Search result for sequence:
TACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTGATTGAGTCAGATGTGAAATCCCCGGGCTTAACCCGGGAATTGCATCTGATACTGGTCAGCTAGAGTCTTGTAGAGGGGGGTAGAATTCCATG
common ontology terms
term enrichment score
TermScore
snake0.342857
china0.315789
southern united states0.264151
digestive system0.136139
skin0.125984
osteopilus septentrionalis0.116959
fossorial snake0.113636
frog0.102041
adula0.097561
mexico0.097561
whole body0.097087
feces0.093151
snake farm0.093023
research facility0.091304
butterfly0.088889
state of florida0.082988
body proper0.080000
united states of america0.079541
hunan province0.075472
costa rica0.072727
desert0.072727
ceratitis capitata0.071429
mediterranean fruit fly0.071429
LOWER IN tadpole0.071429
infant0.071006
crohn's disease0.066667
adult0.066038
french republic0.065934
antibiotic0.058824
ulcerative colitis0.058824
rat0.057143
intestine0.051948
larval stage0.050000
bulgaria0.050000
homo sapiens0.049536
colon0.049383
pantherophis obsoletus0.048780
black rat snake0.048780
arboreal snake0.048780
aquatic snake0.048780
nerodia sipedon0.048780
northern water snake0.048780
storeria dekayi0.048780
ground snake0.048780
thamnophis sirtalis0.048780
common garter snake0.048780
shinisaurus crocodilurus0.048780
crocodile lizard0.048780
coluber constrictor0.048780
eastern racer snake0.048780
diadophis punctatus0.048780
ringneck snake0.048780
opatija0.048780
anisakis pegreffii0.048780
dolphin parasite0.048780
eastern red backed salamander0.048780
plethodon cinereus0.048780
rana pipiens0.048780
northern leopard frog0.048780
drosophila nigrospiracula0.048780
detritivorous beetle0.048780
decaying0.048780
nanjing county0.048780
chrysanthemum0.048780
chrysanthemum morifolium ramat.0.048780
ursus arctos0.047619
brown bear0.047619
croatia0.047619
salamander0.047619
drosophila0.047619
beetle0.047619
cactus0.047619
ph 6.90.047619
metronidazole0.047059
neomycin0.046512
state of wisconsin0.046512
fly0.046512
state of texas0.046512
LOWER IN control0.045627
ampicillin0.045455
LOWER IN 1-month-old human stage0.044444
italy0.043478
commonwealth of virginia0.043478
digesta0.043478
adult organism0.042553
kingdom of denmark0.042553
cloaca0.041667
sprague dawley0.040816
vagina0.040000
united kingdom0.039604
rattus norvegicus0.037736
south africa0.037736
sweden0.037037
farm0.036036
israel0.035714
age0.033333
wild0.031746
male0.027778
annona cherimola0.025000
citrus sinensis0.025000
Fraction of dbbact annotations with this term covered by the query
TermScore
china3.000000
adula1.000000
mexico1.000000
bulgaria1.000000
snake0.666667
osteopilus septentrionalis0.666667
colon0.666667
ceratitis capitata0.500000
annona cherimola0.500000
mediterranean fruit fly0.500000
citrus sinensis0.500000
orange0.500000
arawacus togarna0.500000
ficus carica0.500000
fig0.500000
caligo brasiliensis0.500000
brazilian owl butterfly0.500000
pantherophis obsoletus0.500000
southern united states0.500000
black rat snake0.500000
arboreal snake0.500000
aquatic snake0.500000
nerodia sipedon0.500000
northern water snake0.500000
state of louisiana0.500000
fossorial snake0.500000
storeria dekayi0.500000
ground snake0.500000
dulcedo polita0.500000
thamnophis sirtalis0.500000
common garter snake0.500000
anal swab0.500000
myotis myotis0.500000
bat0.500000
greater mouse eared bat0.500000
shinisaurus crocodilurus0.500000
crocodile lizard0.500000
coluber constrictor0.500000
eastern racer snake0.500000
diadophis punctatus0.500000
ringneck snake0.500000
opatija0.500000
anisakis pegreffii0.500000
dolphin parasite0.500000
children0.500000
carphophis amoenus0.500000
worm snake0.500000
temp 20c0.500000
LOWER IN temp 10c0.500000
eastern red backed salamander0.500000
plethodon cinereus0.500000
drosophila melanogaster0.500000
przewalski horse0.500000
snake farm0.500000
elaphe carinata0.500000
