Search result for sequence:
TACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTGATTAAGTTAGATGTGAAATCCCCGGGCTTAACCTGGGAATGGCATCTAAGACTGGTCAGCTAGAGTCTTGTAGAGGGGGGTAGAATTCCATG
common ontology terms
term enrichment score
TermScore
snake0.250000
digestive system0.226415
food (fermented)0.185328
oncorhynchus mykiss0.177215
rainbow trout0.177215
snake farm0.155844
adula0.155844
fish0.135266
ensete ventricosum0.133333
ethiopian banana0.133333
days 30-600.133333
anaerobic fermentation0.133333
skin0.128736
hunan province0.118812
ethiopia0.117647
late timepoint0.117647
research facility0.114493
osteopilus septentrionalis0.112676
southern united states0.109589
china0.102564
frog0.101266
sweden0.100840
united states of america0.097035
farm0.096220
mexico0.094118
state of florida0.087912
desert0.086022
larvae insect diet0.084507
feces0.073949
galapagos islands0.057971
finch0.057971
geospiza difficilis0.057971
sharp-beaked ground finch0.057971
elaphe carinata0.057971
king ratsnake0.057971
musca domestica0.057971
house fly0.057971
naja atra0.057971
chinese cobra0.057971
thamnophis sirtalis0.057971
common garter snake0.057971
wheat bran0.057971
eastern red backed salamander0.057971
plethodon cinereus0.057971
red pepper sauce0.057971
LOWER IN defatted larvae insect diet0.057971
LOWER IN fishmeal diet0.057971
state of rhode island0.057971
ensete ventricosum var. gena0.057971
LOWER IN ensete ventricosum var. maze0.057971
drosophila0.057971
drosophila nigrospiracula0.057971
fly0.057971
pre pupae insect diet0.057971
decaying0.057971
LOWER IN tadpole0.057143
butterfly0.056338
salamander0.056338
capsicum annuum0.056338
cactus0.056338
beetle0.056338
french republic0.055556
whole body0.054795
south korea0.053333
commonwealth of virginia0.053333
costa rica0.051948
sichuan province0.051948
homo sapiens0.051724
bird0.050633
adult0.048780
city0.048780
age0.047619
colon0.047619
child0.047059
larval stage0.043956
mouse0.043321
c57bl/60.042105
mus musculus0.040268
pseudodebis zimri0.029851
fossorial snake0.029851
storeria dekayi0.029851
ground snake0.029851
anal swab0.029851
myotis myotis0.029851
bat0.029851
greater mouse eared bat0.029851
LOWER IN age 28 days0.029851
temp 20c0.029851
LOWER IN temp 10c0.029851
high salt concentration0.029851
LOWER IN low salt concentration0.029851
przewalski horse0.029851
kimchi0.029851
LOWER IN days 1-90.029851
red pepper0.029851
ensete ventricosum var. ketishe0.029851
waste water0.029851
xinxiang city prefecture0.029851
ptyas mucosa0.029851
oriental ratsnake0.029851
Fraction of dbbact annotations with this term covered by the query
TermScore
snake0.666667
osteopilus septentrionalis0.666667
galapagos islands0.500000
finch0.500000
geospiza difficilis0.500000
sharp-beaked ground finch0.500000
snake farm0.500000
adula0.500000
elaphe carinata0.500000
king ratsnake0.500000
pseudodebis zimri0.500000
musca domestica0.500000
house fly0.500000
naja atra0.500000
chinese cobra0.500000
southern united states0.500000
fossorial snake0.500000
storeria dekayi0.500000
ground snake0.500000
thamnophis sirtalis0.500000
common garter snake0.500000
wheat bran0.500000
anal swab0.500000
myotis myotis0.500000
bat0.500000
greater mouse eared bat0.500000
LOWER IN age 28 days0.500000
eastern red backed salamander0.500000
plethodon cinereus0.500000
temp 20c0.500000
LOWER IN temp 10c0.500000
red pepper sauce0.500000
high salt concentration0.500000
LOWER IN low salt concentration0.500000
oncorhynchus mykiss0.500000
rainbow trout0.500000
LOWER IN defatted larvae insect diet0.500000
larvae insect diet0.500000
przewalski horse0.500000
LOWER IN fishmeal diet0.500000
state of rhode island0.500000
kimchi0.500000
LOWER IN days 1-90.500000
red pepper0.500000
ensete ventricosum0.500000
ethiopian banana0.500000
days 30-600.500000
anaerobic fermentation0.500000
ensete ventricosum var. gena0.500000
LOWER IN ensete ventricosum var. maze0.500000
ensete ventricosum var. ketishe0.500000
waste water0.500000
xinxiang city prefecture0.500000
ptyas mucosa0.500000
oriental ratsnake0.500000
drosophila0.500000
drosophila nigrospiracula0.500000
fly0.500000
aquatic snake0.500000
nerodia sipedon0.500000
northern water snake0.500000
fruit feeding0.500000
LOWER IN nectar feeding0.500000
LOWER IN ensete ventricosum var. ketishe0.500000
pre-pupae insect diet0.500000
