freq. in argentine ant (other body proper, linepithema humile, argentine ant)2017-08-15v4No1 / 4
440amnoncommon feces, geospiza fortis, galapagos islands, bird, finch, medium ground finch2019-01-06v4No1 / 4
404amnonnegatively correlated with hdl levels ( high in low hdl compared to high hdl in feces homo sapiens city adult colombia )2019-01-10v4No1 / 4
495amnoncommon farm, caecum, gallus gallus, kingdom of spain, chicken, broiler chicken, age 3 days2019-03-03v4No1 / 4
184amnoncommon digestive system, peru, ants, neoponera2017-08-15v4No1 / 5
184amnoncommon digestive system, peru, ants, solenopsis2017-08-15v4No1 / 5
301amnon high in duodenum ileum compared to rectum colon in united states of america canis lupus familiaris dog 2018-03-05v4No1 / 5
399amnonhigher in clindamycin treated mice compared to controls ( high in antibiotic clindamycin compared to control in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 5
440amnoncommon feces, galapagos islands, bird, finch, green warbler-finch, certhidea olivacea2019-01-06v4No1 / 5
624sheryodominant in ryegrass rhizosphere soil amended with biochar after 30-40 days (dominant soil, rhizosphere, 10 cm depth, jiangsu province, ph 7-8, biochar, china, ryegrass, days 30-40)2020-05-11v4No1 / 5
692amnondominant brazil, fermented beverage, curitiba microregion, fermented milk2028-03-16v4No1 / 5
118amnoncommon in captive raised teneral adult butterfly (common body proper, panama, butterfly, heliconius erato, whole body, tropical and subtropical moist broadleaf forest biome, teneral adult, forest ecosystem)2017-04-11v4No1 / 6
118amnondominant pupa, body proper, panama, butterfly, heliconius erato, whole body, tropical and subtropical moist broadleaf forest biome, forest ecosystem2017-04-11v4No1 / 6
245amnondominant homo sapiens, breast milk, kingdom of spain2017-11-21v4No1 / 6
397amnondominant digestive system, intestine, panama, fungus growing ant, trachymyrmex cornetzi2018-11-14v4No1 / 6
440amnoncommon feces, galapagos islands, bird, finch, geospiza fuliginosa, small ground finch2019-01-06v4No1 / 6
501amnoncommon digestive system, costa rica, butterfly, urbanus teleus2019-03-08v4No1 / 6
501amnoncommon digestive system, costa rica, butterfly, mechanitis polymnia, orange-spotted tiger clearwing butterfly2019-03-08v4No1 / 6
118amnondominant feces, larval stage, panama, butterfly, heliconius erato, tropical and subtropical moist broadleaf forest biome, caterpillar, frass, forest ecosystem2017-04-11v4No1 / 7
182amnondominant united states of america, body proper, linepithema humile, argentine ant2017-08-15v4No1 / 7
346amnonhigh freq. in fruitfly larva grown on annona (dominant larval stage, body proper, ceratitis capitata, italy, whole body, annona cherimola, mediterranean fruit fly)2018-06-11v4No1 / 7
364amnondominant body proper, orchesella cincta, kingdom of denmark, springtail2018-08-29v4No1 / 7
415amnondominant orchard, soil, rhizosphere, citrus, cultivated environment, china2018-11-27v4No1 / 7
663amnondominant homo sapiens, lung, bronchoalveolar lavage, adult, poland2020-09-22v4No1 / 7
28amnondominant feces, terrestrial biome, hawaii, achatinella mustelina, environmental system determined by an organism2016-12-05v4No1 / 8
29amnondominant brassica oleracea, french republic, seed2016-12-05v4No1 / 8
129amnondominant rhizosphere, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid2017-04-15v4No1 / 8
332amnoncommon homo sapiens, city, infant, vellore district, india, 2-month-old human stage2018-05-14v4No1 / 8
346amnonhigh freq. in fruitfly larva grown on orange (dominant larval stage, body proper, citrus sinensis, ceratitis capitata, italy, whole body, orange, mediterranean fruit fly)2018-06-11v4No1 / 8
408amnondominant united states of america, larval stage, costa rica, crematogaster, ant2018-11-22v4No1 / 8
440amnoncommon feces, geospiza difficilis, galapagos islands, bird, finch, sharp-beaked ground finch2019-01-06v4No1 / 8
440amnondominant feces, galapagos islands, bird, finch, green warbler-finch, certhidea olivacea2019-01-06v4No1 / 8
440amnoncommon feces, galapagos islands, bird, finch, camarhynchus parvulus, small tree finch2019-01-06v4No1 / 8
501amnondominant digestive system, costa rica, butterfly, urbanus teleus2019-03-08v4No1 / 8
501amnondominant digestive system, costa rica, butterfly, anartia fatima, banded peacock butterfly2019-03-09v4No1 / 8
674amnondominant female, body proper, whole body, panama, nyssomyia trapidoi, sand fly2020-09-28v4No1 / 8
859amnon high in 1-month-old human stage compared to 6-month-old human stage in feces homo sapiens infant state of california hispanic or latin american los angeles district hispanic 2022-01-12v4No1 / 8
118amnonhigh freq. in captive raised teneral adult butterfly (dominant body proper, panama, butterfly, heliconius erato, whole body, tropical and subtropical moist broadleaf forest biome, teneral adult, forest ecosystem)2017-04-11v4No1 / 9
271amnondominant rhizosphere, glycine max, soybean, china, depth (soil) 0-20cm2018-01-09v4No1 / 9
301amnondominant united states of america, duodenum, canis lupus familiaris, dog2018-03-05v4No1 / 9
306amnonhigh freq. at whole plant corn at time 0 (dominant zea mays subsp. mays, whole plant, israel, corn)2018-03-19v4No1 / 9
332amnondominant homo sapiens, city, infant, vellore district, india, 2-month-old human stage2018-05-14v4No1 / 9
360amnondominant desert, soil, rhizosphere, mexico, guanajuato, agave, agave salmiana2018-08-21v4No1 / 9
391amnoncommon feces, hospital, infant, diarrhea, china, under-1-year-old human stage2018-11-04v4No1 / 9
423amnondominant skin, ukraine, bank vole, myodes glareolus2018-12-05v4No1 / 9
501amnondominant digestive system, costa rica, butterfly, aeria eurimedia2019-03-09v4No1 / 9
624sheryodominant in ryegrass rhizosphere soil after 30-40 days (dominant soil, rhizosphere, 10 cm depth, jiangsu province, ph 7-8, china, ryegrass, days 30-40)2020-05-11v4No1 / 9
621amnondominant body proper, australia, whole body, tick, haemaphysalis humerosa2020-05-07v1No1 / 9
10amnon high in female compared to male in feces homo sapiens toronto 2016-10-27v4No1 / 10
71amnondominant research facility, small intestine, argentina, liolaemus ruibali2017-02-25v4No1 / 10
177amnonblooming bacteria (grows in storage at room temp.) (contamination)2017-07-30v4No1 / 10
346amnoncommon in fruitfly larva grown on orange (common larval stage, body proper, citrus sinensis, ceratitis capitata, italy, whole body, orange, mediterranean fruit fly)2018-06-11v4No1 / 10
346amnonhigh freq. in fruitfly larva grown on figs (dominant larval stage, body proper, ceratitis capitata, italy, whole body, ficus carica, fig, mediterranean fruit fly)2018-06-11v4No1 / 10
353amnonhigh freq. in wild Lissotriton vulgaris newts skin (dominant skin, adult, cambridgeshire, newt, lissotriton vulgaris, united kingdom)2018-07-30v4No1 / 10
353amnonhigh freq. in wild Triturus cristatus newts skin (dominant skin, adult, cambridgeshire, newt, triturus cristatus, united kingdom)2018-07-30v4No1 / 10
360amnondominant desert, leaf, mexico, guanajuato, agave, agave tequiliana, leaf surface, cultivated environment2018-08-21v4No1 / 10
501amnoncommon digestive system, costa rica, butterfly, anartia fatima, banded peacock butterfly2019-03-09v4No1 / 10
544amnondominant united states of america, commonwealth of massachusetts, vaccinium macrocarpon, american cranberry, botanical fruit food product2019-08-04v4No1 / 10
859amnoncommon feces, homo sapiens, infant, state of california, formula fed, hispanic or latin american, los angeles district, hispanic, 1-month-old human stage2022-01-12v4No1 / 10
847amnon high in 80 year-old and over human stage ninth decade human stage compared to 25-44 year-old human stage in feces japan 2021-12-01v1No1 / 10
146amnondominant united states of america, rhizosphere, solanum lycopersicum, tomato, slit loam soil, ph 62017-04-20v4No1 / 11
391amnondominant feces, hospital, infant, diarrhea, china, under-1-year-old human stage2018-11-04v4No1 / 11
492amnondominant skin, adult, cuba, frog, eleutherodactylus atkinsi2019-02-27v4No1 / 11
501amnondominant digestive system, costa rica, butterfly, heliconius cydno, cydno longwing butterfly2019-03-08v4No1 / 11
501amnondominant digestive system, costa rica, butterfly, heliconius sara, sara longwing butterfly2019-03-09v4No1 / 11
513amnondominant city, waste water, hospital, xinxiang city prefecture, china2019-03-25v4No1 / 11
547amnondominant capsicum annuum, sichuan province, red pepper sauce, food (fermented), china2019-08-15v4No1 / 11
67amnonhigh freq. in wet processing of coffee beans (dominant coffea arabica, ecuador, wet processing)2017-02-19v4No1 / 12
71amnondominant research facility, stomach, argentina, liolaemus ruibali2017-02-25v4No1 / 12
118amnoncommon feces, larval stage, panama, butterfly, heliconius erato, tropical and subtropical moist broadleaf forest biome, caterpillar, frass, forest ecosystem2017-04-11v4No1 / 12
118amnoncommon in captive reared butterfly (common body proper, adult, panama, butterfly, heliconius erato, whole body, tropical and subtropical moist broadleaf forest biome, forest ecosystem)2017-04-11v4No1 / 12
301amnondominant united states of america, ileum, canis lupus familiaris, dog2018-03-05v4No1 / 12
360amnondominant desert, soil, rhizosphere, mexico, guanajuato, agave, agave tequiliana, cultivated environment2018-08-21v4No1 / 12
374amnondominant skin, costa rica, frog, amphibia, craugastor bransfordii, bransford’s litter frog2018-09-09v4No1 / 12
408amnondominant united states of america, larval stage, costa rica, cephalotes, ant2018-11-22v4No1 / 12
440amnondominant feces, geospiza difficilis, galapagos islands, bird, finch, sharp-beaked ground finch2019-01-06v4No1 / 12
440amnondominant feces, geospiza scandens, galapagos islands, bird, finch, common cactus finch2019-01-06v4No1 / 12
495amnondominant farm, caecum, gallus gallus, kingdom of spain, chicken, broiler chicken, age 3 days2019-03-03v4No1 / 12
501amnoncommon digestive system, costa rica, butterfly, pierella helvina, red-washed satyr butterfly2019-03-08v4No1 / 12
858amnondominant two weeks, low salt concentration, fermented vegetable food product, china, fermneted chinese cabbage, suan cai, 0%-1% salt concentration2022-01-11v4No1 / 12
847amnondominant feces, japan, 80 year-old and over human stage, ninth decade human stage2021-12-01v1No1 / 12
149amnondominant stream, larval stage, intestine, amphibian larval stage, germany, salamandra salamandra, fire salamander2017-04-24v4No1 / 13
165amnonhigh freq. in house fly larva grown on moist wheat bran (dominant digestive system, research facility, larval stage, musca domestica, house fly, china)2017-07-16v4No1 / 13
243amnondominant digestive system, united states of america, beetle, anoplophora glabripennis2017-11-15v4No1 / 13
360amnondominant desert, state of california, agave, agave deserti, root endosphere, root2018-08-21v4No1 / 13
405amnondominant feces, united states of america, research facility, mus musculus, mouse, ketogenic diet, swiss webster2018-11-20v4No1 / 13
492amnondominant skin, adult, brazil, frog, dendropsophus minutus, lesser treefrog2019-02-27v4No1 / 13
492amnondominant skin, adult, brazil, frog, lesser foam frog, scinax perereca2019-02-27v4No1 / 13
501amnoncommon digestive system, costa rica, butterfly, caligo atreus, yellow-edged giant owl butterfly2019-03-08v4No1 / 13
501amnoncommon digestive system, costa rica, butterfly, chlosyne gaudialis2019-03-09v4No1 / 13
615amnondominant leaf, brazil, endosphere, leaf endosphere, greenhouse, campinas, saccharum, sugarcane2020-04-27v4No1 / 13
669amnondominant feces, homo sapiens, infant, sweden, 2-month-old human stage2020-09-26v4No1 / 13
859amnoncommon feces, homo sapiens, infant, state of california, breast fed, hispanic or latin american, los angeles district, hispanic, 1-month-old human stage2022-01-12v4No1 / 13
859amnoncommon feces, homo sapiens, infant, state of california, breast fed, hispanic or latin american, los angeles district, hispanic, 6-month-old human stage2022-01-12v4No1 / 13
825amnon high in type i diabetes mellitus type 1 diabetes mellitus compared to control in feces homo sapiens child china hangzhou city prefecture age 6-14 years 2021-08-12v3No1 / 13
847amnondominant feces, japan, eleventh decade human stage, centenarian human stage2021-12-01v1No1 / 13
118amnoncommon in wild butterfly (common body proper, adult, panama, butterfly, heliconius erato, whole body, tropical and subtropical moist broadleaf forest biome, forest ecosystem)2017-04-11v4No1 / 14
118amnon high in adult compared to pupa shelled egg in body proper panama butterfly heliconius erato whole body tropical and subtropical moist broadleaf forest biome forest ecosystem 2017-04-11v4No1 / 14
129amnon high in rhizosphere compared to soil in mexico myrtillocactus geometrizans opuntia robusta cactus semi-arid ph 6-6.5 2017-04-15v4No1 / 14
164amnoncommon laodelphax striatellus, small brown planthopper, china2017-07-13v4No1 / 14
232amnoncommon in foot ulcer of diabetic patients (common homo sapiens, skin, foot, ulcer, australia, wound, diabetes mellitus)2017-11-05v4No1 / 14
232amnonhigh freq. in foot ulcer of diabetic patients (dominant homo sapiens, skin, foot, ulcer, australia, wound, diabetes mellitus)2017-11-05v4No1 / 14
304amnoncandidate contaminants - higher in blanks (contamination)2018-03-12v4No1 / 14
360amnondominant desert, leaf, mexico, guanajuato, agave, agave salmiana, leaf surface2018-08-21v4No1 / 14
361amnoncommon leaf, austria, plant, olea europaea, greenhouse2018-08-21v4No1 / 14
374amnondominant skin, costa rica, frog, amphibia, craugastor fitzingeri, common rain frog2018-09-09v4No1 / 14
