Search result for sequence:
TACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTGGATAAGTTAGATGTGAAAGCCCCGGGCTCAACCTGGGAATTGCATTTAAAACTGTCCAGCTAGAGTCTTGTAGAGGGGGGTAGAATTCCAGG
common ontology terms
term enrichment score
TermScore
river0.288035
china0.259082
united states of america0.227484
fresh water0.215385
intestine0.212389
water0.202532
skin0.197548
research facility0.185240
beetle0.181818
poland0.167224
whole body0.166667
fish0.149690
carnivorous beetle0.118110
raba river0.111111
digestive system0.107663
soil0.107317
adult0.104046
rhizosphere0.088795
zebra fish0.084567
danio rerio0.083682
homo sapiens0.082076
herbivorous beetle0.081967
mississippi river0.076271
plant0.075758
nida basin0.074380
feces0.067343
frog0.067227
united kingdom0.061538
wastewater treatment plant0.060000
cambridgeshire0.058824
pond0.058252
cultivated environment0.057692
newt0.057143
rainbow trout0.055556
oncorhynchus mykiss0.055556
oreochromis niloticus0.051502
snake0.051502
18c0.050847
sweden0.050000
kingdom of spain0.049180
city0.046512
brazil0.045113
warm temperature habitat0.042735
effluent0.042735
hunan province0.042735
depth 0-20cm0.042735
bird0.042433
state of oregon0.042283
costa rica0.041841
mucus0.041841
larval stage0.041623
autumn0.040984
food (fermented)0.040984
winter0.040431
farm0.039761
child0.037175
state of wisconsin0.034783
wheat0.034783
nile tilapia0.034483
lissotriton vulgaris0.034483
age 5-13 years0.034483
chuquisaca department0.034483
forearm0.034483
state of alabama0.034483
ensete ventricosum0.034483
ethiopian banana0.034483
amphibia0.034483
southern united states0.034483
depth 1m0.034483
orchard0.034483
LOWER IN root0.034335
mexico0.034188
arm0.033898
tadpole0.033898
citrus0.033898
air0.033520
LOWER IN feces0.033473
texas0.033333
bolivia0.033333
ethiopia0.033333
pair of nares0.033058
state of florida0.032000
rural community0.031746
sediment0.031414
colon0.030534
control0.029070
female0.027778
anser cygnoides0.026258
stream0.026258
particle0.026258
gut content0.026087
gastrointestinal system mucosa0.026087
cyprinus carpio0.026087
common carp0.026087
england0.026087
pond water0.026087
rana pipiens0.026087
northern leopard frog0.026087
river nile0.026087
depth 50cm0.026087
Fraction of dbbact annotations with this term covered by the query
TermScore
river0.833333
zebra fish0.800000
fresh water0.777778
wastewater treatment plant0.750000
mississippi river0.750000
intestine0.705882
oreochromis niloticus0.666667
danio rerio0.666667
anser cygnoides0.666667
state of wisconsin0.666667
floor0.666667
dust0.666667
snake0.666667
rana catesbeiana0.666667
bullfrog0.666667
salamandra salamandra0.666667
stream0.666667
toad0.666667
particle0.666667
wheat0.666667
fish0.636364
frog0.571429
LOWER IN yeast diet0.500000
gut content0.500000
warm temperature habitat0.500000
18c0.500000
LOWER IN 12c0.500000
LOWER IN cold environment0.500000
gastrointestinal system mucosa0.500000
warm termpterature habitat0.500000
nida basin0.500000
herbivorous beetle0.500000
cheilotoma musciformis0.500000
nile tilapia0.500000
polydrusus inustus0.500000
coreius guichenoti0.500000
largemouth bronze gudgeon0.500000
freshwater river biome0.500000
yangtze river0.500000
carnivorous beetle0.500000
raba river0.500000
bembidion modestum0.500000
paederidus ruficollis0.500000
lissotriton vulgaris0.500000
cambridgeshire0.500000
cyprinus carpio0.500000
common carp0.500000
england0.500000
bembidion decorum0.500000
waste water0.500000
xinxiang city prefecture0.500000
bembidion varicolor0.500000
bembidion punctulatum0.500000
paederidus rubrothoracicus0.500000
age 5-13 years0.500000
chuquisaca department0.500000
forearm0.500000
effluent0.500000
crioceris quatuordecimpunctata0.500000
pond water0.500000
paederus limnophilus0.500000
state of alabama0.500000
eusomus ovulum0.500000
argoptochus quadrisignatus0.500000
paederus riparius0.500000
LOWER IN age 9 weeks0.500000
andrias japonicus0.500000
japanese giant salamander0.500000
LOWER IN amphibian larval stage0.500000
rana pipiens0.500000
northern leopard frog0.500000
age 9 weeks0.500000
leptodactylus latrans0.500000
lesser foam frog0.500000
ensete ventricosum0.500000
ethiopian banana0.500000
aerobic fermentation0.500000
days 1-150.500000
eriocheir sinensis0.500000
LOWER IN cadmium0.500000
pet0.500000
serinus canaria0.500000
canary0.500000
LOWER IN zoo0.500000
area designated as a nature reserve0.500000
ant0.500000
pseudomyrmex gracilis0.500000
generalist0.500000
LOWER IN pseudomyrmex flavicornis0.500000
LOWER IN pseudomyrmex nigrocinctus0.500000
LOWER IN pseudomyrmex spinicola0.500000
LOWER IN acacia ants0.500000