anaxyrus terrestris0.500000
southern toad0.500000
pre pupae insect diet0.500000
england0.500000
LOWER IN common carp0.500000
LOWER IN cyprinus carpio0.500000
deinagkistrodon acutus0.500000
pit viper0.500000
carnegiea gigantea0.500000
saguaro0.500000
decaying0.500000
pachycereus pringlei0.500000
cardon0.500000
gastric carcinoma0.500000
stomach neoplasm0.500000
LOWER IN cactus0.500000
LOWER IN decaying0.500000
age 12-19 weeks0.500000
LOWER IN age 6-10 weeks0.500000
africa0.500000
antananarivo0.500000
madagascar0.500000
LOWER IN bangui0.500000
LOWER IN central african republic0.500000
age 3-60.500000
age 8-120.500000
LOWER IN age 30-500.500000
LOWER IN age 60-790.500000
carnivorous beetle0.500000
raba river0.500000
bembidion varicolor0.500000
bank vole0.500000
myodes glareolus0.500000
ukraine0.500000
LOWER IN no human contact0.500000
Fraction of annotations for the query sequences containing the term
TermScore
research facility0.276923
united states of america0.276923
feces0.261538
china0.230769
digestive system0.230769
snake0.153846
food (fermented)0.123077
farm0.107692
skin0.107692
fish0.107692
oncorhynchus mykiss0.107692
rainbow trout0.107692
snake farm0.092308
adula0.092308
hunan province0.092308
sweden0.092308
homo sapiens0.092308
adult0.076923
ethiopia0.076923
ensete ventricosum0.076923
ethiopian banana0.076923
late timepoint0.076923
days 30-600.076923
anaerobic fermentation0.076923
southern united states0.061538
frog0.061538
osteopilus septentrionalis0.061538
state of florida0.061538
mexico0.061538
desert0.061538
mus musculus0.046154
mouse0.046154
larvae insect diet0.046154
galapagos islands0.030769
bird0.030769
finch0.030769
geospiza difficilis0.030769
sharp-beaked ground finch0.030769
elaphe carinata0.030769
king ratsnake0.030769
costa rica0.030769
butterfly0.030769
musca domestica0.030769
house fly0.030769
larval stage0.030769
naja atra0.030769
chinese cobra0.030769
thamnophis sirtalis0.030769
common garter snake0.030769
wheat bran0.030769
french republic0.030769
c57bl/60.030769
age0.030769
south korea0.030769
eastern red backed salamander0.030769
plethodon cinereus0.030769
salamander0.030769
commonwealth of virginia0.030769
red pepper sauce0.030769
capsicum annuum0.030769
sichuan province0.030769
LOWER IN defatted larvae insect diet0.030769
LOWER IN fishmeal diet0.030769
state of rhode island0.030769
ensete ventricosum var. gena0.030769
LOWER IN ensete ventricosum var. maze0.030769
city0.030769
drosophila0.030769
drosophila nigrospiracula0.030769
fly0.030769
colon0.030769
pre pupae insect diet0.030769
LOWER IN tadpole0.030769
cactus0.030769
decaying0.030769
child0.030769
whole body0.030769
beetle0.030769
control0.030769
pseudodebis zimri0.015385
fossorial snake0.015385
storeria dekayi0.015385
ground snake0.015385
anal swab0.015385
myotis myotis0.015385
bat0.015385
greater mouse eared bat0.015385
male0.015385
age 21 days0.015385
LOWER IN age 28 days0.015385
breast milk0.015385
LOWER IN mouse chow0.015385
temp 20c0.015385
LOWER IN temp 10c0.015385
high salt concentration0.015385
LOWER IN low salt concentration0.015385
equus przewalskii0.015385
przewalski horse0.015385
zoological garden0.015385
kimchi0.015385
Exp. ID User ID Description Date Region Flag Sequences
440amnoncommon galapagos islands, feces, bird, finch, geospiza difficilis, sharp-beaked ground finch2019-01-06v4No1 / 8
530amnonhighfreq snake, feces, snake farm, farm, adula, hunan province, elaphe carinata, king ratsnake, china2019-07-21v4No1 / 10
501amnonhighfreq costa rica, butterfly, digestive system, pseudodebis zimri2019-03-08v4No1 / 11
440amnonhighfreq galapagos islands, feces, bird, finch, geospiza difficilis, sharp-beaked ground finch2019-01-06v4No1 / 12
165amnonhigh freq. in house fly larva grown on moist wheat bran (highfreq research facility, musca domestica, house fly, larval stage, digestive system, china)2017-07-16v4No1 / 13
530amnonhighfreq snake, feces, snake farm, farm, adula, hunan province, naja atra, chinese cobra, china2019-07-21v4No1 / 13
536amnonhighfreq snake, skin, united states of america, southern united states, fossorial snake, storeria dekayi, ground snake2019-07-28v4No1 / 15
536amnonhighfreq snake, skin, united states of america, southern united states, thamnophis sirtalis, common garter snake2019-07-28v4No1 / 18