408amnondominant united states of america, larval stage, costa rica, ant, pseudomyrmex spinicola2018-11-22v4No1 / 14
438amnondominant feces, homo sapiens, adult, jiangsu province, age >94, china, ninth decade human stage, tenth decade human stage2018-12-30v4No1 / 14
501amnoncommon digestive system, costa rica, butterfly, pseudodebis zimri2019-03-08v4No1 / 14
501amnondominant digestive system, costa rica, butterfly, chlosyne gaudialis2019-03-09v4No1 / 14
648amnon high in antibiotic metronidazole compared to control in feces united states of america canis lupus familiaris dog state of louisiana 2020-09-06v4No1 / 14
99amnondominant united states of america, mucus, skin, notophthalmus viridescens, commonwealth of virginia, newt2017-04-02v4No1 / 15
201amnonhigh freq. in decaying Saguaro cactus (dominant desert, mexico, cactus, carnegiea gigantea, saguaro, decaying)2017-10-01v4No1 / 15
201amnonhigh freq. in decaying Cardon cactus (dominant desert, mexico, cactus, decaying, pachycereus pringlei, cardon)2017-10-01v4No1 / 15
339amnondominant feces, homo sapiens, infant, india, under-1-year-old human stage2018-05-24v4No1 / 15
346amnoncommon in fruitfly larva grown on figs (common larval stage, body proper, ceratitis capitata, italy, whole body, ficus carica, fig, mediterranean fruit fly)2018-06-11v4No1 / 15
346amnoncommon in fruitfly larva grown on peach (common larval stage, body proper, prunus persica, ceratitis capitata, italy, whole body, peach, mediterranean fruit fly)2018-06-11v4No1 / 15
406amnondominant feces, zoological garden, gorilla gorilla, french republic, monkey, gorilla2018-11-21v4No1 / 15
440amnondominant feces, galapagos islands, bird, finch, camarhynchus parvulus, small tree finch2019-01-06v4No1 / 15
548amnondominant stem, brazil, minas gerais state, campos rupestres, barbacenia macrantha, stem endosphere2019-08-17v4No1 / 15
651amnondominant feces, homo sapiens, control, united states of america, adult, state of alabama2020-09-13v4No1 / 15
651amnondominant feces, homo sapiens, united states of america, adult, state of alabama, parkinson's disease2020-09-13v4No1 / 15
674amnondominant female, body proper, panama, whole body, culicoides <genus>, biting midge, culicoides helicaniae2020-09-28v4No1 / 15
674amnondominant female, body proper, whole body, panama, culex declarator, mosquito2020-09-28v4No1 / 15
19amnonhigh freq in biopsies of children (IBD study) (dominant homo sapiens, united states of america, rectum, caecum, colon, sigmoid colon, terminal ileum, biopsy, children)2016-11-14v4No1 / 16
59amnoncommon digestive system, apis mellifera2017-02-02v4No1 / 16
94amnoncommon feces, homo sapiens, state of michigan, clostridium difficile intestinal infectious disease, diarrhea2017-03-12v4No1 / 16
118amnonhigh freq. in wild butterfly (dominant body proper, adult, panama, butterfly, heliconius erato, whole body, tropical and subtropical moist broadleaf forest biome, forest ecosystem)2017-04-11v4No1 / 16
150amnonlow in healthy dogs compared to EPI dogs recieving enzyme supplementation ( high in enzyme supplementation exocrine pancreatic insufficiency compared to control in feces united states of america canis lupus familiaris dog )2017-04-26v4No1 / 16
229amnonhigh freq. in sinuses from chronic rhinosinositis patients (dominant homo sapiens, paranasal sinus, sinusoidal space, australia, sinusitis)2017-10-31v4No1 / 16
273amnoncommon feces, homo sapiens, infant, kingdom of denmark, 1-month-old human stage2018-01-14v4No1 / 16
343amnonhigh freq. in apple flowers (dominant united states of america, flower structure, malus x domestica, state of connecticut, flower, apple)2018-05-28v4No1 / 16
352amnondominant feces, homo sapiens, new delhi, india2018-07-30v4No1 / 16
408amnoncommon united states of america, larval stage, costa rica, cephalotes, ant2018-11-22v4No1 / 16
440amnondominant feces, geospiza fortis, galapagos islands, bird, finch, medium ground finch2019-01-06v4No1 / 16
492amnondominant skin, adult, rana catesbeiana, bullfrog, frog, lithobates catesbeianus, japan2019-02-27v4No1 / 16
492amnondominant skin, adult, brazil, rana catesbeiana, bullfrog, frog, lithobates catesbeianus2019-02-27v4No1 / 16
499amnondominant pond, water, fresh water, pond water, brazil2019-03-05v4No1 / 16
590amnoncommon in turtle pond water (dominant farm, water, pond water, china, hainan autonomous prefecture, turtle farm)2020-02-10v4No1 / 16
659amnondominant feces, homo sapiens, ulcerative colitis, child, acute severe colitis2020-09-19v4No1 / 16
663amnondominant homo sapiens, nasal cavity, pair of nares, adult, poland2020-09-22v4No1 / 16
683amnondominant during antibiotics treatment in feces (dominant feces, homo sapiens, united states of america, antibiotic, vancomycin, adult, state of california, metronidazole, neomycin)2028-03-04v4No1 / 16
692amnoncommon brazil, fermented beverage, curitiba microregion, fermented milk2028-03-16v4No1 / 16
738amnon high in high wellfare feed compared to standard feed in caecum gallus gallus age 1 week chicken united kingdom 2021-01-30v3No1 / 16
71amnondominant feces, research facility, argentina, liolaemus ruibali2017-02-25v4No1 / 17
199amnonhigh freq. in kitchen sink (dominant united states of america, building, urban biome, kitchen, sink)2017-10-01v4No1 / 17
212amnondominant feces, united states of america, research facility, mus musculus, obese body mass index status, mouse, db/db mouse, obesity2017-10-22v4No1 / 17
215amnonhigher in people with Roux-en-Y gastric bypass compared to controls ( high in gastric bypass compared to control in feces homo sapiens united states of america )2017-10-23v4No1 / 17
337amnonhigh freq. in feces of house mice from new york city (dominant united states of america, city, mus musculus, new york city, mouse, house mice)2018-05-18v4No1 / 17
360amnondominant desert, mexico, guanajuato, agave, agave tequiliana, root endosphere, cultivated environment, root2018-08-21v4No1 / 17
387amnon high in winter compared to summer in feces sweden wild ursus arctos brown bear 2018-11-03v4No1 / 17
408amnondominant united states of america, larval stage, costa rica, ant, pseudomyrmex nigrocinctus2018-11-22v4No1 / 17
428amnondominant feces, homo sapiens, adult, nanchang city prefecture, acute pancreatitis, pancreatitis, china2018-12-09v4No1 / 17
492amnondominant skin, adult, brazil, frog, leptodactylus latrans, lesser foam frog2019-02-27v4No1 / 17
501amnoncommon digestive system, costa rica, butterfly, heliconius sara, sara longwing butterfly2019-03-09v4No1 / 17
591amnondominant feces, homo sapiens, control, united states of america, adult, human late adulthood stage2020-02-17v4No1 / 17
602sheryocommon in rhizoshere of tomato plant roots planted in unamended potting mix (common rhizosphere, solanum lycopersicum, israel, ph 6.5, unamended, potting mix)2020-04-03v4No1 / 17
602sheryodominant in rhizoshere of tomato plant roots planted in unamended potting mix (dominant rhizosphere, solanum lycopersicum, israel, ph 6.5, unamended, potting mix)2020-04-03v4No1 / 17
674amnondominant female, body proper, whole body, panama, culex coronator, mosquito2020-09-28v4No1 / 17
674amnondominant female, body proper, whole body, panama, coquillettidia, mosquito, coquilettidia venezuelensis2020-09-28v4No1 / 17
859amnondominant feces, homo sapiens, infant, state of california, breast fed, hispanic or latin american, los angeles district, hispanic, 1-month-old human stage2022-01-12v4No1 / 17
859amnondominant feces, homo sapiens, infant, state of california, breast fed, hispanic or latin american, los angeles district, hispanic, 6-month-old human stage2022-01-12v4No1 / 17
36amnondominant feces, homo sapiens, sichuan province2016-12-06v4No1 / 18
39amnonhigh freq. in obsese lepr-db mice (dominant feces, research facility, mus musculus, obesity)2016-12-09v4No1 / 18
59amnondominant digestive system, apis mellifera2017-02-02v4No1 / 18
95amnonhigh freq. in root canal (dominant homo sapiens, tooth, brazil, root canal)2017-03-12v4No1 / 18
207amnonhigh freq. in people hospitalized with diarrhea (dominant feces, homo sapiens, israel, diarrhea)2017-10-05v4No1 / 18
273amnondominant feces, homo sapiens, infant, kingdom of denmark, 1-month-old human stage2018-01-14v4No1 / 18
284amnondominant feces, homo sapiens, female, infant, state of california, 6-month-old human stage2018-01-27v4No1 / 18
339amnondominant feces, homo sapiens, adult, india2018-05-24v4No1 / 18
387amnonhigh freq. in feces of wild brown bear (dominant feces, sweden, wild, ursus arctos, brown bear)2018-11-03v4No1 / 18
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in severe ulcerative colitis compared to mild in feces homo sapiens united states of america child )2018-11-22v4No1 / 18
440amnondominant feces, galapagos islands, bird, finch, geospiza fuliginosa, small ground finch2019-01-06v4No1 / 18
625amnondominant feces, united states of america, zoological garden, state of minnesota, saguinus imperator, como zoo, emperor tamarin2020-05-16v4No1 / 18
650amnondominant feces, homo sapiens, united states of america, adult, state of new york, asian2020-09-09v4No1 / 18
532amnondominant feces, homo sapiens, adult, czech republic, short bowel syndrome2019-07-21v1No1 / 18
37amnonhigh freq. in plastic leaf plants (in field next to tomato plants) (dominant leaf, maryland county)2016-12-09v4No1 / 19
118amnonhigh freq. in captive reared butterfly (dominant body proper, adult, panama, butterfly, heliconius erato, whole body, tropical and subtropical moist broadleaf forest biome, forest ecosystem)2017-04-11v4No1 / 19
146amnondominant united states of america, solanum lycopersicum, tomato, botanical fruit food product2017-04-20v4No1 / 19
165amnonhigh freq. in moist wheat bran (dominant research facility, wheat bran, china)2017-07-16v4No1 / 19
339amnoncommon feces, homo sapiens, infant, india, under-1-year-old human stage2018-05-24v4No1 / 19
404amnondominant feces, homo sapiens, city, adult, colombia2018-11-20v4No1 / 19
408amnoncommon united states of america, larval stage, costa rica, crematogaster, ant2018-11-22v4No1 / 19
418amnon high in mucus compared to tissue in ocean coral diploastrea heliopora 2018-12-02v4No1 / 19
431amnonhigh freq. in midgut of hibernating bumble bees (dominant research facility, midgut, belgium, bombus terrestris, bumble bee, queen, hibernation)2018-12-16v4No1 / 19
438amnondominant feces, homo sapiens, adult, jiangsu province, china, 65-79 year-old human stage2018-12-30v4No1 / 19
455amnondominant feces, homo sapiens, adult, canada, atherosclerosis2019-01-10v4No1 / 19
489amnondominant feces, french republic, anal swab, myotis myotis, bat, greater mouse eared bat2019-02-25v4No1 / 19
45amnonhigh freq. in feces babies <2 years in india (dominant feces, homo sapiens, infant, india)2016-12-19v4No1 / 20
59amnoncommon digestive system, centris atripes2017-02-03v4No1 / 20
105amnondominant homo sapiens, dentition, brazil, mouth, pulpitis2017-04-05v4No1 / 20
160amnonhigh freq. in wastewater treatment plant effluent in autumn in china (dominant wastewater treatment plant, effluent, autumn, china)2017-07-12v4No1 / 20
184amnoncommon digestive system, peru, ants, odontomachus2017-08-15v4No1 / 20
238amnondominant feces, homo sapiens, colombia2017-11-07v4No1 / 20
271amnoncommon root structure, glycine max, soybean, root, root nodule, china, depth (soil) 0-20cm2018-01-09v4No1 / 20
273amnoncommon feces, homo sapiens, infant, kingdom of denmark, age one week, 1-month-old human stage2018-01-14v4No1 / 20
273amnondominant feces, homo sapiens, infant, kingdom of denmark, age one week, 1-month-old human stage2018-01-14v4No1 / 20
284amnoncommon feces, homo sapiens, female, infant, state of california, age 2 months2018-01-27v4No1 / 20
284amnondominant feces, homo sapiens, female, infant, state of california, age 2 months2018-01-27v4No1 / 20
286amnonhigh freq. in feces of individuals with kidney stones (dominant feces, homo sapiens, adult, nanning city prefecture, nephrolithiasis, china, sixth decade human stage)2018-01-27v4No1 / 20
292amnondominant feces, homo sapiens, adult, ulcerative colitis, china2018-02-05v4No1 / 20
292amnondominant feces, homo sapiens, adult, crohn's disease, china2018-02-05v4No1 / 20
390amnondominant feces, homo sapiens, hospital, australia, diarrhea2018-11-04v4No1 / 20
492amnondominant skin, adult, chile, frog, eupsophus vertebralis2019-02-27v4No1 / 20
539amnondominant ethiopia, early timepoint, ensete ventricosum, ethiopian banana, days 1-15, aerobic fermentation, food (fermented)2019-07-31v4No1 / 20
594amnondominant homo sapiens, saliva, adult, cameroon2020-03-12v4No1 / 20
333amnonhigh freq. in healthy controls feces (dominant feces, homo sapiens, control, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 20
723amnoncommon feces, homo sapiens, infant, child, indonesia, municipality of yogyakarta, age 0-6 months2021-01-02v3No1 / 20
149amnondominant pond, larval stage, intestine, amphibian larval stage, germany, salamandra salamandra, fire salamander2017-04-24v4No1 / 21
241amnonhigh freq. in babies age < 3 years in finland (dominant feces, homo sapiens, infant, finland, age < 3 years)2017-11-13v4No1 / 21
249amnondominant feces, homo sapiens, united states of america2017-11-22v4No1 / 21
320amnondominant feces, homo sapiens, adult, crohn's disease2018-04-19v4No1 / 21
350amnonhigh freq. in feces of white faced capuchin from costa rica rain forest (dominant feces, costa rica, monkey, cebus capucinus, white-faced capuchin, woodland area)2018-07-30v4No1 / 21
390amnondominant feces, homo sapiens, hospital, australia, clostridium difficile intestinal infectious disease, diarrhea2018-11-04v4No1 / 21
501amnoncommon digestive system, costa rica, butterfly, arawacus togarna2019-03-09v4No1 / 21
591amnondominant feces, homo sapiens, united states of america, adult, parkinson's disease, human late adulthood stage2020-02-17v4No1 / 21