aphthona venustula0.500000
bumble bee0.500000
queen0.500000
hibernation0.500000
river nile0.500000
depth 50cm0.500000
cairo0.500000
amphibia0.500000
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.308036
china0.218750
research facility0.196429
river0.174107
water0.142857
skin0.129464
whole body0.125000
beetle0.125000
intestine0.125000
fresh water0.125000
poland0.111607
adult0.093750
fish0.084821
feces0.084821
homo sapiens0.080357
digestive system0.075893
soil0.071429
carnivorous beetle0.066964
raba river0.062500
rhizosphere0.053571
plant0.044643
herbivorous beetle0.044643
danio rerio0.044643
zebra fish0.044643
nida basin0.040179
mississippi river0.040179
united kingdom0.035714
frog0.035714
sweden0.031250
rainbow trout0.031250
oncorhynchus mykiss0.031250
newt0.031250
cambridgeshire0.031250
wastewater treatment plant0.031250
pond0.031250
cultivated environment0.031250
18c0.026786
oreochromis niloticus0.026786
city0.026786
brazil0.026786
snake0.026786
kingdom of spain0.026786
warm temperature habitat0.022321
larval stage0.022321
child0.022321
effluent0.022321
state of oregon0.022321
autumn0.022321
food (fermented)0.022321
control0.022321
bird0.022321
costa rica0.022321
winter0.022321
mucus0.022321
farm0.022321
hunan province0.022321
depth 0-20cm0.022321
texas0.017857
colon0.017857
nile tilapia0.017857
lissotriton vulgaris0.017857
age 5-13 years0.017857
bolivia0.017857
rural community0.017857
chuquisaca department0.017857
arm0.017857
forearm0.017857
female0.017857
state of alabama0.017857
state of wisconsin0.017857
tadpole0.017857
ethiopia0.017857
ensete ventricosum0.017857
ethiopian banana0.017857
mexico0.017857
amphibia0.017857
pair of nares0.017857
state of florida0.017857
southern united states0.017857
air0.017857
LOWER IN feces0.017857
sediment0.017857
depth 1m0.017857
citrus0.017857
orchard0.017857
LOWER IN root0.017857
wheat0.017857
gut content0.013393
gastrointestinal system mucosa0.013393
cyprinus carpio0.013393
common carp0.013393
england0.013393
hospital0.013393
mus musculus0.013393
mouse0.013393
c57bl/60.013393
pond water0.013393
channel catfish0.013393
ictalurus punctatus0.013393
anser cygnoides0.013393
Exp. ID User ID Description Date Region Flag Sequences
313amnon high in fishmeal diet compared to yeast diet in sweden fish rainbow trout oncorhynchus mykiss research facility digestive system 2018-04-10v4No1 / 2
313amnonlower in gut content of fish grown in 12C compared to 18C water ( high in warm temperature habitat 18c compared to 12c cold environment in sweden fish rainbow trout oncorhynchus mykiss research facility digestive system gut content )2018-04-10v4No1 / 3
313amnonlower in gut mucosa of fish grown in 12C compared to 18C water ( high in warm termpterature habitat 18c compared to 12c cold environment in sweden fish rainbow trout oncorhynchus mykiss research facility digestive system gastrointestinal system mucosa )2018-04-10v4No1 / 3
313amnonhigh freq. in rainbow trout gut content grown in 18C water (highfreq sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, gut content, warm temperature habitat, 18c)2018-04-10v4No1 / 5
313amnonhigh freq. in rainbow trout gut mucosa grown in 18C water (highfreq sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, warm temperature habitat, 18c, gastrointestinal system mucosa)2018-04-10v4No1 / 5
515amnonhighfreq poland, whole body, beetle, plant, nida basin, herbivorous beetle, cheilotoma musciformis2019-04-18v4No1 / 5
108amnonhighfreq research facility, texas, united states of america, colon, oreochromis niloticus, nile tilapia2017-04-07v4No1 / 6
112amnonhighfreq danio rerio, zebra fish, intestine, research facility, china2017-04-09v4No1 / 6
113amnonhighfreq danio rerio, zebra fish, research facility, united states of america, intestine, adult2017-04-10v4No1 / 6
515amnonhighfreq poland, whole body, beetle, plant, nida basin, herbivorous beetle, polydrusus inustus2019-04-18v4No1 / 6
115amnonhighfreq coreius guichenoti, largemouth bronze gudgeon, fish, freshwater river biome, yangtze river, intestine, china2017-04-10v4No1 / 8
313amnoncommon in rainbow trout gut mucosa grown in 18C water (common sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, warm temperature habitat, 18c, gastrointestinal system mucosa)2018-04-10v4No1 / 8
515amnonhighfreq carnivorous beetle, river, poland, raba river, whole body, beetle, bembidion modestum2019-04-18v4No1 / 8
313amnoncommon in rainbow trout gut content grown in 18C water (common sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, gut content, warm temperature habitat, 18c)2018-04-10v4No1 / 9