165amnonhigh freq. in moist wheat bran (highfreq research facility, wheat bran, china)2017-07-16v4No1 / 19
489amnonhighfreq feces, anal swab, myotis myotis, bat, greater mouse eared bat, french republic2019-02-25v4No1 / 19
471amnonhighfreq digestive system, frog, osteopilus septentrionalis, research facility, united states of america, adult, state of florida2019-01-14v4No1 / 24
165amnoncommon in house fly larva grown on moist wheat bran (common research facility, musca domestica, house fly, larval stage, digestive system, china)2017-07-16v4No1 / 29
165amnoncommon in moist wheat bran (common research facility, wheat bran, china)2017-07-16v4No1 / 32
219amnonhigher in pre-weaning compared to post-weaning in mouse feces ( high in age age 21 days breast milk compared to age 28 days mouse chow in mus musculus mouse feces c57bl/6 male research facility south korea )2017-10-24v4No1 / 36
427amnonhigher in salamanders kept at 20C compared to 10C ( high in temp 20c compared to temp 10c in united states of america eastern red backed salamander plethodon cinereus salamander feces commonwealth of virginia )2018-12-08v4No1 / 39
547amnon high in high salt concentration compared to low salt concentration in red pepper sauce capsicum annuum sichuan province china food (fermented) 2019-08-15v4No1 / 43
392amnon high in larvae insect diet compared to defatted larvae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 46
547amnoncommon red pepper sauce, capsicum annuum, sichuan province, china, food (fermented)2019-08-15v4No1 / 49
406amnoncommon feces, equus przewalskii, przewalski horse, zoological garden, united states of america2018-11-21v4No1 / 50
392amnon high in larvae insect diet compared to fishmeal diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 51
392amnoncommon fish, oncorhynchus mykiss, rainbow trout, digestive system, sweden, research facility, larvae insect diet2018-11-05v4No1 / 55
311amnonlower in fermneted kimchi days>1 compared to day 0 ( high in day 0 early timepoints compared to days 1-9 in united states of america state of rhode island kimchi food (fermented) )2018-04-09v4No1 / 62
311amnoncommon united states of america, state of rhode island, red pepper, foodon product type2018-04-09v4No1 / 63
530amnoncommon snake, feces, snake farm, farm, adula, hunan province, elaphe carinata, king ratsnake, china2019-07-21v4No1 / 63
539amnon high in ensete ventricosum var. gena compared to ensete ventricosum var. maze in ethiopia ensete ventricosum ethiopian banana late timepoint days 30-60 anaerobic fermentation food (fermented) 2019-07-31v4No1 / 65
539amnon high in ensete ventricosum var. ketishe compared to ensete ventricosum var. maze in ethiopia ensete ventricosum ethiopian banana late timepoint days 30-60 anaerobic fermentation food (fermented) 2019-07-31v4No1 / 74
513amnoncommon waste water, hospital, city, xinxiang city prefecture, china2019-03-25v4No1 / 86
530amnoncommon snake, feces, snake farm, farm, adula, hunan province, ptyas mucosa, oriental ratsnake, china2019-07-21v4No1 / 86
530amnoncommon snake, feces, snake farm, farm, adula, hunan province, naja atra, chinese cobra, china2019-07-21v4No1 / 90
471amnoncommon digestive system, frog, osteopilus septentrionalis, research facility, united states of america, adult, state of florida2019-01-14v4No1 / 94
201amnoncommon in cactus fly whole body (common drosophila, drosophila nigrospiracula, fly, mexico, desert, body proper)2017-10-01v4No1 / 101
536amnoncommon snake, skin, united states of america, southern united states, thamnophis sirtalis, common garter snake2019-07-28v4No1 / 110
536amnoncommon snake, skin, united states of america, southern united states, aquatic snake, nerodia sipedon, northern water snake2019-07-28v4No1 / 111
501amnonlower in nectar feeding butterflies compared to fruit feeding ( high in fruit feeding compared to nectar feeding in costa rica butterfly digestive system )2019-03-09v4No1 / 116
539amnon high in ensete ventricosum var. gena compared to ensete ventricosum var. ketishe in ethiopia ensete ventricosum ethiopian banana late timepoint days 30-60 anaerobic fermentation food (fermented) 2019-07-31v4No1 / 123
427amnoncommon united states of america, eastern red backed salamander, plethodon cinereus, salamander, feces, commonwealth of virginia2018-12-08v4No1 / 125