614amnondominant united states of america, commonwealth of massachusetts, plant fluid, harvard forest, sarracenia purpurea, pitcher plant, pitcher fluid2020-04-26v4No1 / 21
674amnondominant female, body proper, panama, whole body, culicoides <genus>, culicoides batesi, biting midge2020-09-28v4No1 / 21
859amnoncommon feces, homo sapiens, infant, state of california, formula fed, hispanic or latin american, los angeles district, hispanic, 6-month-old human stage2022-01-12v4No1 / 21
728amnondominant feces, homo sapiens, hospital, adult, kingdom of spain, clostridium difficile intestinal infectious disease, clostridium difficile infection, valladolid2021-01-05v3No1 / 21
848amnondominant feces, homo sapiens, infant, kingdom of spain, 4-month-old human stage2021-12-13v1No1 / 21
94amnondominant feces, homo sapiens, state of michigan, clostridium difficile intestinal infectious disease, diarrhea2017-03-12v4No1 / 22
185amnonhigh freq. in patients with c. diff infection before treatment (dominant feces, homo sapiens, united states of america, state of minnesota, clostridium difficile intestinal infectious disease)2017-08-20v4No1 / 22
201amnonhigh freq. in cactus fly whole body (dominant desert, body proper, drosophila, mexico, drosophila nigrospiracula, fly)2017-10-01v4No1 / 22
286amnonhigh freq. in feces of individuals without kidney stones (dominant feces, homo sapiens, control, adult, nanning city prefecture, china, sixth decade human stage)2018-01-27v4No1 / 22
395amnondominant feces, homo sapiens, united states of america, child, commonwealth of pennsylvania, inflammatory bowel disease, crohn's disease, ulcerative colitis2018-11-14v4No1 / 22
674amnondominant female, body proper, panama, whole body, lutzomyia gomezi, sand fly2020-09-28v4No1 / 22
674amnondominant female, body proper, whole body, panama, psychodopygus panamensis, sand fly2020-09-28v4No1 / 22
779amnoncommon feces, homo sapiens, adult, guangzhou city prefecture, crohn's disease, china2021-04-28v4No1 / 22
779amnondominant feces, homo sapiens, control, adult, guangzhou city prefecture, china2021-04-28v4No1 / 22
795amnondominant research facility, gallus gallus, chicken, uterine tube infundibulum, adult organism, china, age 90 weeks2021-06-08v4No1 / 22
858amnondominant two weeks, high salt concentration, fermented vegetable food product, china, fermneted chinese cabbage, suan cai, 3%-5% salt concentration2022-01-11v4No1 / 22
859amnondominant feces, homo sapiens, infant, state of california, formula fed, hispanic or latin american, los angeles district, hispanic, 1-month-old human stage2022-01-12v4No1 / 22
333amnonhigh freq. in stroke patient feces (dominant feces, homo sapiens, stroke, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 22
655amnondominant in patients after hematopoietic stem cell transplant (dominant feces, homo sapiens, italy, after hcst, hematopoietic stem cell transplant)2020-09-13v3No1 / 22
71amnondominant research facility, hindgut, colon, argentina, liolaemus ruibali2017-02-25v4No1 / 23
197amnondominant feces, homo sapiens, juvenile organism, obsolete_juvenile stage, india, 13-year-old human stage2017-09-12v4No1 / 23
241amnonhigh freq. in babies age < 3 years in estonia (dominant feces, homo sapiens, infant, estonia, age < 3 years)2017-11-13v4No1 / 23
284amnondominant feces, homo sapiens, female, infant, state of california, 12-month-old human stage2018-01-27v4No1 / 23
492amnoncommon skin, adult, brazil, rana catesbeiana, bullfrog, frog, lithobates catesbeianus2019-02-27v4No1 / 23
539amnondominant ethiopia, late timepoint, ensete ventricosum, ethiopian banana, days 30-60, anaerobic fermentation, food (fermented)2019-07-31v4No1 / 23
636amnondominant homo sapiens, united states of america, hospital, adult, commonwealth of pennsylvania, tracheal aspirate, acute respiratory failure, respiratory failure, trachea, endotracheal aspirate2020-08-08v4No1 / 23
636amnondominant homo sapiens, united states of america, hospital, oropharynx, adult, commonwealth of pennsylvania, acute respiratory failure, respiratory failure, oropharyngeal swab2020-08-08v4No1 / 23
779amnondominant feces, homo sapiens, ulcerative colitis, adult, guangzhou city prefecture, china2021-04-28v4No1 / 23
795amnondominant research facility, vagina, gallus gallus, chicken, adult organism, china, age 90 weeks2021-06-08v4No1 / 23
322amnondominant digestive system, united states of america, research facility, adult, state of florida, frog, osteopilus septentrionalis2018-04-23v4No1 / 24
489amnoncommon feces, french republic, anal swab, myotis myotis, bat, greater mouse eared bat2019-02-25v4No1 / 24
532amnoncommon feces, homo sapiens, adult, czech republic, short bowel syndrome2019-07-21v1No1 / 24
181amnoncommon digestive system, research facility, belgium, bombus terrestris, bumblebee2017-08-15v4No1 / 25
258amnonhigh freq. in lungs of hiv patients with pneumonia (dominant homo sapiens, lung, bronchoalveolar lavage, hiv infection, bronchial epithelium, uganda, pneumonia)2017-11-27v4No1 / 25
284amnoncommon feces, homo sapiens, female, infant, state of california, 6-month-old human stage2018-01-27v4No1 / 25
428amnoncommon feces, homo sapiens, adult, nanchang city prefecture, acute pancreatitis, pancreatitis, china2018-12-09v4No1 / 25
501amnoncommon costa rica, tree, dipteryx oleifera, botanical fruit food product2019-03-08v4No1 / 25
663amnoncommon homo sapiens, nasal cavity, pair of nares, adult, poland2020-09-22v4No1 / 25
674amnondominant female, body proper, whole body, culicoides <genus>, panama, culicoides foxi, biting midge2020-09-28v4No1 / 25
779amnoncommon feces, homo sapiens, ulcerative colitis, adult, guangzhou city prefecture, china2021-04-28v4No1 / 25
859amnondominant feces, homo sapiens, infant, state of california, formula fed, hispanic or latin american, los angeles district, hispanic, 6-month-old human stage2022-01-12v4No1 / 25
59amnon high in united states of america austin compared to australia malaysia seoul china in digestive system apis mellifera 2017-02-02v4No1 / 25
723amnoncommon homo sapiens, female, breast milk, adult, breast milk material, indonesia, municipality of yogyakarta2021-01-02v3No1 / 25
29amnoncommon in various plant seeds ( high in compared to in french republic seed )2016-12-05v4No1 / 26
158amnonhigher in skin sites compared to mouth in cats ( high in skin compared to saliva mouth in united states of america felis catus cat )2017-07-06v4No1 / 26
438amnondominant feces, homo sapiens, adult, jiangsu province, china, fourth decade human stage, fifth decade human stage2018-12-30v4No1 / 26
614amnoncommon united states of america, commonwealth of massachusetts, plant fluid, harvard forest, sarracenia purpurea, pitcher plant, pitcher fluid2020-04-26v4No1 / 26
674amnoncommon female, body proper, whole body, panama, coquillettidia, mosquito, coquilettidia venezuelensis2020-09-28v4No1 / 26
689amnondominant feces, homo sapiens, united states of america, hospital, adult, non c. diff diarrhea, tucson2028-03-11v4No1 / 26
723amnondominant feces, homo sapiens, infant, child, indonesia, municipality of yogyakarta, age 0-6 months2021-01-02v3No1 / 26
131amnondominant feces, homo sapiens, south korea2017-04-16v4No1 / 27
387amnoncommon in feces of wild brown bear (common feces, sweden, wild, ursus arctos, brown bear)2018-11-03v4No1 / 27
659amnoncommon feces, homo sapiens, ulcerative colitis, child, acute severe colitis2020-09-19v4No1 / 27
674amnoncommon female, body proper, panama, whole body, lutzomyia gomezi, sand fly2020-09-28v4No1 / 27
674amnoncommon female, body proper, whole body, panama, nyssomyia trapidoi, sand fly2020-09-28v4No1 / 27
365amnondominant feces, homo sapiens, child, jordan, obsolete_juvenile stage2018-08-30v4No1 / 28
397amnoncommon digestive system, intestine, panama, fungus growing ant, myrmicocrypta ednaella2018-11-14v4No1 / 28
26amnoncommon in combined swab of inguinal region and axilla (common homo sapiens, united states of america, sebum, axilla, inguinal region)2016-12-05v4No1 / 29
165amnoncommon in house fly larva grown on moist wheat bran (common digestive system, research facility, larval stage, musca domestica, house fly, china)2017-07-16v4No1 / 29
193amnonlower in nares of people working in dairy farms ( high in control compared to farm bos taurus in homo sapiens united states of america pair of nares )2017-09-05v4No1 / 29
858amnon high in two weeks compared to 3 days in fermented vegetable food product china fermneted chinese cabbage suan cai 2022-01-11v4No1 / 29
284amnoncommon feces, homo sapiens, female, infant, state of california, 12-month-old human stage2018-01-27v4No1 / 30
364amnoncommon body proper, orchesella cincta, kingdom of denmark, springtail2018-08-29v4No1 / 30
492amnoncommon skin, adult, brazil, frog, lesser foam frog, scinax perereca2019-02-27v4No1 / 30
723amnoncommon feces, homo sapiens, child, indonesia, municipality of yogyakarta, 2-5 year-old child stage2021-01-02v3No1 / 30
45amnoncommon in feces babies age 0-2 in india (common feces, homo sapiens, infant, india)2016-12-19v4No1 / 31
149amnoncommon pond, larval stage, intestine, amphibian larval stage, germany, salamandra salamandra, fire salamander2017-04-24v4No1 / 31
492amnoncommon skin, adult, brazil, frog, dendropsophus minutus, lesser treefrog2019-02-27v4No1 / 31
544amnoncommon united states of america, commonwealth of massachusetts, vaccinium macrocarpon, american cranberry, botanical fruit food product2019-08-04v4No1 / 31
651amnon high in male compared to female in feces homo sapiens united states of america adult state of alabama 2020-09-13v4No1 / 31
674amnoncommon female, body proper, whole body, panama, culex coronator, mosquito2020-09-28v4No1 / 31
796amnon high in graves' disease compared to control in feces homo sapiens adult taiwan republic of china taoyuan city 2021-06-10v3No1 / 31
26amnoncommon united states of america, mucus, pair of nares, canis lupus familiaris2016-12-05v4No1 / 32
165amnoncommon in moist wheat bran (common research facility, wheat bran, china)2017-07-16v4No1 / 32
292amnon high in crohn's disease ulcerative colitis compared to control in feces homo sapiens adult china 2018-02-05v4No1 / 32
37amnoncommon leaf, solanum lycopersicum, maryland county2016-12-09v4No1 / 33
57amnoncommon digestive system, apis mellifera, state of california, forager2017-01-31v4No1 / 33
71amnoncommon research facility, small intestine, argentina, liolaemus ruibali2017-02-25v4No1 / 33
311amnoncommon united states of america, state of rhode island, garlic, foodon product type2018-04-09v4No1 / 34
407amnoncommon feces, costa rica, monkey, wild, cebus capucinus, white-faced capuchin2018-11-21v4No1 / 34
492amnoncommon skin, adult, brazil, frog, leptodactylus latrans, lesser foam frog2019-02-27v4No1 / 34
674amnoncommon female, body proper, panama, whole body, psychodopygus panamensis, sand fly2020-09-28v4No1 / 34
19amnonhigher in CD compared to control in biopsies ( high in crohn's disease compared to control in homo sapiens united states of america rectum caecum colon sigmoid colon terminal ileum biopsy children )2016-11-14v4No1 / 34
24amnondisappears on transition to cow milk ( high in breast milk compared to mammalian milk beverage in feces homo sapiens infant )2016-12-01v4No1 / 35
146amnoncommon united states of america, solanum lycopersicum, tomato, botanical fruit food product2017-04-20v4No1 / 35
240amnonhigher in infants age<1 year compared to 1-3 years in baby feces ( high in age under-1-year-old human stage compared to 1-year-old human stage in feces homo sapiens infant finland )2017-11-12v4No1 / 35
262amnonhigher in tick larvae fed on PIXR immunized mice compared to non immunized ( high in pixr immunized compared to control in research facility larval stage body proper ixodes scapularis tick )2017-12-10v4No1 / 35
350amnoncommon in feces of white faced capuchin from costa rica rain forest (common feces, costa rica, monkey, cebus capucinus, white-faced capuchin, woodland area)2018-07-30v4No1 / 35
539amnoncommon ethiopia, early timepoint, ensete ventricosum, ethiopian banana, days 1-15, aerobic fermentation, food (fermented)2019-07-31v4No1 / 35
212amnon high in obese body mass index status db/db mouse obesity compared to lean body mass in feces united states of america research facility mus musculus mouse 2017-10-22v4No1 / 36
219amnonhigher in pre-weaning compared to post-weaning in mouse feces ( high in breast milk age age 21 days compared to mouse chow age 28 days in feces research facility mus musculus c57bl/6 male mouse south korea )2017-10-24v4No1 / 36
311amnoncommon united states of america, state of rhode island, radish, foodon product type2018-04-09v4No1 / 36
367amnoncommon coast, air, namibia2018-09-02v4No1 / 36
674amnoncommon female, body proper, whole body, culicoides <genus>, panama, biting midge, culicoides helicaniae2020-09-28v4No1 / 36
674amnoncommon female, body proper, whole body, panama, culex declarator, mosquito2020-09-28v4No1 / 36
749amnoncommon homo sapiens, female, skin, adult, seoul, skin of cheek, south korea, third decade human stage2021-03-10v4No1 / 36
749amnoncommon homo sapiens, female, skin, adult, seoul, skin of forehead, south korea, third decade human stage2021-03-10v4No1 / 36
81amnonhigh in influenza A positive mallards compared to healthy mallards ( high in influenza compared to control in cloaca anas platyrhynchos state of california mallard )2017-03-05v4No1 / 37
232amnoncommon in foot of diabetic patients (common homo sapiens, skin, foot, australia, diabetes mellitus)2017-11-05v4No1 / 37
59amnoncommon digestive system, apis dorsata2017-02-02v4No1 / 38
243amnoncommon digestive system, united states of america, beetle, anoplophora glabripennis2017-11-15v4No1 / 38