515amnonhighfreq poland, whole body, beetle, carnivorous beetle, river, raba river, paederidus ruficollis2019-04-18v4No1 / 9
117amnonhighfreq zebra fish, danio rerio, research facility, larval stage, united states of america, intestine2017-04-10v4No1 / 10
353amnonhigh freq. in wild Lissotriton vulgaris newts skin (highfreq newt, adult, skin, lissotriton vulgaris, cambridgeshire, united kingdom)2018-07-30v4No1 / 10
396amnonhighfreq fish, cyprinus carpio, common carp, england, intestine, digestive system2018-11-14v4No1 / 10
515amnonhighfreq bembidion decorum, carnivorous beetle, river, poland, raba river, whole body, beetle2019-04-18v4No1 / 10
513amnonhighfreq waste water, hospital, city, xinxiang city prefecture, china2019-03-25v4No1 / 11
108amnoncommon research facility, texas, united states of america, caecum, oreochromis niloticus, nile tilapia2017-04-07v4No1 / 12
515amnonhighfreq carnivorous beetle, river, poland, raba river, whole body, beetle, bembidion varicolor2019-04-18v4No1 / 12
515amnonhighfreq carnivorous beetle, river, poland, raba river, whole body, beetle, bembidion punctulatum2019-04-18v4No1 / 13
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, polydrusus inustus2019-04-18v4No1 / 13
515amnonhighfreq poland, whole body, beetle, paederidus rubrothoracicus, carnivorous beetle, river, raba river2019-04-18v4No1 / 13
517amnonhighfreq homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department, skin, arm, forearm2019-05-29v4No1 / 13
200amnonhighfreq. in river downstream of wastewater treatment plant (highfreq river, fresh water, water, united states of america, wastewater treatment plant, effluent)2017-10-01v4No1 / 15
435amnoncommon mus musculus, mouse, feces, research facility, c57bl/6, female, united states of america, state of oregon, age 4 weeks2018-12-23v4No1 / 15
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, crioceris quatuordecimpunctata2019-04-18v4No1 / 15
499amnonhighfreq brazil, pond, water, pond water, fresh water2019-03-05v4No1 / 16
515amnoncommon poland, whole body, beetle, carnivorous beetle, river, raba river, paederus limnophilus2019-04-18v4No1 / 16
116amnonhighfreq research facility, litopenaeus vannamei, pacific white shrimp, intestine, south china sea, china2017-04-10v4No1 / 17
481amnonhighfreq united states of america, state of alabama, research facility, channel catfish, ictalurus punctatus, intestine2019-02-12v4No1 / 17
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, eusomus ovulum2019-04-18v4No1 / 18
60amnonhighfreq anser cygnoides, feces, china2017-02-03v4No1 / 19
115amnoncommon coreius guichenoti, largemouth bronze gudgeon, fish, freshwater river biome, yangtze river, intestine, china2017-04-10v4No1 / 19
160amnonhigh freq. in river water upstream of WTP effluent in autumn in china (highfreq river, water, autumn, china)2017-07-12v4No1 / 19
160amnonhigh freq. in wastewater treatment plant effluent in autumn in china (highfreq wastewater treatment plant, effluent, autumn, china)2017-07-12v4No1 / 20
437amnonhighfreq fish, zebra fish, danio rerio, juvenile organism, age 21 days, intestine, research facility, united states of america, state of oregon2018-12-26v4No1 / 20
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, argoptochus quadrisignatus2019-04-18v4No1 / 22
515amnoncommon poland, whole body, beetle, carnivorous beetle, river, raba river, paederus riparius2019-04-18v4No1 / 22
435amnonlower in mice at end of experiment compared to initial sample ( high in age 4 weeks compared to age 9 weeks in feces united states of america female research facility mus musculus c57bl/6 state of oregon mouse )2018-12-23v4No1 / 23
338amnon high in adult compared to tadpole amphibian larval stage larval stage in andrias japonicus japanese giant salamander skin japan 2018-05-21v4No1 / 24
515amnoncommon poland, whole body, beetle, paederidus rubrothoracicus, carnivorous beetle, river, raba river2019-04-18v4No1 / 25
114amnonhighfreq rana pipiens, northern leopard frog, research facility, digesta, intestine, state of wisconsin, united states of america, tadpole2017-04-10v4No1 / 26
267amnoncommon fish, digestive system, oreochromis niloticus, research facility, china2017-12-24v4No1 / 28
435amnoncommon mus musculus, mouse, feces, research facility, c57bl/6, female, united states of america, state of oregon, age 9 weeks2018-12-23v4No1 / 30
492amnoncommon brazil, skin, adult, leptodactylus latrans, frog, lesser foam frog2019-02-27v4No1 / 34
539amnoncommon ethiopia, ensete ventricosum, ethiopian banana, early timepoint, aerobic fermentation, days 1-15, food (fermented)2019-07-31v4No1 / 35