king ratsnake0.500000
LOWER IN tadpole0.500000
rana pipiens0.500000
northern leopard frog0.500000
age 3-60.500000
LOWER IN age 8-120.500000
LOWER IN age 13-140.500000
xinxiang city prefecture0.500000
ptyas mucosa0.500000
oriental ratsnake0.500000
naja atra0.500000
chinese cobra0.500000
drosophila nigrospiracula0.500000
LOWER IN bacterial vaginosis0.500000
fruit feeding0.500000
LOWER IN nectar feeding0.500000
anaxyrus terrestris0.500000
southern toad0.500000
cambridgeshire0.500000
triturus cristatus0.500000
LOWER IN cyprinus carpio0.500000
LOWER IN common carp0.500000
dnbs induced colitis0.500000
balkan mountains0.500000
detritivorous beetle0.500000
onthophagus ruficapillus0.500000
deinagkistrodon acutus0.500000
pit viper0.500000
carnegiea gigantea0.500000
saguaro0.500000
decaying0.500000
pachycereus pringlei0.500000
cardon0.500000
LOWER IN decaying0.500000
agkistrodon contortrix0.500000
copperhead snake0.500000
cloud0.500000
LOWER IN no human contact0.500000
LOWER IN chernobyl exclusion zone0.500000
ukraine0.500000
bank vole0.500000
myodes glareolus0.500000
days 30-600.500000
anaerobic fermentation0.500000
LOWER IN days 1-150.500000
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.371795
feces0.333333
snake0.230769
skin0.205128
southern united states0.179487
research facility0.179487
adult0.179487
china0.166667
homo sapiens0.153846
digestive system0.141026
LOWER IN control0.076923
whole body0.064103
fossorial snake0.064103
state of florida0.064103
frog0.064103
osteopilus septentrionalis0.064103
body proper0.051282
costa rica0.051282
butterfly0.051282
infant0.051282
farm0.051282
hunan province0.051282
adula0.051282
snake farm0.051282
desert0.051282
mexico0.051282
larval stage0.038462
ceratitis capitata0.038462
italy0.038462
mediterranean fruit fly0.038462
antibiotic0.038462
rat0.038462
french republic0.038462
ulcerative colitis0.038462
crohn's disease0.038462
LOWER IN tadpole0.038462
intestine0.038462
pantherophis obsoletus0.025641
black rat snake0.025641
arboreal snake0.025641
aquatic snake0.025641
nerodia sipedon0.025641
northern water snake0.025641
metronidazole0.025641
storeria dekayi0.025641
ground snake0.025641
ampicillin0.025641
rattus norvegicus0.025641
sprague dawley0.025641
israel0.025641
neomycin0.025641
male0.025641
sweden0.025641
wild0.025641
ursus arctos0.025641
brown bear0.025641
thamnophis sirtalis0.025641
common garter snake0.025641
cloaca0.025641
shinisaurus crocodilurus0.025641
crocodile lizard0.025641
coluber constrictor0.025641
eastern racer snake0.025641
diadophis punctatus0.025641
ringneck snake0.025641
adult organism0.025641
croatia0.025641
opatija0.025641
anisakis pegreffii0.025641
dolphin parasite0.025641
colon0.025641
commonwealth of virginia0.025641
salamander0.025641
eastern red backed salamander0.025641
plethodon cinereus0.025641
united kingdom0.025641
state of wisconsin0.025641
digesta0.025641
rana pipiens0.025641
northern leopard frog0.025641
drosophila0.025641
drosophila nigrospiracula0.025641
fly0.025641
vagina0.025641
south africa0.025641
state of texas0.025641
age0.025641
LOWER IN 1-month-old human stage0.025641
kingdom of denmark0.025641
bulgaria0.025641
beetle0.025641
detritivorous beetle0.025641
cactus0.025641
decaying0.025641
soil0.025641
nanjing county0.025641
chrysanthemum0.025641
chrysanthemum morifolium ramat.0.025641
ph 6.90.025641
annona cherimola0.012821
Exp. ID User ID Description Date Region Flag Sequences
346amnonhigh freq. in fruitfly larva grown on annona (dominant larval stage, body proper, ceratitis capitata, italy, whole body, annona cherimola, mediterranean fruit fly)2018-06-11v4No1 / 7
346amnonhigh freq. in fruitfly larva grown on orange (dominant larval stage, body proper, citrus sinensis, ceratitis capitata, italy, whole body, orange, mediterranean fruit fly)2018-06-11v4No1 / 8