390amnoncommon feces, homo sapiens, hospital, australia, diarrhea2018-11-04v4No1 / 38
503amnonincreases following malaria infection ( high in late time points experimental cerebral malaria malaria compared to control early time points in feces research facility mus musculus c57bl/6 mouse japan )2019-03-12v4No1 / 38
330amnoncommon feces, homo sapiens, infant, kingdom of norway, oslo, age 1 year2018-05-13v4No1 / 39
79amnoncommon united states of america, skin, peponocephala electra2017-03-03v4No1 / 40
79amnoncommon united states of america, skin, stenella attenuata2017-03-03v4No1 / 40
28amnoncommon in various trees in hawaii (common organic material, forest biome, leaf, hawaii, whole plant, forest ecosystem)2016-12-05v4No1 / 41
267amnonhigher in gut of fish in water with cadmium contamination compared to control ( high in cadmium compared to control in digestive system research facility oreochromis niloticus fish china )2017-12-24v4No1 / 41
352amnoncommon feces, homo sapiens, new delhi, india2018-07-30v4No1 / 41
400amnonhigher in children of hmong migrands born in the usa compared to non-migrant usa people ( high in hmong hmong 2nd generation compared to united states of america in feces homo sapiens )2018-11-18v4No1 / 41
859amnon high in formula fed compared to breast fed in feces homo sapiens infant state of california hispanic or latin american los angeles district hispanic 6-month-old human stage 2022-01-12v4No1 / 41
60amnoncommon feces, anser cygnoides, china2017-02-03v4No1 / 42
95amnoncommon in root canal (common homo sapiens, tooth, brazil, root canal)2017-03-12v4No1 / 42
59amnoncommon digestive system, trigona hyalinata2017-02-02v4No1 / 43
547amnon high in high salt concentration compared to low salt concentration in capsicum annuum sichuan province red pepper sauce food (fermented) china 2019-08-15v4No1 / 43
789amnonlow in unfemented compared to fermented cocoa mass ( high in time 5 days fermented cocoa mass compared to time 0 in mexico cocoa mass theobroma cacao state of tabasco )2021-06-01v3No1 / 43
241amnoncommon in babies age < 3 years in russia (common feces, homo sapiens, infant, russia, age < 3 years)2017-11-13v4No1 / 44
302amnoncommon in feces of parakeet pet birds (common feces, melopsittacus undulatus, mexico, bird, parakeet, pet)2018-03-05v4No1 / 44
406amnoncommon feces, united states of america, zoological garden, myrmecophaga tridactyla, giant anteater2018-11-21v4No1 / 44
244amnoncommon digestive system, research facility, drosophila melanogaster, fruit fly, united kingdom2017-11-15v4No1 / 45
258amnonhigher lungs of hiv pneumonia patients not treated with ceftriaxone ( high in no ceftriaxone compared to ceftriaxone in homo sapiens lung bronchoalveolar lavage hiv infection bronchial epithelium uganda pneumonia )2017-11-27v4No1 / 47
301amnoncommon united states of america, duodenum, canis lupus familiaris, dog2018-03-05v4No1 / 47
379amnonnegatively correlated with age 8-35 days in chickens ( high in young age compared to age old age in feces gallus gallus chicken united kingdom )2018-09-14v4No1 / 47
779amnoncommon feces, homo sapiens, control, adult, guangzhou city prefecture, china2021-04-28v4No1 / 47
674amnoncommon female, body proper, panama, whole body, culicoides <genus>, culicoides batesi, biting midge2020-09-28v4No1 / 48
149amnoncommon mucus, larval stage, amphibian larval stage, skin, germany, salamandra salamandra, fire salamander2017-04-24v4No1 / 49
258amnoncommon in lungs of hiv patients with pneumonia (common homo sapiens, lung, bronchoalveolar lavage, hiv infection, bronchial epithelium, uganda, pneumonia)2017-11-27v4No1 / 49
547amnoncommon capsicum annuum, sichuan province, red pepper sauce, food (fermented), china2019-08-15v4No1 / 49
651amnoncommon feces, homo sapiens, united states of america, adult, state of alabama, parkinson's disease2020-09-13v4No1 / 49
674amnoncommon female, body proper, whole body, culicoides <genus>, panama, culicoides foxi, biting midge2020-09-28v4No1 / 49
121amnoncommon feces, homo sapiens, adult, bangladesh2017-04-13v4No1 / 50
406amnoncommon feces, united states of america, zoological garden, equus przewalskii, przewalski horse2018-11-21v4No1 / 50
441amnonhigher after antibiotic treatment ( high in antibiotic cefoperazone compared to control in feces united states of america research facility mus musculus c57bl/6j mouse )2019-01-06v4No1 / 50
834amnoncommon feces, homo sapiens, adult, japan2021-09-11v1No1 / 50
127amnoncommon united states of america, caecum, gallus gallus, chicken, age 14-28 days2017-04-14v4No1 / 51
847amnoncommon feces, japan, 80 year-old and over human stage, ninth decade human stage2021-12-01v1No1 / 52
292amnoncommon feces, homo sapiens, adult, ulcerative colitis, china2018-02-05v4No1 / 53
333amnoncommon in stroke patient feces (common feces, homo sapiens, stroke, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 53
515amnoncommon poland, whole body, plant, beetle, aphthona venustula, nida basin, herbivorous beetle2019-04-18v4No1 / 54
292amnoncommon feces, homo sapiens, adult, crohn's disease, china2018-02-05v4No1 / 55
390amnoncommon feces, homo sapiens, hospital, salmonella gastroenteritis, australia, diarrhea2018-11-04v4No1 / 55
492amnoncommon skin, adult, chile, frog, eupsophus vertebralis2019-02-27v4No1 / 55
26amnon high in mucus pair of nares compared to saliva mouth in united states of america canis lupus familiaris 2016-12-05v4No1 / 57
308amnoncommon in neonatal intensive care unit floor (common united states of america, dust, hospital, state of california, floor)2018-03-31v4No1 / 57
431amnoncommon in midgut of hibernating bumble bees (common research facility, midgut, belgium, bombus terrestris, bumble bee, queen, hibernation)2018-12-16v4No1 / 57
532amnon high in short bowel syndrome compared to control in feces homo sapiens adult czech republic 2019-07-21v1No1 / 57
116amnoncommon research facility, intestine, litopenaeus vannamei, south china sea, pacific white shrimp, china2017-04-10v4No1 / 58
523amnoncommon united states of america, building, air, state of illinois, chicago, bedroom2019-07-03v4No1 / 58
67amnoncommon in wet processing of coffee beans (common coffea arabica, ecuador, wet processing)2017-02-19v4No1 / 59
149amnoncommon stream, larval stage, intestine, amphibian larval stage, germany, salamandra salamandra, fire salamander2017-04-24v4No1 / 60
600sheryoincearses after 12 days of unammendment in soil ( high in day 12 compared to day 1 in united states of america soil state of new york ph 6 coarse-loamy soil depth (soil) 0-5cm )2020-03-27v4No1 / 60
90amnoncommon douchi, food (fermented), china2017-03-08v4No1 / 61
374amnoncommon skin, costa rica, frog, amphibia, oophaga pumilio, strawberry poison frog2018-09-09v4No1 / 61
333amnoncommon in healthy controls feces (common feces, homo sapiens, control, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 61
311amnonlower in fermneted kimchi days>1 compared to day 0 ( high in early timepoints day 0 compared to days 1-9 in united states of america state of rhode island kimchi food (fermented) )2018-04-09v4No1 / 62
302amnoncommon in feces of Cockatiel pet birds (common feces, mexico, bird, pet, nymphicus hollandicus, cockatiel)2018-03-05v4No1 / 63
311amnoncommon united states of america, state of rhode island, red pepper, foodon product type2018-04-09v4No1 / 63
558amnon high in duodenum compared to caecum in united states of america state of wyoming bird centrocercus urophasianus greater sage-grouse 2019-09-20v4No1 / 64
858amnoncommon two weeks, low salt concentration, fermented vegetable food product, china, fermneted chinese cabbage, suan cai, 0%-1% salt concentration2022-01-11v4No1 / 65
720amnon high in autoimmune hepatitis compared to control in feces homo sapiens adult china zhengzhou city prefecture 2028-05-23v3No1 / 65
341amnoncommon united states of america, water, fresh water, drinking water, tap water, state of illinois2018-05-28v4No1 / 66
365amnoncommon feces, homo sapiens, child, nigeria, obsolete_juvenile stage2018-08-30v4No1 / 66
734amnoncommon feces, homo sapiens, adult, taiwan, coronary heart disease, republic of china2021-01-22v3No1 / 66
71amnon high in stomach small intestine compared to feces hindgut colon in research facility argentina liolaemus ruibali 2017-02-25v4No1 / 67
311amnoncommon united states of america, state of rhode island, fish sauce, foodon product type2018-04-09v4No1 / 68
398amnon high in crohn's disease compared to control in feces homo sapiens belgium 2018-11-15v4No1 / 68
734amnoncommon feces, homo sapiens, adult, taiwan, republic of china, omnivore diet2021-01-22v3No1 / 68
738amnon high in age 1 week compared to age 30 days in caecum gallus gallus chicken united kingdom 2021-01-30v3No1 / 68
301amnoncommon united states of america, ileum, canis lupus familiaris, dog2018-03-05v4No1 / 69
723amnoncommon feces, homo sapiens, female, adult, indonesia, municipality of yogyakarta2021-01-02v3No1 / 69
91amnoncommon serofluid dish, jiangshui, food (fermented), china2017-03-08v4No1 / 70
417amnoncommon feces, anser cygnoides, winter, bird, swan goose, china2018-12-01v4No1 / 70
594amnon high in city yaounde compared to rural community ngoantet in feces homo sapiens adult cameroon 2020-03-12v4No1 / 70
9amnonhigher in beginning of experiment comapred to 12 days ( high in beginning compared to end in sea water bermuda )2016-10-27v4No1 / 71
28amnoncommon feces, terrestrial biome, hawaii, achatinella mustelina, environmental system determined by an organism2016-12-05v4No1 / 71
404amnon high in municipality of santiago de cali bucaramanga barranquilla compared to bogota medellin metropolitan area in feces homo sapiens city adult colombia 2018-11-20v4No1 / 71
663amnon high in poland compared to switzerland in feces homo sapiens adult 2020-09-22v4No1 / 72
26amnoncommon homo sapiens, united states of america, mucus, pair of nares2016-12-05v4No1 / 73
99amnoncommon united states of america, mucus, skin, notophthalmus viridescens, commonwealth of virginia, newt2017-04-02v4No1 / 74
477amnoncommon feces, homo sapiens, adult, nepal, himalayas, rural community, tharu, agrarian2019-01-28v4No1 / 74
858amnoncommon two weeks, high salt concentration, fermented vegetable food product, china, fermneted chinese cabbage, suan cai, 3%-5% salt concentration2022-01-11v4No1 / 75
797amnon high in formula fed compared to breast fed in feces homo sapiens infant germany 3-month-old human stage 2021-06-13v3No1 / 75
322amnoncommon digestive system, united states of america, research facility, adult, state of florida, frog, osteopilus septentrionalis2018-04-23v4No1 / 76
438amnonhigher in kindergarten compared to primary and middle school kids ( high in age 3-6 2-5 year-old child stage compared to age 8-12 age 13-14 6-12 year-old child stage 13-year-old human stage 14-year-old human stage in feces homo sapiens china )2018-12-30v4No1 / 76
122amnonpositively correlated with bmi ( high in body mass index high bmi compared to low bmi in feces homo sapiens united kingdom )2017-04-13v4No1 / 77
431amnonhigher in midgut of hibernating bumble bees compared to non-hibernating ( high in hibernation compared to non hibernating in research facility midgut belgium bombus terrestris bumble bee queen )2018-12-16v4No1 / 77
360amnoncommon desert, leaf, mexico, guanajuato, agave, leaf endosphere, agave tequiliana, cultivated environment2018-08-21v4No1 / 78
399amnoncommon feces, united states of america, state of tennessee, zoological garden, panthera leo, lion2018-11-16v4No1 / 79
404amnoncommon feces, homo sapiens, city, adult, colombia2018-11-20v4No1 / 79
26amnoncommon united states of america, mucus, pair of nares, felis catus2016-12-05v4No1 / 80
292amnoncommon feces, homo sapiens, control, adult, china2018-02-05v4No1 / 81
339amnoncommon feces, homo sapiens, adult, india2018-05-24v4No1 / 81
361amnoncommon leaf, austria, plant, greenhouse, beaucarnea recurvata2018-08-21v4No1 / 81
707amnoncommon feces, homo sapiens, female, adult, guangzhou city prefecture, china, fourth decade human stage, fifth decade human stage2028-04-11v3No1 / 82
269amnonpeaks at 2 weeks in refrigeration of yao meat ( high in middle timepoint two weeks compared to late timepoint fresh food spoilage in foodon product type china )2018-01-09v4No1 / 83
648amnoncommon feces, united states of america, canis lupus familiaris, dog, state of louisiana2020-09-06v4No1 / 83
353amnoncommon in captive Triturus cristatus newts skin (common research facility, skin, adult, cambridgeshire, newt, triturus cristatus, united kingdom)2018-07-30v4No1 / 84
663amnoncommon homo sapiens, lung, bronchoalveolar lavage, adult, poland2020-09-22v4No1 / 84
592amnoncommon digestive system, united states of america, commonwealth of pennsylvania, tenebrio molitor, mealworm, pet store2020-02-18v1No1 / 84
601amnoncommon feces, homo sapiens, adult, type 2 diabetes mellitus, china2020-03-30v4No1 / 85
804amnon high in iga negative fraction compared to iga positive fraction in feces homo sapiens child africa central african republic madagascar age 2-5 years 2021-06-18v4No1 / 85
26amnon high in mucus pair of nares compared to saliva mouth in united states of america felis catus 2016-12-05v4No1 / 86
353amnoncommon in captive Lissotriton vulgaris newts skin (common research facility, skin, adult, cambridgeshire, newt, lissotriton vulgaris, united kingdom)2018-07-30v4No1 / 86
513amnoncommon city, waste water, hospital, xinxiang city prefecture, china2019-03-25v4No1 / 86
600sheryoIncearses after 12 days of biochar ammendment in soil ( high in day 12 compared to day 1 in united states of america soil state of new york ph 6 biochar coarse-loamy soil depth (soil) 0-5cm )2020-03-27v4No1 / 86