50amnoncommon in mitten crab gills (common gill, eriocheir sinensis, china)2017-01-19v4No1 / 37
113amnoncommon danio rerio, zebra fish, research facility, united states of america, intestine, adult2017-04-10v4No1 / 40
267amnonlower in gut of fish in water with cadmium contamination compared to control ( high in control compared to cadmium in fish digestive system oreochromis niloticus research facility china )2017-12-24v4No1 / 40
112amnoncommon danio rerio, zebra fish, intestine, research facility, china2017-04-09v4No1 / 41
117amnoncommon zebra fish, danio rerio, research facility, larval stage, united states of america, intestine2017-04-10v4No1 / 41
60amnoncommon anser cygnoides, feces, china2017-02-03v4No1 / 42
108amnoncommon research facility, texas, united states of america, colon, oreochromis niloticus, nile tilapia2017-04-07v4No1 / 43
50amnoncommon in mitten crab intestine (common intestine, eriocheir sinensis, china)2017-01-19v4No1 / 45
113amnoncommon danio rerio, zebra fish, research facility, united states of america, intestine, larval stage2017-04-10v4No1 / 45
396amnoncommon fish, cyprinus carpio, common carp, england, intestine, digestive system2018-11-14v4No1 / 45
515amnoncommon poland, whole body, beetle, carnivorous beetle, river, raba river, paederidus ruficollis2019-04-18v4No1 / 45
302amnoncommon in feces of canary pet birds (common bird, mexico, feces, pet, serinus canaria, canary)2018-03-05v4No1 / 47
338amnonhigher in wild salamanders compared to zoo grown salamanders ( high in pond area designated as a nature reserve compared to zoological garden zoo in andrias japonicus japanese giant salamander skin japan )2018-05-21v4No1 / 51
408amnon high in pseudomyrmex gracilis generalist compared to pseudomyrmex flavicornis pseudomyrmex nigrocinctus pseudomyrmex spinicola acacia ants in ant costa rica united states of america pseudomyrmex 2018-11-22v4No1 / 54
437amnoncommon fish, zebra fish, danio rerio, juvenile organism, age 21 days, intestine, research facility, united states of america, state of oregon2018-12-26v4No1 / 54
515amnoncommon poland, whole body, beetle, aphthona venustula, plant, nida basin, herbivorous beetle2019-04-18v4No1 / 54
308amnoncommon in neonatal intensive care unit floor (common united states of america, state of california, hospital, floor, dust)2018-03-31v4No1 / 57
431amnoncommon in midgut of hibernating bumble bees (common research facility, midgut, belgium, bombus terrestris, bumble bee, queen, hibernation)2018-12-16v4No1 / 57
116amnoncommon research facility, litopenaeus vannamei, pacific white shrimp, intestine, south china sea, china2017-04-10v4No1 / 58
366amnon high in winter dry season compared to summer wet season in river nile water river fresh water depth 50cm cairo egypt 2018-08-31v4No1 / 58
374amnoncommon skin, costa rica, amphibia, oophaga pumilio, strawberry poison frog, frog2018-09-09v4No1 / 61
302amnoncommon in feces of Cockatiel pet birds (common bird, mexico, feces, pet, nymphicus hollandicus, cockatiel)2018-03-05v4No1 / 63
91amnoncommon serofluid dish, jiangshui, china, food (fermented)2017-03-08v4No1 / 70
417amnoncommon anser cygnoides, swan goose, bird, feces, winter, china2018-12-01v4No1 / 70
26amnoncommon united states of america, homo sapiens, pair of nares, mucus2016-12-05v4No1 / 73
108amnonincreases during fasting in nile tilapia colon ( high in fasting late timepoints compared to early timepoints in research facility texas united states of america colon oreochromis niloticus nile tilapia )2017-04-07v4No1 / 81
269amnonpeaks at 2 weeks in refrigeration of yao meat ( high in middle timepoint two weeks compared to fresh food spoilage late timepoint in china foodon product type )2018-01-09v4No1 / 83
114amnoncommon rana pipiens, northern leopard frog, research facility, digesta, intestine, state of wisconsin, united states of america, tadpole2017-04-10v4No1 / 84
353amnoncommon in captive Triturus cristatus newts skin (common newt, adult, skin, cambridgeshire, triturus cristatus, research facility, united kingdom)2018-07-30v4No1 / 84
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, centricnemus leucogrammus2019-04-18v4No1 / 84
539amnon high in ensete ventricosum var. maze compared to ensete ventricosum var. ketishe in ethiopia ensete ventricosum ethiopian banana late timepoint days 30-60 anaerobic fermentation food (fermented) 2019-07-31v4No1 / 84
26amnon high in pair of nares mucus compared to saliva mouth in united states of america felis catus 2016-12-05v4No1 / 86
353amnoncommon in captive Lissotriton vulgaris newts skin (common newt, adult, skin, cambridgeshire, research facility, lissotriton vulgaris, united kingdom)2018-07-30v4No1 / 86