501amnondominant digestive system, costa rica, butterfly, arawacus togarna2019-03-09v4No1 / 9
177amnonblooming bacteria (grows in storage at room temp.) (contamination)2017-07-30v4No1 / 10
346amnonhigh freq. in fruitfly larva grown on figs (dominant larval stage, body proper, ceratitis capitata, italy, whole body, ficus carica, fig, mediterranean fruit fly)2018-06-11v4No1 / 10
501amnoncommon digestive system, costa rica, butterfly, caligo brasiliensis, brazilian owl butterfly2019-03-08v4No1 / 12
536amnondominant united states of america, skin, pantherophis obsoletus, snake, southern united states, black rat snake, arboreal snake2019-07-28v4No1 / 13
536amnondominant united states of america, skin, snake, southern united states, aquatic snake, nerodia sipedon, northern water snake2019-07-28v4No1 / 14
648amnon high in antibiotic metronidazole compared to control in feces united states of america canis lupus familiaris dog state of louisiana 2020-09-06v4No1 / 14
536amnondominant united states of america, skin, snake, southern united states, fossorial snake, storeria dekayi, ground snake2019-07-28v4No1 / 15
586amnoncommon feces, research facility, antibiotic, ampicillin, rattus norvegicus, sprague dawley, israel, rat, neomycin, male2020-02-09v4No1 / 15
586amnondominant feces, research facility, antibiotic, ampicillin, rattus norvegicus, sprague dawley, israel, rat, neomycin, male2020-02-09v4No1 / 16
387amnon high in winter compared to summer in feces sweden wild ursus arctos brown bear 2018-11-03v4No1 / 17
501amnoncommon digestive system, costa rica, butterfly, dulcedo polita2019-03-08v4No1 / 17
536amnondominant united states of america, skin, snake, southern united states, thamnophis sirtalis, common garter snake2019-07-28v4No1 / 18
489amnondominant feces, french republic, anal swab, myotis myotis, bat, greater mouse eared bat2019-02-25v4No1 / 19
281amnondominant cloaca, shinisaurus crocodilurus, crocodile lizard, china2018-01-25v4No1 / 20
292amnondominant feces, homo sapiens, adult, ulcerative colitis, china2018-02-05v4No1 / 20
536amnondominant united states of america, skin, snake, southern united states, coluber constrictor, eastern racer snake2019-07-28v4No1 / 20
536amnondominant united states of america, skin, snake, southern united states, diadophis punctatus, ringneck snake, fossorial snake2019-07-28v4No1 / 21
670amnon high in adult adult organism compared to larval stage in croatia opatija anisakis pegreffii dolphin parasite 2020-09-26v4No1 / 22
471amnondominant digestive system, united states of america, research facility, adult, state of florida, frog, osteopilus septentrionalis2019-01-14v4No1 / 24
670amnoncommon adult, adult organism, croatia, opatija, anisakis pegreffii, dolphin parasite2020-09-26v4No1 / 24
536amnoncommon united states of america, skin, snake, southern united states, diadophis punctatus, ringneck snake, fossorial snake2019-07-28v4No1 / 26
387amnoncommon in feces of wild brown bear (common feces, sweden, wild, ursus arctos, brown bear)2018-11-03v4No1 / 27
292amnon high in crohn's disease ulcerative colitis compared to control in feces homo sapiens adult china 2018-02-05v4No1 / 32
19amnonhigher in CD compared to control in biopsies ( high in crohn's disease compared to control in homo sapiens united states of america rectum caecum colon sigmoid colon terminal ileum biopsy children )2016-11-14v4No1 / 34
536amnoncommon united states of america, skin, snake, southern united states, fossorial snake, carphophis amoenus, worm snake2019-07-28v4No1 / 35
427amnonhigher in salamanders kept at 20C compared to 10C ( high in temp 20c compared to temp 10c in feces united states of america commonwealth of virginia salamander eastern red backed salamander plethodon cinereus )2018-12-08v4No1 / 39