766amnon high in age 2 days compared to age 8 weeks in feces canis lupus familiaris french republic dog rectal swab puppy 2021-04-12v4No1 / 86
841amnoncommon feces, homo sapiens, united states of america, adult, state of texas, human adult stage2021-11-08v4No1 / 86
336amnoncommon feces, qinghai province, anser, goose, greylag goose, china2018-05-16v4No1 / 87
360amnoncommon desert, mexico, guanajuato, agave, root endosphere, agave salmiana, root2018-08-21v4No1 / 87
723amnonlower in children age 2-4 years compared to mothers ( high in adult compared to child 2-5 year-old child stage in feces homo sapiens indonesia municipality of yogyakarta )2021-01-02v3No1 / 87
71amnoncommon research facility, stomach, argentina, liolaemus ruibali2017-02-25v4No1 / 88
660amnonhigher in the cross cutcu population (more modern) comparen to upano valley (less modern) ( high in cross-cutucu compared to upano valley in feces homo sapiens ecuador rural community village shuar population )2020-09-20v4No1 / 88
382amnoncommon hot spring, geothermal field, water, ganzi tibetan autonomous prefecture, high temperature environment, china2018-10-22v4No1 / 89
199amnoncommon on shower wall tile (common united states of america, building, urban biome, bathroom, shower, tile, building wall)2017-10-01v4No1 / 90
137amnon high in juvenile stage compared to adult in feces united states of america state of florida gopherus polyphemus gopher tortoise 2017-04-17v4No1 / 91
26amnon high in mucus pair of nares compared to sebum axilla inguinal region in homo sapiens united states of america 2016-12-05v4No1 / 92
428amnoncommon feces, homo sapiens, control, adult, nanchang city prefecture, china2018-12-09v4No1 / 93
601amnoncommon feces, homo sapiens, control, adult, china2020-03-30v4No1 / 93
471amnoncommon digestive system, united states of america, research facility, adult, state of florida, frog, osteopilus septentrionalis2019-01-14v4No1 / 94
838amnoncommon united states of america, research facility, caecum, state of ohio, meleagris gallopavo, wild turkey2021-10-13v4No1 / 94
400amnoncommon in hmong (chinese) females from thailand (common feces, homo sapiens, female, adult, thailand, hmong, china)2018-11-18v4No1 / 95
492amnoncommon skin, adult, brazil, rhinella icterica, toad, yellow cururu toad2019-02-27v4No1 / 95
238amnoncommon feces, homo sapiens, colombia2017-11-07v4No1 / 96
306amnoncommon at whole plant corn at time 0 (common zea mays subsp. mays, whole plant, israel, corn)2018-03-19v4No1 / 96
365amnoncommon feces, homo sapiens, child, azerbaijan, obsolete_juvenile stage2018-08-30v4No1 / 97
558amnoncommon united states of america, gizzard, state of wyoming, bird, centrocercus urophasianus, greater sage-grouse2019-09-20v4No1 / 97
558amnon high in colon compared to caecum in united states of america state of wyoming bird centrocercus urophasianus greater sage-grouse 2019-09-20v4No1 / 97
127amnonhigh in old (14-28 days) compared to young (0-3 day) chickens ( high in age old age compared to young age in united states of america caecum gallus gallus chicken )2017-04-14v4No1 / 98
360amnoncommon desert, soil, rhizosphere, mexico, guanajuato, agave, agave tequiliana, cultivated environment2018-08-21v4No1 / 98
663amnoncommon feces, homo sapiens, adult, poland, low bmi2020-09-22v4No1 / 98
532amnoncommon feces, homo sapiens, control, adult, czech republic2019-07-21v1No1 / 98
99amnoncommon united states of america, mucus, skin, commonwealth of virginia, rana catesbeiana, bullfrog2017-04-02v4No1 / 99
105amnoncommon homo sapiens, dentition, brazil, mouth, pulpitis2017-04-05v4No1 / 100
201amnoncommon in cactus fly whole body (common desert, body proper, drosophila, mexico, drosophila nigrospiracula, fly)2017-10-01v4No1 / 101
438amnoncommon feces, homo sapiens, china, young adult stage2018-12-30v4No1 / 101
361amnoncommon leaf, austria, plant, greenhouse, malvaviscus penduliflorus2018-08-21v4No1 / 102
213amnoncommon homo sapiens, vagina, south africa2017-10-22v4No1 / 103
499amnoncommon digestive system, pond, larval stage, intestine, brazil, remartinia, aeshnidae, dragonfly2019-03-05v4No1 / 104
538amnon high in taconic farms compared to jackson laboratories in research facility ileum mus musculus c57bl/6 terminal ileum canada mouse age 8 weeks 2019-07-29v4No1 / 104
284amnoncommon feces, homo sapiens, female, adult, state of california2018-01-27v4No1 / 105
301amnoncommon united states of america, colon, canis lupus familiaris, dog2018-03-05v4No1 / 105
377amnoncommon skin, germany, salamandra salamandra, salamander2018-09-12v4No1 / 106
438amnoncommon feces, homo sapiens, child, jiangsu province, age 8-12, china, 6-12 year-old child stage2018-12-30v4No1 / 106
663amnoncommon homo sapiens, adult, poland, oral wash, mouth2020-09-22v4No1 / 106
215amnoncommon feces, homo sapiens, united states of america2017-10-23v4No1 / 107
213amnonlower in patients with bacterial vaginosis compared to healthy controls ( high in control compared to bacterial vaginosis in homo sapiens vagina south africa )2017-10-31v4No1 / 107
278amnon high in control compared to periodontitis in homo sapiens united states of america adult state of california subgingival plaque 2018-01-23v4No1 / 107
438amnoncommon feces, homo sapiens, child, jiangsu province, age 3-6, china, 2-5 year-old child stage2018-12-30v4No1 / 109
271amnon high in root structure root compared to soil rhizosphere in glycine max soybean china depth (soil) 0-20cm 2018-01-09v4No1 / 110
536amnoncommon united states of america, skin, snake, southern united states, thamnophis sirtalis, common garter snake2019-07-28v4No1 / 110
539amnon high in early timepoint days 1-15 aerobic fermentation compared to late timepoint days 30-60 anaerobic fermentation in ethiopia ensete ventricosum ethiopian banana food (fermented) 2019-07-31v4No1 / 110
438amnoncommon feces, homo sapiens, adult, jiangsu province, china, 65-79 year-old human stage2018-12-30v4No1 / 111
477amnon high in nepal himalayas rural community compared to united states of america in feces homo sapiens adult 2019-01-28v4No1 / 111
388amnoncommon united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 6-10 weeks2018-11-03v4No1 / 112
580amnoncommon feces, homo sapiens, female, pregnancy, adult, israel, first trimester2020-01-14v4No1 / 112
663amnoncommon feces, homo sapiens, obesity, adult, obese body mass index status, poland2020-09-22v4No1 / 112
71amnoncommon feces, research facility, argentina, liolaemus ruibali2017-02-25v4No1 / 113
269amnoncommon in fresh yao meat food (common foodon product type, china)2018-01-09v4No1 / 113
594amnoncommon homo sapiens, saliva, adult, cameroon2020-03-12v4No1 / 113
201amnonlower in cactus fly compared to decaying cactus ( high in cactus decaying compared to drosophila drosophila nigrospiracula fly in desert mexico )2017-10-01v4No1 / 114
98amnoncommon leaf, state of florida, citrus, vero beach, fl2017-04-01v4No1 / 115
438amnoncommon feces, homo sapiens, adult, jiangsu province, china, fourth decade human stage, fifth decade human stage2018-12-30v4No1 / 115
492amnoncommon skin, adult, germany, toad, bufo bufo, common toad2019-02-27v4No1 / 115
536amnoncommon united states of america, skin, snake, southern united states, agkistrodon piscivorus, aquatic snake2019-07-28v4No1 / 115
529amnonhigher in CRC patients that underwent low anterior resection ( high in low anterior resection compared to control in feces homo sapiens adult taipei city taiwan )2019-07-18v3No1 / 115
48amnonhigher in 3 months compared to 1 week in infant hypopharynx ( high in age 3-month-old human stage compared to age 1 week 1-month-old human stage in homo sapiens hypopharynx infant kingdom of denmark )2017-01-19v4No1 / 116
195amnoncommon in boston subway surfaces (common city, urban biome, boston, train)2017-09-07v4No1 / 116
301amnoncommon united states of america, rectum, canis lupus familiaris, dog2018-03-05v4No1 / 116
613amnoncommon research facility, aquarium, gastrointestinal system, poland, fish, olsztyn, esox lucius, pike fry, gut2020-04-25v3No1 / 116
149amnonhigher in larvae transferred to stream compared to pond ( high in stream compared to pond in mucus larval stage amphibian larval stage skin germany salamandra salamandra fire salamander )2017-04-24v4No1 / 117
343amnoncommon in apple flowers (common united states of america, flower structure, malus x domestica, state of connecticut, flower, apple)2018-05-28v4No1 / 118
212amnoncommon feces, control, united states of america, research facility, mus musculus, lean body mass, mouse2017-10-22v4No1 / 120
311amnoncommon united states of america, state of rhode island, scallion, foodon product type2018-04-09v4No1 / 121
352amnoncommon in duodenal biopsies (common homo sapiens, small intestine, duodenum, new delhi, india)2018-07-30v4No1 / 121
374amnoncommon skin, costa rica, amphibia, rhaebo haematiticus, truando toad, toad2018-09-09v4No1 / 121
438amnoncommon feces, homo sapiens, adult, jiangsu province, age >94, china, ninth decade human stage, tenth decade human stage2018-12-30v4No1 / 121
517amnoncommon homo sapiens, arm, skin, forearm, child, bolivia, chuquisaca department, rural community, age 5-13 years2019-05-29v4No1 / 121
108amnondecreases during fasting in nile tilapia caecum ( high in early timepoints compared to fasting late timepoints in united states of america research facility caecum oreochromis niloticus state of texas nile tilapia )2017-04-07v4No1 / 122
615amnoncommon leaf, brazil, endosphere, leaf endosphere, greenhouse, campinas, saccharum, sugarcane2020-04-27v4No1 / 122
128amnonhigher in ivy leaves from forest compared to moor ( high in forest ecosystem compared to moor scrubland in leaf belgium ivy hedera hibernica )2017-04-14v4No1 / 123
548amnoncommon stem, brazil, minas gerais state, campos rupestres, barbacenia macrantha, stem endosphere2019-08-17v4No1 / 123
449amnoncommon feces, homo sapiens, colombia2019-01-09v4No1 / 124
67amnoncommon in dry processing of coffee beans (common coffea arabica, ecuador, dry processing)2017-02-19v4No1 / 126
590amnoncommon in turtle pond water (common farm, water, pond water, china, hainan autonomous prefecture, turtle farm)2020-02-10v4No1 / 127
753amnon high in farm canis lupus familiaris dog dog breeding center compared to zoological garden captive canis lupus wolf in feces adult china 2021-03-12v4No1 / 127
131amnoncommon feces, homo sapiens, south korea2017-04-16v4No1 / 128
841amnoncommon homo sapiens, united states of america, saliva, adult, state of texas, human adult stage2021-11-08v4No1 / 129
199amnoncommon in kitchen sink (common united states of america, building, urban biome, kitchen, sink)2017-10-01v4No1 / 130
718amnoncommon united states of america, state of wisconsin, hypolimnion, polymictic lake, bog lake, freshwater lake, ph 4-4.5, "crystal bog" lake2028-05-23v4No1 / 131
39amnoncommon in obese lepr-db mice (common feces, research facility, mus musculus, obesity)2016-12-09v4No1 / 132
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
625amnoncommon feces, united states of america, zoological garden, state of minnesota, saguinus imperator, como zoo, emperor tamarin2020-05-16v4No1 / 132
176amnoncommon in skin of hairless mice (common united states of america, female, research facility, dorsum, mus musculus, skin, mouse, skh-1 hairless mouse)2017-07-29v4No1 / 133
711amnon high in adult compared to child age 8-12 years in homo sapiens united states of america oral cavity state of colorado mouth 2028-05-21v4No1 / 133
438amnoncommon feces, homo sapiens, jiangsu province, age 13-14, china, 13-year-old human stage, 14-year-old human stage2018-12-30v4No1 / 134
511amnoncommon united states of america, state of colorado, depth 0-5cm, snow2019-03-20v4No1 / 134
538amnon high in taconic farms compared to jackson laboratories in feces research facility mus musculus c57bl/6 canada mouse age 8 weeks 2019-07-29v4No1 / 135
374amnoncommon skin, costa rica, frog, amphibia, craugastor fitzingeri, common rain frog2018-09-09v4No1 / 136
594amnoncommon feces, homo sapiens, adult, rural community, cameroon, ngoantet2020-03-12v4No1 / 136
212amnoncommon feces, united states of america, research facility, mus musculus, obese body mass index status, mouse, db/db mouse, obesity2017-10-22v4No1 / 137
255amnoncommon in fish feed (common united states of america, research facility, state of minnesota, fish feed)2017-11-24v4No1 / 141
718amnoncommon united states of america, state of wisconsin, epilimnion, polymictic lake, bog lake, freshwater lake, ph 4-4.5, "crystal bog" lake2028-05-23v4No1 / 141
62amnon high in egypt compared to united states of america in feces homo sapiens child obsolete_juvenile stage 2017-02-13v4No1 / 144
71amnoncommon research facility, hindgut, colon, argentina, liolaemus ruibali2017-02-25v4No1 / 144
29amnoncommon brassica oleracea, french republic, seed2016-12-05v4No1 / 146
509amnoncommon feces, homo sapiens, child, nigeria, kebbi state, rural community, schistosomiasis, urinary schistosomiasis, 10-15-years-old human2019-03-18v4No1 / 146
73amnoncommon feces, homo sapiens, adult, glasgow2017-02-26v4No1 / 147
85amnoncommon digestive system, sea water, litopenaeus vannamei, shenzhen city prefecture, pacific white shrimp, china2017-03-06v4No1 / 147
475amnoncommon in air next to subway stations in hong kong (common city, air, hong kong)2019-01-20v4No1 / 147
509amnoncommon feces, homo sapiens, control, child, nigeria, kebbi state, rural community, 10-15-years-old human2019-03-18v4No1 / 147
278amnon high in subgingival plaque compared to saliva in homo sapiens united states of america adult state of california 2018-01-23v4No1 / 149
782amnon high in sparus aurata seabream compared to dicentrarchus labrax seabass in fish farm skin portuguese republic ria formosa open water pond 2021-05-06v4No1 / 149