513amnoncommon waste water, hospital, city, xinxiang city prefecture, china2019-03-25v4No1 / 86
530amnoncommon snake, feces, snake farm, farm, adula, hunan province, ptyas mucosa, oriental ratsnake, china2019-07-21v4No1 / 86
382amnoncommon water, hot spring, geothermal field, ganzi tibetan autonomous prefecture, china, high temperature environment2018-10-22v4No1 / 89
114amnon high in tadpole compared to adult in rana pipiens northern leopard frog research facility digesta intestine state of wisconsin united states of america 2017-04-10v4No1 / 90
530amnoncommon snake, feces, snake farm, farm, adula, hunan province, naja atra, chinese cobra, china2019-07-21v4No1 / 90
26amnon high in pair of nares mucus compared to inguinal region axilla sebum in united states of america homo sapiens 2016-12-05v4No1 / 92
471amnoncommon digestive system, frog, osteopilus septentrionalis, research facility, united states of america, adult, state of florida2019-01-14v4No1 / 94
558amnon high in colon compared to caecum in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 97
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, rana catesbeiana, bullfrog2017-04-02v4No1 / 99
201amnoncommon in cactus fly whole body (common drosophila, drosophila nigrospiracula, fly, mexico, desert, body proper)2017-10-01v4No1 / 101
377amnoncommon salamandra salamandra, salamander, skin, germany2018-09-12v4No1 / 106
149amnon high in stream compared to pond in salamandra salamandra fire salamander germany larval stage amphibian larval stage intestine 2017-04-24v4No1 / 107
536amnoncommon snake, skin, united states of america, southern united states, thamnophis sirtalis, common garter snake2019-07-28v4No1 / 110
539amnon high in early timepoint days 1-15 aerobic fermentation compared to late timepoint days 30-60 anaerobic fermentation in ethiopia ensete ventricosum ethiopian banana food (fermented) 2019-07-31v4No1 / 110
536amnoncommon snake, skin, united states of america, southern united states, aquatic snake, nerodia sipedon, northern water snake2019-07-28v4No1 / 111
269amnoncommon in fresh yao meat food (common china, foodon product type)2018-01-09v4No1 / 113
492amnoncommon skin, adult, germany, bufo bufo, toad, common toad2019-02-27v4No1 / 115
536amnoncommon snake, skin, united states of america, southern united states, agkistrodon piscivorus, aquatic snake2019-07-28v4No1 / 115
481amnonhigher in channel catfish intestine compared to the growing pond water ( high in fish ictalurus punctatus channel catfish intestine compared to pond water fresh water in united states of america state of alabama research facility )2019-02-12v4No1 / 118
113amnon high in adult compared to larval stage in danio rerio zebra fish research facility united states of america intestine 2017-04-10v4No1 / 120
374amnoncommon skin, costa rica, amphibia, rhaebo haematiticus, truando toad, toad2018-09-09v4No1 / 121
517amnoncommon homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department, skin, arm, forearm2019-05-29v4No1 / 121
539amnon high in ensete ventricosum var. gena compared to ensete ventricosum var. ketishe in ethiopia ensete ventricosum ethiopian banana late timepoint days 30-60 anaerobic fermentation food (fermented) 2019-07-31v4No1 / 123
263amnonhigher in soils irrigated with artificial wastewater compared to other methods ( high in artificial wastewater irrigation compared to tap water irrigation fertilized water irrigation treated wastewater irrigation in soil israel sandy loam soil negev desert ph 7-8 irrigated research facility )2017-12-11v4No1 / 127
515amnoncommon carnivorous beetle, river, poland, raba river, whole body, beetle, bembidion modestum2019-04-18v4No1 / 131
374amnoncommon skin, costa rica, amphibia, craugastor fitzingeri, common rain frog, frog2018-09-09v4No1 / 136
255amnoncommon in fish feed (common united states of america, state of minnesota, research facility, fish feed)2017-11-24v4No1 / 141
475amnoncommon in air next to subway stations in hong kong (common air, hong kong, city)2019-01-20v4No1 / 147
515amnoncommon whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, aphodius haemorrhoidalis2019-04-18v4No1 / 147
53amnonhigher in sewer and wastewater influent comapred to feces in low income south america ( high in sewer wastewater treatment plant compared to feces in south america city low income )2017-01-21v4No1 / 148
481amnoncommon united states of america, state of alabama, research facility, channel catfish, ictalurus punctatus, intestine2019-02-12v4No1 / 151