392amnoncommon digestive system, research facility, oncorhynchus mykiss, sweden, fish, rainbow trout, pre-pupae insect diet2018-11-05v4No1 / 126
108amnoncommon research facility, texas, united states of america, colon, anaxyrus terrestris, southern toad2017-04-07v4No1 / 132
392amnon high in pre pupae insect diet compared to defatted larvae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 134
396amnon high in rainbow trout oncorhynchus mykiss compared to common carp cyprinus carpio in fish england intestine digestive system 2018-11-14v4No1 / 142
392amnon high in pre pupae insect diet compared to fishmeal diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 153
539amnoncommon ethiopia, ensete ventricosum, ethiopian banana, late timepoint, days 30-60, anaerobic fermentation, food (fermented)2019-07-31v4No1 / 161
322amnon high in adult compared to tadpole in frog osteopilus septentrionalis united states of america state of florida research facility digestive system 2018-04-23v4No1 / 163
530amnoncommon snake, deinagkistrodon acutus, pit viper, feces, snake farm, farm, adula, hunan province, china2019-07-21v4No1 / 178
201amnoncommon in decaying Saguaro cactus (common mexico, desert, carnegiea gigantea, saguaro, cactus, decaying)2017-10-01v4No1 / 193
201amnoncommon in decaying Cardon cactus (common mexico, desert, cactus, decaying, pachycereus pringlei, cardon)2017-10-01v4No1 / 193
520amnonhigher in gastric cancer compared to paired normal tissue ( high in gastric carcinoma stomach neoplasm compared to control in homo sapiens zhejiang province stomach adult china )2019-06-26v3No1 / 214
201amnonhigher in cactus fly compared to decaying cactus ( high in drosophila fly drosophila nigrospiracula compared to cactus decaying in mexico desert )2017-10-01v4No1 / 215
388amnon high in age 12-19 weeks compared to age 6-10 weeks in pig sus scrofa tonsil farm united states of america state of michigan 2018-11-03v4No1 / 231
425amnon high in antananarivo madagascar compared to bangui central african republic in homo sapiens feces africa child 2018-12-08v4No1 / 248
219amnoncommon in mother mice feces (common mus musculus, mouse, feces, c57bl/6, research facility, female, south korea)2017-10-24v4No1 / 250
235amnoncommon in sediment near eelgrass in northern hemisphere (common sediment, marine sediment, ocean)2017-11-07v4No1 / 258
438amnon high in age 3-6 age 8-12 child compared to adult age 30-50 age 60-79 in homo sapiens feces china 2018-12-30v4No1 / 279
515amnoncommon carnivorous beetle, river, poland, raba river, whole body, beetle, bembidion varicolor2019-04-18v4No1 / 308
61amnoncommon canis lupus familiaris, skin, research facility, united states of america, inguinal region2017-02-05v4No1 / 328
471amnon high in adult compared to tadpole in digestive system frog osteopilus septentrionalis research facility united states of america state of florida 2019-01-14v4No1 / 328
423amnon high in human contact compared to no human contact chernobyl exclusion zone in bank vole myodes glareolus ukraine skin 2018-12-05v4No1 / 334
337amnonlower in manhattan compared to queens in feces of house mice from new york city ( high in queens region compared to manhatten region in united states of america city mus musculus new york city mouse house mice )2018-05-18v4No1 / 362
29amnon high in seed compared to seedling in brassica oleracea french republic 2016-12-05v4No1 / 379
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
539amnon high in days 30-60 anaerobic fermentation late timepoint compared to days 1-15 aerobic fermentation early timepoint in ethiopia ensete ventricosum ethiopian banana food (fermented) 2019-07-31v4No1 / 510
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
371amnonhigher in skin of amerindians compared to western visitors ( high in venezuela hunter gatherer amerindian compared to city united states of america in homo sapiens skin )2018-09-06v4No1 / 854
37amnonlower in tomato plant leaves compared to plastic control ( high in control compared to solanum lycopersicum in maryland county leaf )2016-12-09v4No1 / 950
515amnon high in detritivorous beetle bulgaria compared to herbivorous beetle poland in whole body beetle 2019-04-19v4No1 / 1543

Problems / suggestions? Please email info AT dbbact DOT org