358amnonhigher in dnbs induced colitis compared to controls in rat feces ( high in dnbs induced colitis colitis compared to control in feces research facility rattus czech republic rat wistar rat )2018-08-19v4No1 / 154
361amnoncommon leaf, austria, plant, greenhouse, howea forsteriana2018-08-21v4No1 / 154
594amnoncommon feces, homo sapiens, city, adult, cameroon, yaounde2020-03-12v4No1 / 154
53amnoncommon feces, homo sapiens, city, el salvador, small village2017-01-21v4No1 / 155
273amnon high in age 1-month-old human stage compared to 1-year-old human stage in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 155
361amnoncommon leaf, austria, plant, greenhouse, dracaena draco2018-08-21v4No1 / 155
171amnoncommon united states of america, oryza sativa, state of california, rice, root2017-07-25v4No1 / 156
510amnoncommon estuary, water, saline water, kingdom of spain, estuary water, salinity >20 ppt, bilbao2019-03-20v4No1 / 158
98amnoncommon leaf, state of florida, citrus, immokalee, fl2017-04-01v4No1 / 160
192amnoncommon seed structure, brassica napus, seed2017-09-05v4No1 / 161
209amnoncommon in whale blow condensate (common respiratory airway, north america, megaptera novaeangliae, humpback whale, exhaled air condensate, whale blow)2017-10-15v4No1 / 161
475amnoncommon in air in subway train in hong kong (common city, air, hong kong, subway)2019-01-20v4No1 / 161
539amnoncommon ethiopia, late timepoint, ensete ventricosum, ethiopian banana, days 30-60, anaerobic fermentation, food (fermented)2019-07-31v4No1 / 161
290amnoncommon feces, homo sapiens, city, adult, china2018-02-01v4No1 / 162
297amnoncommon feces, homo sapiens, united states of america, child, atlanta, obsolete_juvenile stage, age<17 years, immature stage, adolescent stage2018-02-12v4No1 / 162
322amnon high in adult compared to tadpole in digestive system united states of america research facility state of florida frog osteopilus septentrionalis 2018-04-23v4No1 / 163
548amnoncommon leaf, brazil, minas gerais state, leaf endosphere, campos rupestres, barbacenia macrantha2019-08-17v4No1 / 164
337amnoncommon in feces of house mice from new york city (common united states of america, city, mus musculus, new york city, mouse, house mice)2018-05-18v4No1 / 165
232amnoncoomon in foot of healthy controls (common homo sapiens, skin, foot, australia)2017-11-05v4No1 / 166
462amnon high in populus deltoides compared to populus trichocarpa x deltoides in united states of america state of tennessee stem populus tree cultivated environment 2019-01-13v4No1 / 166
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
194amnon high in feces compared to colon ileum in homo sapiens kingdom of norway 2017-09-07v4No1 / 169
123amnon high in diet high fat diet compared to normal diet mouse chow in feces united states of america research facility mus musculus c57bl/6j mouse 2017-04-13v4No1 / 170
197amnoncommon feces, homo sapiens, juvenile organism, obsolete_juvenile stage, india, 13-year-old human stage2017-09-12v4No1 / 170
374amnoncommon skin, costa rica, frog, amphibia, craugastor bransfordii, bransford’s litter frog2018-09-09v4No1 / 171
534amnoncommon river, water, fresh water, nepal, free floating, depth (water) 10cm, filtered 0.2um, koshi river2019-07-22v4No1 / 172
529amnoncommon in patients that underwent low anterior resection (common feces, homo sapiens, adult, taipei city, taiwan, low anterior resection)2019-07-18v3No1 / 172
405amnoncommon feces, united states of america, research facility, mus musculus, mouse, ketogenic diet, swiss webster2018-11-20v4No1 / 177
311amnoncommon united states of america, state of rhode island, ginger, foodon product type2018-04-09v4No1 / 180
179amnoncommon united states of america, research facility, oral cavity, mus musculus, balb/c, mouse, mouth2017-08-13v4No1 / 183
536amnoncommon united states of america, skin, pantherophis obsoletus, snake, southern united states, black rat snake, arboreal snake2019-07-28v4No1 / 184
73amnonhigh in children with Crohn's disease compared to healthy adult controls ( high in child obsolete_juvenile stage crohn's disease compared to control adult in feces homo sapiens glasgow )2017-02-26v4No1 / 185
299amnoncommon homo sapiens, saliva, adult, mouth neoplasm, cancer, china2018-02-27v4No1 / 188
197amnon high in india compared to finland in feces homo sapiens juvenile organism obsolete_juvenile stage 13-year-old human stage 2017-09-12v4No1 / 189
75amnoncommon homo sapiens, arm, skin, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 190
352amnon high in feces compared to small intestine duodenum in homo sapiens new delhi india 2018-07-30v4No1 / 190
80amnon high in dry forest compared to tropical moist broadleaf forest biome in feces state of florida central america alouatta pigra howler monkey 2017-03-03v4No1 / 193
109amnon high in water treatment plant compared to distribution system in united states of america water drinking water site c 2017-04-08v4No1 / 193
201amnoncommon in decaying Saguaro cactus (common desert, mexico, cactus, carnegiea gigantea, saguaro, decaying)2017-10-01v4No1 / 193
201amnoncommon in decaying Cardon cactus (common desert, mexico, cactus, decaying, pachycereus pringlei, cardon)2017-10-01v4No1 / 193
170amnoncommon united states of america, river, stream, water, fresh water, depth (water) 10cm2017-07-24v4No1 / 194
371amnoncommon homo sapiens, skin, venezuela, amerindian, hunter gatherer2018-09-06v4No1 / 195
371amnonlower in skin of amerindians compared to western visitors ( high in united states of america city compared to venezuela amerindian hunter gatherer in homo sapiens skin )2018-09-06v4No1 / 195
600sheryoIncearses after 12 days of stover ammendment in soil ( high in day 12 compared to day 1 in united states of america soil state of new york ph 6 coarse-loamy soil stover ammendment soil depth (soil) 0-5cm )2020-03-27v4No1 / 196
6amnoncommon homo sapiens, urine, female, pregnancy, state of tennessee2016-10-13v4No1 / 201
384amnoncommon farm, pasture, saliva, oral cavity, equus caballus, canada, horse, mouth2018-10-22v4No1 / 201
438amnonlower in centenarians compared to adults ( high in 65-79 year-old human stage fourth decade human stage fifth decade human stage compared to age >94 ninth decade human stage tenth decade human stage in feces homo sapiens china )2018-12-30v4No1 / 203
618amnoncommon farm, canada, root endosphere, root, cannabis sativa, early flowering stage2020-05-04v4No1 / 205
120amnoncommon feces, homo sapiens, brazil2017-04-12v4No1 / 208
150amnoncommon feces, united states of america, canis lupus familiaris, dog2017-04-26v4No1 / 208
360amnoncommon desert, leaf, mexico, guanajuato, agave, agave tequiliana, leaf surface, cultivated environment2018-08-21v4No1 / 210
511amnoncommon kingdom of norway, sweden, finland, lapland, depth 0-5cm, snow2019-03-20v4No1 / 213
360amnon high in summer compared to spring in desert soil rhizosphere state of california mexico 2018-08-21v4No1 / 214
455amnoncommon feces, homo sapiens, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon feces, homo sapiens, adult, small village, rural community, china2018-02-01v4No1 / 218
566amnoncommon feces, homo sapiens, adult, china2019-11-24v4No1 / 221
499amnoncommon pond, water, fresh water, pond water, brazil2019-03-05v4No1 / 228
331amnon high in dry season compared to wet season in feces ethiopia monkey theropithecus gelada 2018-05-13v4No1 / 232
351amnoncommon feces, united states of america, research facility, state of florida, eagle harbor, lytechinus variegatus, sea urchin2018-07-30v4No1 / 233
169amnoncommon lake, photic zone, water, fresh water, canada, depth (water) 0-100cm, depth (water) 20-100cm2017-07-24v4No1 / 234
492amnoncommon skin, adult, rana catesbeiana, bullfrog, frog, lithobates catesbeianus, japan2019-02-27v4No1 / 236
286amnoncommon in feces of individuals with kidney stones (common feces, homo sapiens, adult, nanning city prefecture, nephrolithiasis, china, sixth decade human stage)2018-01-27v4No1 / 239
483amnoncommon united states of america, research facility, hawaii, pearl harbor, hydroides elegans, tubeworm, shelled egg2019-02-13v4No1 / 243
161amnoncommon in barn swallows in colorado (common feces, united states of america, state of colorado, hirundo rustica, barn swallow)2017-07-12v4No1 / 245
384amnon high in pasture compared to hay barn in farm saliva equus caballus canada horse mouth 2018-10-22v4No1 / 245
101amnon high in soil compared to rhizosphere in united states of america vitis vinifera state of new york merlot grapevine 2017-04-03v4No1 / 249
351amnoncommon united states of america, research facility, coelomic fluid, state of florida, eagle harbor, lytechinus variegatus, sea urchin2018-07-30v4No1 / 249
45amnonlower in young babies compared to 2 year olds in india ( high in age 1-year-old human stage compared to under-1-year-old human stage in feces homo sapiens infant india )2016-12-19v4No1 / 253
214amnon high in diet high fat diet compared to mouse chow nih 31m chow in feces united states of america research facility mus musculus mouse 2017-10-23v4No1 / 255
788amnoncommon united states of america, state of georgia, mesocosm, plant litter2021-05-31v4No1 / 259
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in feces homo sapiens adult bangladesh )2017-04-13v4No1 / 263
458amnonlower in mice from hsd compared to jackson laboratories ( high in jackson laboratories compared to harlan spague dawley in feces united states of america female research facility mus musculus mouse )2019-01-11v4No1 / 267
361amnoncommon leaf, austria, plant, greenhouse, chlorophytum comosum2018-08-21v4No1 / 270
499amnoncommon digestive system, pond, intestine, brazil, fish, astyanax paranae, astyanax2019-03-05v4No1 / 273
315amnoncommon in frog pond water (common pond, water, fresh water, jiangxi province, hunan province, china)2018-04-10v4No1 / 274
160amnoncommon in river water upstream of WTP effluent in spring in china (common river, water, china, spring)2017-07-12v4No1 / 278
225amnoncommon in polgA mutants (accelerated aging) (common feces, research facility, mus musculus, mouse, polga mutant, united kingdom)2017-10-29v4No1 / 281
286amnoncommon in feces of individuals without kidney stones (common feces, homo sapiens, control, adult, nanning city prefecture, china, sixth decade human stage)2018-01-27v4No1 / 281
357amnon high in ph<4 compared to ph>4 in soil topsoil depth (soil) 0-10cm southern temperate forest temperate broadleaf and mixed forest biome woodland area forest ecosystem 2018-08-19v4No1 / 282
433amnon high in indian ocean compared to coast south china sea in ocean sea water depth (water) 4m 2018-12-19v4No1 / 283
171amnonlower in roots of drought irrigated rice compared to irrigated conrols ( high in control compared to drought environment in united states of america oryza sativa state of california rice root )2017-07-25v4No1 / 288
423amnoncommon skin, ukraine, bank vole, myodes glareolus2018-12-05v4No1 / 291
37amnoncommon in plastic leaf plants (in field next to tomato plants) (common leaf, maryland county)2016-12-09v4No1 / 298
499amnoncommon digestive system, pond, intestine, poecilia reticulata, brazil, fish, guppy2019-03-05v4No1 / 308
816amnon high in late pregnancy compared to early pregnancy in feces united states of america pregnancy research facility sus scrofa commonwealth of pennsylvania pig female organism adult organism 2021-07-04v4No1 / 312
534amnoncommon river, water, fresh water, nepal, depth (water) 10cm, filtered 2.7um, particle bound, koshi river2019-07-22v4No1 / 315
510amnoncommon estuary, water, fresh water, kingdom of spain, estuary water, salinity <5 ppt, bilbao2019-03-20v4No1 / 317
650amnon high in asian compared to caucasian european in feces homo sapiens united states of america adult state of new york 2020-09-12v4No1 / 317
299amnon high in mouth neoplasm cancer compared to control in homo sapiens saliva adult china 2018-02-27v4No1 / 319
311amnoncommon in floor of kimchi production facility (common united states of america, food processing factory, state of rhode island, floor)2018-04-09v4No1 / 324
782amnon high in skin compared to gill in fish farm portuguese republic sparus aurata ria formosa open water pond seabream 2021-05-06v4No1 / 325
61amnoncommon united states of america, research facility, skin, inguinal region, canis lupus familiaris2017-02-05v4No1 / 327
471amnon high in adult compared to tadpole in digestive system united states of america research facility state of florida frog osteopilus septentrionalis 2019-01-14v4No1 / 328
423amnon high in human contact compared to no human contact chernobyl exclusion zone in skin ukraine bank vole myodes glareolus 2018-12-05v4No1 / 334
819amnon high in baoding city prefecture high atmospheric pollution compared to dalian city prefecture low atmospheric pollution in homo sapiens female skin adult scalp china age 25-45 years 2021-07-12v1No1 / 337
129amnoncommon rhizosphere, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid2017-04-15v4No1 / 338
351amnoncommon in artificial sea water where sea urchins were grown (common united states of america, research facility, sea water, state of florida, lytechinus variegatus, sea urchin, artificial seawater)2018-07-30v4No1 / 338
190amnon high in wet season compared to dry season in feces homo sapiens tanzania hunter gatherer hadza 2017-09-04v4No1 / 341
254amnoncommon river, water, fresh water, fujian province, depth (soil) 50cm, jiulong river, china2017-11-23v4No1 / 347
618amnoncommon farm, canada, root endosphere, root, cannabis sativa, late flowering stage2020-05-04v4No1 / 352