241amnonlower in babies from finland compared to estonia ( high in estonia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 157
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, crioceris duodecimpunctata2019-04-18v4No1 / 157
180amnoncommon dermanyssus gallinae, red poulty mite, czech republic, poulty farm, larval stage, shelled egg2017-08-14v4No1 / 158
510amnoncommon kingdom of spain, water, estuary, estuary water, saline water, salinity >20 ppt, bilbao2019-03-20v4No1 / 158
376amnonappear when transferred from high salinity to low salinity (other rhizosphere, saline marsh, united states of america, atlantic ocean, sediment, spartina alterniflora)2018-09-11v4No1 / 161
475amnoncommon in air in subway train in hong kong (common air, hong kong, city, subway)2019-01-20v4No1 / 161
121amnonhigh in diarrhea compared to recovery period ( high in diarrhea compared to control in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 162
374amnoncommon skin, costa rica, amphibia, craugastor bransfordii, bransford’s litter frog, frog2018-09-09v4No1 / 171
424amnonfarm dependent in feces of pigs with same genetic background ( high in farm 1 compared to farm 2 in sus scrofa pig jinhua city prefecture jinhua pig feces farm china )2018-12-06v4No1 / 171
499amnoncommon brazil, pond, digestive system, intestine, scinax fuscovarius, frog, tadpole2019-03-05v4No1 / 176
515amnoncommon whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, onthophagus ruficapillus2019-04-18v4No1 / 178
311amnoncommon ginger, united states of america, state of rhode island, foodon product type2018-04-09v4No1 / 180
396amnon high in common carp cyprinus carpio compared to rainbow trout oncorhynchus mykiss in fish england intestine digestive system 2018-11-14v4No1 / 184
170amnoncommon river, water, fresh water, depth 10 cm, united states of america, stream2017-07-24v4No1 / 194
371amnoncommon homo sapiens, skin, amerindian, hunter gatherer, venezuela2018-09-06v4No1 / 195
515amnoncommon bembidion decorum, carnivorous beetle, river, poland, raba river, whole body, beetle2019-04-18v4No1 / 198
6amnoncommon urine, female, homo sapiens, pregnancy, state of tennessee2016-10-13v4No1 / 201
443amnoncommon mississippi river, water, river, fresh water, depth 1m, united states of america, uppper mississippi river, upstream, particle, filtered 2.7um2019-01-07v4No1 / 201
515amnon high in herbivorous beetle poland compared to detritivorous beetle bulgaria in whole body beetle 2019-04-19v4No1 / 205
481amnoncommon united states of america, state of alabama, research facility, water, fresh water, pond water, fishpond2019-02-12v4No1 / 210
201amnonhigher in cactus fly compared to decaying cactus ( high in drosophila fly drosophila nigrospiracula compared to cactus decaying in mexico desert )2017-10-01v4No1 / 215
443amnoncommon mississippi river, water, river, fresh water, depth 1m, united states of america, free floating, filtered 0.2um, uppper mississippi river, upstream2019-01-07v4No1 / 219
499amnoncommon brazil, pond, water, pond water, fresh water2019-03-05v4No1 / 228
169amnoncommon lake, fresh water, water, canada, depth 0-1 meter, photic zone2017-07-24v4No1 / 234
492amnoncommon skin, adult, rana catesbeiana, bullfrog, lithobates catesbeianus, frog, japan2019-02-27v4No1 / 236
286amnoncommon in feces of individuals with kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, nephrolithiasis, china)2018-01-27v4No1 / 239
351amnoncommon sea urchin, lytechinus variegatus, coelomic fluid, research facility, eagle harbor, state of florida, united states of america2018-07-30v4No1 / 249
415amnonlower in citrus from humid subtropical compared to mediterranean and semi-arid climate ( high in mediterranean semi-arid compared to subtropical in rhizosphere soil citrus orchard cultivated environment )2018-11-27v4No1 / 264
499amnoncommon brazil, pond, digestive system, intestine, astyanax paranae, fish, astyanax2019-03-05v4No1 / 273
315amnoncommon in frog pond water (common hunan province, jiangxi province, water, fresh water, pond, china)2018-04-10v4No1 / 274
160amnoncommon in river water upstream of WTP effluent in spring in china (common river, water, spring, china)2017-07-12v4No1 / 278
286amnoncommon in feces of individuals without kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, control, china)2018-01-27v4No1 / 281
171amnonlower in roots of drought irrigated rice compared to irrigated conrols ( high in control compared to drought environment in united states of america state of california oryza sativa rice root )2017-07-25v4No1 / 288