244amnoncommon digestive system, research facility, drosophila melanogaster, fruit fly, united kingdom2017-11-15v4No1 / 45
339amnon high in infant under-1-year-old human stage compared to adult in feces homo sapiens india 2018-05-24v4No1 / 50
406amnoncommon feces, united states of america, zoological garden, equus przewalskii, przewalski horse2018-11-21v4No1 / 50
292amnoncommon feces, homo sapiens, adult, ulcerative colitis, china2018-02-05v4No1 / 53
281amnoncommon cloaca, shinisaurus crocodilurus, crocodile lizard, china2018-01-25v4No1 / 59
530amnoncommon feces, farm, hunan province, adula, snake, snake farm, elaphe carinata, king ratsnake, china2019-07-21v4No1 / 63
536amnoncommon united states of america, skin, snake, southern united states, coluber constrictor, eastern racer snake2019-07-28v4No1 / 64
114amnon high in adult compared to tadpole in united states of america research facility intestine state of wisconsin digesta rana pipiens northern leopard frog 2017-04-10v4No1 / 67
398amnon high in crohn's disease compared to control in feces homo sapiens belgium 2018-11-15v4No1 / 68
114amnoncommon united states of america, research facility, intestine, adult, state of wisconsin, digesta, rana pipiens, northern leopard frog2017-04-10v4No1 / 72
322amnoncommon digestive system, united states of america, research facility, adult, state of florida, frog, osteopilus septentrionalis2018-04-23v4No1 / 76
438amnonhigher in kindergarten compared to primary and middle school kids ( high in age 3-6 2-5 year-old child stage compared to age 8-12 age 13-14 6-12 year-old child stage 13-year-old human stage 14-year-old human stage in feces homo sapiens china )2018-12-30v4No1 / 76
513amnoncommon city, waste water, hospital, xinxiang city prefecture, china2019-03-25v4No1 / 86
530amnoncommon feces, farm, hunan province, adula, snake, snake farm, ptyas mucosa, oriental ratsnake, china2019-07-21v4No1 / 86
530amnoncommon feces, farm, hunan province, adula, snake, snake farm, naja atra, chinese cobra, china2019-07-21v4No1 / 90
471amnoncommon digestive system, united states of america, research facility, adult, state of florida, frog, osteopilus septentrionalis2019-01-14v4No1 / 94
201amnoncommon in cactus fly whole body (common desert, body proper, drosophila, mexico, drosophila nigrospiracula, fly)2017-10-01v4No1 / 101
536amnoncommon united states of america, skin, snake, southern united states, fossorial snake, storeria dekayi, ground snake2019-07-28v4No1 / 101
213amnoncommon homo sapiens, vagina, south africa2017-10-22v4No1 / 103
213amnonlower in patients with bacterial vaginosis compared to healthy controls ( high in control compared to bacterial vaginosis in homo sapiens vagina south africa )2017-10-31v4No1 / 107
536amnoncommon united states of america, skin, snake, southern united states, thamnophis sirtalis, common garter snake2019-07-28v4No1 / 110
536amnoncommon united states of america, skin, snake, southern united states, aquatic snake, nerodia sipedon, northern water snake2019-07-28v4No1 / 111
501amnonlower in nectar feeding butterflies compared to fruit feeding ( high in fruit feeding compared to nectar feeding in digestive system costa rica butterfly )2019-03-09v4No1 / 116
632amnonhigher following metronidazole treatment in horse feces ( high in metronidazole compared to control in feces united states of america research facility adult equus caballus state of texas horse )2020-06-10v4No1 / 121
427amnoncommon feces, united states of america, commonwealth of virginia, salamander, eastern red backed salamander, plethodon cinereus2018-12-08v4No1 / 125
273amnon high in age age 1 week 1-month-old human stage compared to 1-month-old human stage in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 127
108amnoncommon united states of america, research facility, colon, state of texas, anaxyrus terrestris, southern toad2017-04-07v4No1 / 132