209amnonhigher in whale blow condensate compared to ocean water ( high in respiratory airway megaptera novaeangliae humpback whale exhaled air condensate whale blow compared to ocean sea water depth (water) 25cm in north america )2017-10-15v4No1 / 359
337amnonlower in manhattan compared to queens in feces of house mice from new york city ( high in queens region compared to manhatten region in united states of america city mus musculus new york city mouse house mice )2018-05-18v4No1 / 362
341amnonhigher in fresh drinking water compared to week old water ( high in fresh water compared to stagnant water in united states of america water drinking water tap water state of illinois )2018-05-28v4No1 / 365
225amnoncommon in wild type cotrols (common feces, research facility, mus musculus, wild type genotype, mouse, united kingdom)2017-10-29v4No1 / 370
62amnoncommon feces, homo sapiens, united states of america, child, obsolete_juvenile stage2017-02-13v4No1 / 373
582amnon high in external acoustic meatus ear canal compared to rectum perianal skin in united states of america wild santa catalina island urocyon littoralis urocyon littoralis catalinae santa catalina island fox 2020-01-22v4No1 / 374
160amnoncommon in river water upstream of WTP effluent in autumn in china (common river, water, autumn, china)2017-07-12v4No1 / 376
400amnonhigher in people from thailand compared to 2nd generation immigrants to usa ( high in thailand rural community compared to united states of america in feces homo sapiens )2018-11-18v4No1 / 378
29amnon high in seed compared to seedling in brassica oleracea french republic 2016-12-05v4No1 / 379
458amnonhigher in C57BL/6 strain compared to A/J and BALB/c strains ( high in c57bl/6 compared to balb/c a/j in feces united states of america female research facility mus musculus mouse )2019-01-11v4No1 / 380
718amnon high in epilimnion compared to hypolimnion in united states of america state of wisconsin dimictic lake bog lake freshwater lake ph 4.5-5 "south sparkling bog" lake 2028-05-23v4No1 / 382
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum left colon right colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
170amnonhigher in low turbidity river water ( high in turbidity low turbidity compared to high turbidity in united states of america river stream water fresh water depth (water) 10cm )2017-07-24v4No1 / 395
412amnonhigh in pig manured soil with wheat-maize rotation compared to non-manured soil ( high in manured soil compared to non-manured soil in soil cambisol red soil zea mays triticum aestivum hunan province china )2018-11-26v4No1 / 395
342amnoncommon water, sea water, pacific ocean, philippine sea, depth (water) 150m2018-05-28v4No1 / 397
722amnon high in surface water sea water compared to sediment marine sediment sediment surface in united states of america estuary state of new york new york city 2021-01-02v4No1 / 399
558amnon high in gizzard compared to crop in united states of america state of wyoming bird centrocercus urophasianus greater sage-grouse 2019-09-20v4No1 / 408
28amnon high in feces achatinella mustelina compared to leaf whole plant in hawaii 2016-12-05v4No1 / 413
425amnon high in feces compared to duodenum in homo sapiens child africa 2018-12-08v4No1 / 416
353amnoncommon in wild Lissotriton vulgaris newts skin (common skin, adult, cambridgeshire, newt, lissotriton vulgaris, united kingdom)2018-07-30v4No1 / 418
612amnoncommon united states of america, water, fresh water, state of florida, spring water, location 32020-04-22v4No1 / 420
62amnoncommon feces, homo sapiens, child, egypt, obsolete_juvenile stage2017-02-13v4No1 / 422
792amnon high in soil compared to rhizosphere haloxylon ammodendron nitraria tangutorum in desert depth (soil) 50cm china minqin county sand ph 9 depth (soil) 20-60cm 2021-06-07v4No1 / 432
360amnoncommon desert, soil, mexico, guanajuato2018-08-21v4No1 / 437
99amnoncommon united states of america, mucus, skin, commonwealth of virginia, pseudacris crucifer, peeper2017-04-02v4No1 / 438
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in city wastewater treatment plant south america )2017-01-21v4No1 / 440
283amnoncommon digestive system, research facility, hindgut, kingdom of denmark, pycnoscelus surinamensis, cockroach, burrowing cockroach2018-01-25v4No1 / 448
504amnoncommon water, sea water, nan'ao island, china2019-03-14v4No1 / 452
353amnoncommon in wild Triturus cristatus newts skin (common skin, adult, cambridgeshire, newt, triturus cristatus, united kingdom)2018-07-30v4No1 / 456
504amnon high in water sea water compared to sediment marine sediment in nan'ao island china 2019-03-14v4No1 / 462
160amnoncommon in wastewater treatment plant effluent in autumn in china (common wastewater treatment plant, effluent, autumn, china)2017-07-12v4No1 / 469
360amnoncommon desert, soil, rhizosphere, mexico, guanajuato, agave, agave salmiana2018-08-21v4No1 / 484
438amnon high in adult 65-79 year-old human stage fourth decade human stage fifth decade human stage compared to child age 3-6 age 8-12 2-5 year-old child stage 6-12 year-old child stage in feces homo sapiens china 2018-12-30v4No1 / 486
718amnon high in epilimnion compared to hypolimnion in united states of america state of wisconsin dimictic lake bog lake freshwater lake ph 4.5-5 "north sparkling bog" lake 2028-05-23v4No1 / 488
375amnoncommon in oil contaminated desert soil (common desert, soil, oil contaminated soil, kuwait)2018-09-09v4No1 / 490
415amnoncommon united states of america, orchard, soil, rhizosphere, citrus, cultivated environment2018-11-27v4No1 / 494
360amnoncommon desert, soil, mexico, guanajuato, cultivated environment2018-08-21v4No1 / 500
718amnon high in epilimnion compared to hypolimnion in united states of america state of wisconsin dimictic lake bog lake freshwater lake ph 4.5-5 "trout bog" lake 2028-05-23v4No1 / 509
618amnon high in root endosphere root compared to rhizosphere in farm canada cannabis sativa 2020-05-04v4No1 / 510
615amnon high in endosphere root compared to rhizosphere in brazil greenhouse campinas saccharum sugarcane 2020-04-27v4No1 / 529
27amnoncommon rumen, bos grunniens, china2016-12-05v4No1 / 532
98amnoncommon rhizosphere, state of florida, citrus, vero beach, fl, root2017-04-01v4No1 / 544
462amnon high in populus deltoides compared to populus trichocarpa x deltoides in united states of america state of tennessee leaf populus tree cultivated environment 2019-01-13v4No1 / 559
600sheryohigher in stover ammendment soil ( high in stover amended soil compared to unamended soil in united states of america soil state of new york ph 6 coarse-loamy soil day 82 depth (soil) 0-5cm )2020-03-27v4No1 / 567
160amnoncommon in wastewater treatment plant effluent in spring in china (common wastewater treatment plant, effluent, china, spring)2017-07-12v4No1 / 573
667amnoncommon soil, topsoil, jiangxi province, ph 4.5, forested area, china, lushan mountain, elevation 500-600m, depth (soil) 0-20cm2020-09-25v4No1 / 575
254amnon high in summer wet season compared to winter autumn dry season in river water fresh water fujian province depth (soil) 50cm jiulong river china 2017-11-23v4No1 / 581
788amnon high in feces cherokia georgiana georgiana millipede compared to soil in united states of america state of georgia mesocosm 2021-05-31v4No1 / 589
146amnon high in rhizosphere compared to soil in united states of america solanum lycopersicum tomato ph 6 slit loam 2017-04-20v4No1 / 590
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in estuary water kingdom of spain estuary water bilbao 2019-03-20v4No1 / 592
360amnon high in rhizosphere agave compared to soil in desert state of california mexico 2018-08-21v4No1 / 593
792amnoncommon desert, soil, depth (soil) 50cm, china, minqin county, sand, ph 9, depth (soil) 20-60cm2021-06-07v4No1 / 595
788amnoncommon feces, united states of america, state of georgia, mesocosm, cherokia georgiana georgiana, millipede2021-05-31v4No1 / 607
518amnonhigher in end of experiment (older steers) ( high in days 14-28 compared to days 1-2 in feces united states of america bos taurus state of georgia cow post-weaning angus steer )2019-06-11v4No1 / 609
667amnoncommon soil, topsoil, jiangxi province, ph 4.5, forested area, china, elevation 200-300m, lushan mountain, depth (soil) 0-20cm2020-09-25v4No1 / 613
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age >94 65-79 year-old human stage fourth decade human stage fifth decade human stage ninth decade human stage tenth decade human stage compared to soldiers young adult stage in feces homo sapiens china )2018-12-30v4No1 / 617
264amnoncommon research facility, caecum, oryctolagus cuniculus, rex rabbit, jiangsu province, china2017-12-11v4No1 / 622
667amnoncommon soil, topsoil, jiangxi province, forested area, coniferous forest biome, china, lushan mountain, elevation 1000-1100m, ph 4-4.5, depth (soil) 0-20cm2020-09-25v4No1 / 630
308amnoncommon united states of america, research facility, shell, state of california, haliotis sorenseni, white abalone2018-03-30v4No1 / 632
360amnonhigher in leaf surface compared to soil in agave plants ( high in leaf leaf surface compared to soil in desert state of california mexico guanajuato agave )2018-08-21v4No1 / 645
360amnoncommon desert, leaf, state of california, agave, agave deserti, leaf surface2018-08-21v4No1 / 649
548amnoncommon rhizosphere, brazil, minas gerais state, campos rupestres, barbacenia macrantha2019-08-17v4No1 / 651
443amnonhigher in lower mississippi river (downstream) compared to upper mississippi river ( high in downstream lower mississippi river compared to upstream higher mississippi river in united states of america river water fresh water mississippi river free floating depth (water) 1m filtered 0.2um )2019-01-07v4No1 / 652
200amnoncommon in river downstream of wastewater treatment plant (common united states of america, river, water, fresh water, wastewater treatment plant, effluent)2017-10-01v4No1 / 655
612amnoncommon united states of america, water, fresh water, state of florida, spring water, location 42020-04-22v4No1 / 655
237amnonhigher deep in burrow compared to burrow entrance ( high in deep burrow compared to surface burrow in soil canada bon portage island bird oceanodroma leucorhoa seabird burrow )2017-11-07v4No1 / 676
416amnon high in mulch diet compared to wood diet in united states of america research facility colon termite reticulitermes flaviceps 2018-11-30v4No1 / 681
100amnoncommon park, soil, urban biome, new york city, central park2017-04-03v4No1 / 685
128amnoncommon leaf, belgium, ivy, forest ecosystem, hedera hibernica2017-04-14v4No1 / 693
667amnoncommon soil, topsoil, jiangxi province, ph 4.5, forested area, china, lushan mountain, elevation 800-900m, depth (soil) 0-20cm2020-09-25v4No1 / 694
808amnon high in mucosa compared to digesta in research facility caecum gallus gallus germany chicken age 35 weeks hen 2021-06-20v1No1 / 701
809amnoncommon research facility, rhizosphere, greenhouse, china, lu'an city prefecture, dendrobium officinale, flowerpot2021-06-20v4No1 / 715
415amnoncommon orchard, soil, rhizosphere, reunion island, citrus, cultivated environment2018-11-27v4No1 / 721
813amnoncommon united states of america, soil, state of washington, forested area, olympic national park, temperate rainforest2021-06-22v4No1 / 740
415amnoncommon orchard, soil, rhizosphere, australia, citrus, cultivated environment2018-11-27v4No1 / 743
271amnon high in rhizosphere glycine max soybean compared to soil in china depth (soil) 0-20cm 2018-01-09v4No1 / 750
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 752
206amnoncommon in air from israel particles <10um size (common air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 765
171amnon high in drought environment compared to control in united states of america soil rhizosphere oryza sativa state of california rice 2017-07-25v4No1 / 770
171amnoncommon united states of america, soil, rhizosphere, oryza sativa, state of california, rice2017-07-25v4No1 / 772
615amnoncommon brazil, endosphere, greenhouse, root, campinas, saccharum, sugarcane2020-04-27v4No1 / 776
667amnoncommon soil, topsoil, jiangxi province, ph 4, forested area, coniferous forest biome, china, lushan mountain, elevation 1300-1400m, depth (soil) 0-20cm2020-09-25v4No1 / 777
615amnoncommon in control soil with no sugarcane (common soil, brazil, greenhouse, campinas)2020-04-27v4No1 / 780
548amnoncommon in endopytic roots of Vellozia epidendroides (common brazil, minas gerais state, plant, campos rupestres, vellozia epidendroides, root)2019-08-15v4No1 / 800
412amnoncommon soil, cambisol, red soil, zea mays, triticum aestivum, hunan province, ph<5, china2018-11-26v4No1 / 823
415amnoncommon orchard, soil, rhizosphere, citrus, cultivated environment, china2018-11-27v4No1 / 830
517amnon high in arm skin forearm compared to feces in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 836
412amnoncommon soil, cambisol, red soil, zea mays, triticum aestivum, hunan province, ph>5, china2018-11-26v4No1 / 856
767sheryoCommon in soil planted with Chrysanthemum, fertilized with bio-organic fertilizer in Nanjing China (common soil, compost biofilter, compost, pig manure, paenibacillus, china, nanjing county, chrysanthemum, bio-organic fertilizer, chrysanthemum morifolium ramat., ph 6.9, paenibacillus polymyxa)2021-04-14v4No1 / 866
618amnoncommon farm, rhizosphere, canada, cannabis sativa, early flowering stage2020-05-04v4No1 / 873
665amnon high in late time points compared to early time points in united states of america state of california biomat microbial biomat water treatment pond benthic biomat engineered wetland 2020-09-23v4No1 / 884
171amnoncommon in soil with rice growth irrigation protocol (common united states of america, soil, state of california, depth 5cm)2017-07-25v4No1 / 890