515amnoncommon carnivorous beetle, river, poland, raba river, whole body, beetle, bembidion punctulatum2019-04-18v4No1 / 305
499amnoncommon brazil, pond, poecilia reticulata, digestive system, intestine, fish, guppy2019-03-05v4No1 / 308
515amnoncommon carnivorous beetle, river, poland, raba river, whole body, beetle, bembidion varicolor2019-04-18v4No1 / 308
226amnoncommon water, lake, lake erie, united states of america, freshwater lake, fresh water2017-10-29v4No1 / 316
510amnoncommon kingdom of spain, water, estuary, estuary water, fresh water, salinity <5 ppt, bilbao2019-03-20v4No1 / 317
299amnon high in mouth neoplasm cancer compared to control in saliva adult homo sapiens china 2018-02-27v4No1 / 319
311amnoncommon in floor of kimchi production facility (common united states of america, state of rhode island, floor, food processing factory)2018-04-09v4No1 / 324
471amnon high in adult compared to tadpole in digestive system frog osteopilus septentrionalis research facility united states of america state of florida 2019-01-14v4No1 / 328
433amnoncommon sea water, ocean, depth 4m, indian ocean2018-12-19v4No1 / 333
351amnoncommon in artificial sea water where sea urchins were grown (common sea urchin, lytechinus variegatus, research facility, state of florida, united states of america, artificial seawater, sea water)2018-07-30v4No1 / 338
254amnoncommon river, water, fresh water, depth 0.5m, jiulong river, fujian province, china2017-11-23v4No1 / 347
443amnoncommon united states of america, river, water, fresh water, mississippi river, free floating, downstream, depth 1m, filtered 0.2um, lower mississippi river2019-01-07v4No1 / 349
341amnonhigher in fresh drinking water compared to week old water ( high in fresh water compared to stagnant water in water drinking water united states of america tap water state of illinois )2018-05-28v4No1 / 365
160amnoncommon in river water upstream of WTP effluent in autumn in china (common river, water, autumn, china)2017-07-12v4No1 / 376
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
170amnonhigher in low turbidity river water ( high in low turbidity turbidity compared to high turbidity in river water fresh water depth 10 cm united states of america stream )2017-07-24v4No1 / 395
366amnoncommon river nile, water, river, fresh water, depth 50cm, cairo, egypt, winter, dry season2018-08-31v4No1 / 403
558amnon high in gizzard compared to crop in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 408
353amnoncommon in wild Lissotriton vulgaris newts skin (common newt, adult, skin, lissotriton vulgaris, cambridgeshire, united kingdom)2018-07-30v4No1 / 418
515amnoncommon whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, aphodius pusillus2019-04-18v4No1 / 421
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, pseudacris crucifer, peeper2017-04-02v4No1 / 438
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
353amnoncommon in wild Triturus cristatus newts skin (common newt, adult, skin, cambridgeshire, triturus cristatus, united kingdom)2018-07-30v4No1 / 456
160amnoncommon in wastewater treatment plant effluent in autumn in china (common autumn, wastewater treatment plant, effluent, china)2017-07-12v4No1 / 469
366amnoncommon river nile, water, river, fresh water, depth 50cm, cairo, egypt, summer, wet season2018-08-31v4No1 / 474
438amnon high in age 30-50 age 60-79 adult compared to age 3-6 age 8-12 child in homo sapiens feces china 2018-12-30v4No1 / 486
315amnonhigher in frog pond water compared to frog gut ( high in water fresh water compared to digestive system colon frog quasipaa spinosa giant spiny frog in jiangxi province hunan province china )2018-04-10v4No1 / 505
178amnonlower in drinking water compared to loose deposits in water pipes ( high in deposits compared to drinking water in kingdom of the netherlands water )2017-08-10v4No1 / 538
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
304amnoncommon united states of america, state of california, beach, pacific ocean, air, aerosol, san francisco bay2018-03-12v4No1 / 558
443amnoncommon mississippi river, water, river, fresh water, depth 1m, united states of america, particle, filtered 2.7um, downstream, lower mississippi river2019-01-07v4No1 / 568
254amnon high in summer wet season autumn compared to winter dry season in river water fresh water depth 0.5m jiulong river fujian province china 2017-11-23v4No1 / 571
160amnoncommon in wastewater treatment plant effluent in spring in china (common wastewater treatment plant, effluent, spring, china)2017-07-12v4No1 / 573