353amnonhigher in captive compared to wild caught Lissotriton vulgaris newts skin ( high in research facility compared to wild in skin adult cambridgeshire newt triturus cristatus united kingdom )2018-07-30v4No1 / 135
396amnon high in oncorhynchus mykiss rainbow trout compared to cyprinus carpio common carp in digestive system intestine england fish 2018-11-14v4No1 / 142
358amnonhigher in dnbs induced colitis compared to controls in rat feces ( high in dnbs induced colitis colitis compared to control in feces research facility rattus czech republic rat wistar rat )2018-08-19v4No1 / 154
241amnonlower in babies from finland compared to estonia ( high in estonia compared to finland in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 157
322amnon high in adult compared to tadpole in digestive system united states of america research facility state of florida frog osteopilus septentrionalis 2018-04-23v4No1 / 163
515amnoncommon feces, bulgaria, balkan mountains, whole body, beetle, detritivorous beetle, onthophagus ruficapillus2019-04-18v4No1 / 178
530amnoncommon feces, farm, hunan province, adula, snake, deinagkistrodon acutus, pit viper, snake farm, china2019-07-21v4No1 / 178
536amnoncommon united states of america, skin, pantherophis obsoletus, snake, southern united states, black rat snake, arboreal snake2019-07-28v4No1 / 184
201amnoncommon in decaying Saguaro cactus (common desert, mexico, cactus, carnegiea gigantea, saguaro, decaying)2017-10-01v4No1 / 193
201amnoncommon in decaying Cardon cactus (common desert, mexico, cactus, decaying, pachycereus pringlei, cardon)2017-10-01v4No1 / 193
201amnonhigher in cactus fly compared to decaying cactus ( high in drosophila drosophila nigrospiracula fly compared to cactus decaying in desert mexico )2017-10-01v4No1 / 215
536amnoncommon united states of america, skin, snake, southern united states, agkistrodon contortrix, copperhead snake2019-07-28v4No1 / 236
253amnoncommon in clouds in puy de dome mountain in france (common air, french republic, autumn, cloud)2017-11-22v4No1 / 267
471amnon high in adult compared to tadpole in digestive system united states of america research facility state of florida frog osteopilus septentrionalis 2019-01-14v4No1 / 328
423amnon high in human contact compared to no human contact chernobyl exclusion zone in skin ukraine bank vole myodes glareolus 2018-12-05v4No1 / 334
29amnon high in seed compared to seedling in brassica oleracea french republic 2016-12-05v4No1 / 379
539amnon high in late timepoint days 30-60 anaerobic fermentation compared to early timepoint days 1-15 aerobic fermentation in ethiopia ensete ventricosum ethiopian banana food (fermented) 2019-07-31v4No1 / 510
273amnon high in age 1-year-old human stage compared to 1-month-old human stage in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 557
647amnon high in lake water freshwater lake compared to skin frog rana luteiventris columbia spotted frog in united states of america state of montana 2020-09-06v4No1 / 593
767sheryoCommon in soil planted with Chrysanthemum, fertilized with bio-organic fertilizer in Nanjing China (common soil, compost biofilter, compost, pig manure, paenibacillus, china, nanjing county, chrysanthemum, bio-organic fertilizer, chrysanthemum morifolium ramat., ph 6.9, paenibacillus polymyxa)2021-04-14v4No1 / 866
767sheryoCommon in soil planted with Chrysanthemum, amended with soil fumigant 'Dazomet' in Nanjing China (common soil, china, nanjing county, chrysanthemum, chrysanthemum morifolium ramat., ph 6.9, soil fumigation, dazomet)2021-04-14v4No1 / 946
515amnon high in bulgaria detritivorous beetle compared to poland herbivorous beetle in whole body beetle 2019-04-19v4No1 / 1543

Problems / suggestions? Please email info AT dbbact DOT org