462amnon high in leaf compared to stem in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 890
146amnoncommon united states of america, rhizosphere, solanum lycopersicum, tomato, slit loam soil, ph 62017-04-20v4No1 / 894
479amnoncommon united states of america, rhizosphere, state of california, ph 6-7, ceanothus jepsonii2019-02-05v4No1 / 900
206amnoncommon in dust storm air from israel particles <10um size (common air, dust, israel, size < 10um, dust storm)2017-10-04v4No1 / 902
462amnoncommon united states of america, state of tennessee, rhizosphere, populus, tree, silt clay loam, depth 30-75cm, cultivated environment, depth (soil) 20-60cm2019-01-13v4No1 / 908
103amnoncommon united states of america, river, aquatic biome, fresh water, mississippi river, particles2017-04-05v4No1 / 909
103amnoncommon united states of america, river, aquatic biome, fresh water, mississippi river, free floating2017-04-05v4No1 / 909
767sheryocommon in soil planted with Chrysanthemum, infested with fusarium in Nanjing China (common soil, fusarium, china, nanjing county, chrysanthemum, chrysanthemum morifolium ramat., ph 6.9, fusarium oxysporum f. sp. chrysanthemi)2021-04-14v4No1 / 922
767sheryoCommon in soil planted with Chrysanthemum, amended with soil fumigant 'Dazomet' in Nanjing China (common soil, china, nanjing county, chrysanthemum, chrysanthemum morifolium ramat., ph 6.9, soil fumigation, dazomet)2021-04-14v4No1 / 946
414amnon high in ph<6 npk fertilizer compared to ph>6 in agricultural feature soil zea mays glycine max triticum aestivum heilongjiang province black soil mollisol china 2018-11-26v4No1 / 963
624sheryoCommon in ryegrass rhizosphere soil after 30-40 days (common soil, rhizosphere, 10 cm depth, jiangsu province, ph 7-8, china, ryegrass, days 30-40)2020-05-11v4No1 / 966
129amnoncommon soil, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, root zone soil, ph 6-6.52017-04-15v4No1 / 968
615amnoncommon rhizosphere, brazil, greenhouse, campinas, saccharum, sugarcane2020-04-27v4No1 / 974
323amnonlower in sharks compared to sea water ( high in water surface water sea water depth (water) 0cm compared to shark in united states of america atlantic ocean state of florida south florida )2018-04-24v4No1 / 979
462amnoncommon united states of america, state of tennessee, rhizosphere, populus, tree, silt loam, cultivated environment, depth (soil) 0-20cm, depth (soil) 0-30 cm2019-01-13v4No1 / 997
809amnoncommon research facility, rhizosphere, greenhouse, china, lu'an city prefecture, dendrobium moniliforme, flowerpot2021-06-20v4No1 / 1002
479amnoncommon united states of america, rhizosphere, state of california, ph 6-7, heteromeles arbutifolia2019-02-05v4No1 / 1006
517amnon high in arm skin forearm compared to mouth mucosa mouth in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 1014
624sheryocommon in ryegrass rhizosphere soil amended with biochar after 30-40 days (common soil, rhizosphere, 10 cm depth, jiangsu province, ph 7-8, biochar, china, ryegrass, days 30-40)2020-05-11v4No1 / 1017
801sheryoHigher at depth 0-15cm compared to depth 60-90cm in corn and soybean agriculture fields, Iowa USA ( high in depth (soil) 0-15cm compared to depth (soil) 60-90cm in soil zea mays glycine max iowa agricultural field united states des moines nicollet soil series kelley subsurface drainage )2021-06-16v4No1 / 1036
548amnoncommon rhizosphere, brazil, minas gerais state, campos rupestres, vellozia epidendroides2019-08-15v4No1 / 1040
618amnon high in early flowering stage compared to late flowering stage in farm rhizosphere canada cannabis sativa 2020-05-04v4No1 / 1040
828sheryoCommon in gleysol soil of poplar plantation at 0-10cm depth, sihong, china (common soil, jiangsu province, depth (soil) 0-10cm, clay loam, ph 6-7, gleysol, china, sihong county, poplar, poplar plantation, chenwei forest)2021-08-25v4No1 / 1069
252amnoncommon in river rock biofilm (common river, rock, biofilm, kingdom of spain, epilithic, biofilm)2017-11-22v4No1 / 1081
415amnoncommon orchard, soil, rhizosphere, brazil, citrus, cultivated environment2018-11-27v4No1 / 1091
415amnoncommon orchard, soil, rhizosphere, kingdom of spain, citrus, cultivated environment2018-11-27v4No1 / 1099
414amnoncommon agricultural feature, soil, zea mays, glycine max, triticum aestivum, heilongjiang province, ph<6, black soil, mollisol, npk fertilizer, china2018-11-26v4No1 / 1105
5amnoncommon periplaneta americana, digestive system, united states of america, wild type2016-10-13v4No1 / 1142
746sheryoCommon in saline soil in dafeng, china (common jiangsu province, solonchak, china, dafeng city, ph 7.6, saline soil)2021-03-03v4No1 / 1170
252amnoncommon in river sand biofilm (common river, biofilm, sand, kingdom of spain, biofilm)2017-11-22v4No1 / 1181
421amnoncommon soil, paddy field soil, zhejiang province, china2018-12-04v4No1 / 1194
801sheryoCommon at depth 0-15cm in corn and soybean agriculture fields, Iowa USA (common soil, zea mays, glycine max, iowa, agricultural field, united states, des moines, depth (soil) 0-15cm, nicollet soil series, kelley, ph 6.2, subsurface drainage)2021-06-15v4No1 / 1202
415amnoncommon orchard, soil, rhizosphere, italy, citrus, cultivated environment2018-11-27v4No1 / 1279
821sheryoCommon in soil of restored prairie at 0-10cm depth, Michigan USA (common united states of america, soil, state of michigan, depth (soil) 0-10cm, ph 6.5, kalamazoo loam, mesic type hapludalf, kellogg biological station, restored prairie)2021-07-28v4No1 / 1291
837sheryoCommon in soil at 0-40-100cm depth after 20 years reforestation with Black locust trees, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 40-100cm, 20 years)2021-09-26v4No1 / 1294
837sheryoCommon in soil at 0-40cm depth after 20 years reforestation with Black locust trees, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 0-40cm, 20 years)2021-09-26v4No1 / 1323
783sheryocommon in desert soil in mongolia without water addition treatment (common soil, mongolia, sandy desert, bajada, china, dengkou county, ph 7.85, ulan buh desert, cambic arenosols, luvic gypsisols, ambient precipitation, no water addition)2021-05-11v4No1 / 1324
600sheryoCommon in stover ammended soil after 82 days (common united states of america, soil, state of new york, ph 6, coarse-loamy soil, day 82, stover ammendment , depth (soil) 0-5cm)2020-03-27v4No1 / 1327
259amnoncommon in soil and rhizpsphere of peanut plants (common soil, rhizosphere, arachis hypogaea, ph 5, peanut, china)2017-12-02v4No1 / 1334
98amnoncommon rhizosphere, state of florida, citrus, ft. pierce, fl, root2017-04-01v4No1 / 1340
809amnoncommon research facility, rhizosphere, greenhouse, china, lu'an city prefecture, dendrobium huoshanense, flowerpot2021-06-20v4No1 / 1356
422amnoncommon soil, paddy field soil, oryza sativa, hubei province, hunan province, cultivated environment, china2018-12-02v4No1 / 1399
443amnonhigher in lower mississippi river (downstream) compared to upper mississippi river ( high in downstream lower mississippi river compared to upstream upper mississippi river in united states of america river water fresh water mississippi river particles depth (water) 1m filtered 2.7um )2019-01-07v4No1 / 1418
40amnoncommon soil, field soil, rhizosphere, nicotiana tabacum, china2016-12-09v4No1 / 1420
462amnon high in rhizosphere compared to soil in united states of america state of tennessee populus tree cultivated environment 2019-01-12v4No1 / 1428
783sheryocommon in desert soil in mongolia under water addition treatment (common soil, mongolia, sandy desert, bajada, china, dengkou county, ph 7.85, ulan buh desert, cambic arenosols, luvic gypsisols, water addition, 100% above ambient precipitation)2021-05-11v4No1 / 1442
271amnoncommon rhizosphere, glycine max, soybean, china, depth (soil) 0-20cm2018-01-09v4No1 / 1459
608sheryoCommon in wheat field in China, amended and unamended biochar, unamended with nitrogen fertilizer (common soil, china, silty clay, triticum aestivum l. cv., xiaoyan no. 22)2020-04-20v4No1 / 1643
154amnon high in control compared to uranium high uranium in sediment soil australia kakadu national park 2017-06-29v4No1 / 1663
760sheryoCommon in rhizosphere soil of rice plants with manure fertilization in a long term fertilization experiment (common soil, manured soil, rhizosphere, oryza sativa, hunan province, china, qiyang county, quaternary red clay, ph 5.9, manure fertilization)2021-04-06v4No1 / 1670
696amnon high in alycaeus jagori compared to opisthostoma concinnum plectostoma concinnum in stomach gastrointestinal system malaysia state of sabah land snail 2028-03-28v3No1 / 1672
608sheryoCommon in wheat field in China, amended and unamended biochar, amended with nitrogen fertilizer (common soil, urea enriched soil, china, silty clay, triticum aestivum l. cv., xiaoyan no. 22)2020-04-20v4No1 / 1682
819amnon high in skin of cheek compared to scalp in homo sapiens female skin adult china age 25-45 years 2021-07-12v1No1 / 1684
696amnon high in alycaeus jagori compared to georissa georissa similis in stomach gastrointestinal system malaysia state of sabah land snail 2028-03-28v3No1 / 1698
155amnonhigher in tightly bound root soil compared to loose soil and bulk soil ( high in root compared to bulk soil in soil triticum aestivum wheat china )2017-07-02v4No1 / 1714
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in skin adult cambridgeshire newt triturus cristatus united kingdom )2018-07-30v4No1 / 1834
296amnoncommon agricultural feature, soil, winter, wheat, north china plain, ph>4, ph<5, china, depth (soil) 0-20cm2018-02-11v4No1 / 1886
155amnoncommon in soil tightly bound to wheat root (common soil, triticum aestivum, wheat, root, china)2017-07-02v4No1 / 1977
175amnoncommon in heavy metal contaminated soils in china (common soil, heavy metal, ph 7-9, china)2017-07-29v4No1 / 2133
808amnon high in caecum compared to ileum in research facility mucosa gallus gallus germany chicken age 35 weeks hen 2021-06-20v1No1 / 2147
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in skin adult cambridgeshire newt lissotriton vulgaris united kingdom )2018-07-30v4No1 / 2162
296amnoncommon agricultural feature, soil, winter, wheat, north china plain, ph>6, ph<7, china, depth (soil) 0-20cm2018-02-11v4No1 / 2223
166amnoncommon in river sediment (5cm) with mussels (common united states of america, river, sediment, freshwater biome, mississippi river, depth 5cm, upper mississippi river, mussel, unionidae)2017-07-18v4No1 / 2254
296amnoncommon in wheat field soil (common agricultural feature, soil, winter, depth 5cm, wheat, north china plain, china)2018-02-11v4No1 / 2341
101amnoncommon united states of america, soil, vitis vinifera, state of new york, merlot, grapevine2017-04-03v4No1 / 2537
296amnoncommon agricultural feature, soil, winter, wheat, north china plain, ph>8, china, depth (soil) 0-20cm2018-02-11v4No1 / 2646
271amnoncommon soil, china, depth (soil) 0-20cm2018-01-09v4No1 / 2856
642amnon high in sediment marine sediment compared to water saline water sea water in pacific ocean san diego 2020-08-28v4No1 / 3217
296amnoncommon agricultural feature, soil, winter, wheat, north china plain, ph>5, ph<6, china, depth (soil) 0-20cm2018-02-11v4No1 / 3508
103amnonhigher in particle bound fraction compared to free floating bacteria in mississippi river ( high in particles compared to free floating in united states of america river aquatic biome fresh water mississippi river )2017-04-05v4No1 / 3559
837sheryoHigher in soil after 20 years compared to 30 years of reforestation with Black locust trees, shaanxi, China ( high in 20 years compared to 30 years in soil silt loam reforestation china shaanxi province loess plateau robinia pseudoacacia )2021-09-27v4No1 / 3893
837sheryoHigher in soil after 10 years reforestation with Black locust trees compared to agricultural feild, shaanxi, China ( high in reforestation robinia pseudoacacia 10 years compared to zea mays wheat agricultural field in soil silt loam china shaanxi province loess plateau )2021-09-26v4No1 / 3932
462amnon high in rhizosphere compared to root in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 4630
837sheryoHigher in soil after 30 years compared to 10 years of reforestation with Black locust trees, shaanxi, China ( high in 30 years compared to 10 years in soil silt loam reforestation china shaanxi province loess plateau robinia pseudoacacia )2021-09-27v4No1 / 5245
837sheryoHigher in soil after 20 years compared to 10 years of reforestation with Black locust trees, shaanxi, China ( high in 20 years compared to 10 years in soil silt loam reforestation china shaanxi province loess plateau robinia pseudoacacia )2021-09-27v4No1 / 5270
837sheryoHigher in soil after 30 years reforestation with Black locust trees compared to agricultural feild, shaanxi, China ( high in reforestation robinia pseudoacacia 30 years compared to zea mays triticum aestivum agricultural field in soil silt loam china shaanxi province loess plateau )2021-09-27v4No1 / 5596
837sheryoHigher in soil after 20 years reforestation with Black locust trees compared agricultural feild, shaanxi, China ( high in reforestation robinia pseudoacacia 20 years compared to zea mays triticum aestivum agricultural field in soil silt loam china shaanxi province loess plateau )2021-09-26v4No1 / 5661
266amnon high in root compared to leaf in united states of america state of idaho plant brassicaceae boechera stricta 2017-12-19v4No1 / 5886
171amnonlower in roots compared to rhizosphere soil in rice ( high in soil rhizosphere compared to root in united states of america oryza sativa state of california rice )2017-07-25v4No1 / 7628

Problems / suggestions? Please email info AT dbbact DOT org