254amnon high in summer wet season compared to winter dry season autumn in river water fresh water depth 0.5m jiulong river fujian province china 2017-11-23v4No1 / 581
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in kingdom of spain water estuary estuary water bilbao 2019-03-20v4No1 / 592
425amnon high in duodenum compared to feces in homo sapiens africa child 2018-12-08v4No1 / 622
459amnoncommon in surface in aquaculture biofilter sand (common water, fresh water, fish farm, biofilter, sand, united states of america, state of wisconsin, surface)2019-01-12v4No1 / 622
200amnoncommon in river downstream of wastewater treatment plant (common river, fresh water, water, united states of america, wastewater treatment plant, effluent)2017-10-01v4No1 / 655
178amnoncommon in drinking water pipe loose deposits (common kingdom of the netherlands, water, deposits, drinking water)2017-08-10v4No1 / 656
508amnoncommon united states of america, state of minnesota, manganika lake, hypereutrophic lake, sulfidic bottom water, sediment, lake sediment2019-03-17v4No1 / 693
415amnoncommon rhizosphere, soil, citrus, orchard, reunion island, cultivated environment2018-11-27v4No1 / 721
271amnon high in rhizosphere glycine max soybean compared to soil in depth 0-20cm china 2018-01-09v4No1 / 750
206amnoncommon in air from israel particles <10um size (common air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 765
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 836
517amnon high in skin arm forearm compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 836
462amnon high in leaf compared to stem in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 890
103amnoncommon river, united states of america, mississippi river, fresh water, aquatic biome, particle2017-04-05v4No1 / 909
103amnoncommon river, united states of america, mississippi river, fresh water, aquatic biome, free floating2017-04-05v4No1 / 909
359amnoncommon soil, topsoil, depth 0-10cm, guangdong province, subtropical broadleaf forest biome, china, forest ecosystem, woodland area2018-08-19v4No1 / 935
37amnonlower in tomato plant leaves compared to plastic control ( high in control compared to solanum lycopersicum in maryland county leaf )2016-12-09v4No1 / 950
193amnonhigher in nares of people working in dairy farms ( high in bos taurus farm compared to control in homo sapiens united states of america pair of nares )2017-09-05v4No1 / 992
412amnon high in ph>5 compared to ph<5 in soil hunan province red soil cambisol zea mays triticum aestivum china 2018-11-26v4No1 / 1005
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014
252amnoncommon in river rock biofilm (common kingdom of spain, biofilm, river, rock, epilithic)2017-11-22v4No1 / 1081
415amnoncommon rhizosphere, soil, citrus, orchard, kingdom of spain, cultivated environment2018-11-27v4No1 / 1099
515amnon high in carabidae compared to staphylinidae in whole body beetle carnivorous beetle river poland 2019-04-19v4No1 / 1130
266amnon high in leaf compared to root in brassicaceae boechera stricta plant united states of america state of idaho 2017-12-19v4No1 / 1175
252amnoncommon in river sand biofilm (common river, biofilm, kingdom of spain, sand)2017-11-22v4No1 / 1181
415amnoncommon rhizosphere, soil, citrus, orchard, italy, cultivated environment2018-11-27v4No1 / 1279
420amnoncommon in soil of vegetables in organic plastic tunnel (common soil, ph>7, ph 7-8, agricultural feature, farm, shanghai proper, clay loam, organic farming, greenhouse soil, china, cultivated environment)2018-12-02v4No1 / 1294
40amnoncommon soil, field soil, nicotiana tabacum, rhizosphere, china2016-12-09v4No1 / 1420
271amnoncommon rhizosphere, glycine max, depth 0-20cm, soybean, china2018-01-09v4No1 / 1459
101amnon high in rhizosphere compared to root in vitis vinifera united states of america merlot grapevine new york 2017-04-03v4No1 / 1588
536amnon high in aquatic snake compared to terrestrial snake in snake skin united states of america southern united states 2019-07-28v4No1 / 1772
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in newt adult skin cambridgeshire triturus cristatus united kingdom )2018-07-30v4No1 / 1834
101amnoncommon vitis vinifera, united states of america, merlot, grapevine, new york, rhizosphere2017-04-03v4No1 / 1980
175amnoncommon in heavy metal contaminated soils in china (common soil, heavy metal, ph 7-9, china)2017-07-29v4No1 / 2133
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in newt adult skin cambridgeshire lissotriton vulgaris united kingdom )2018-07-30v4No1 / 2162
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>6, ph<7, china2018-02-11v4No1 / 2223
166amnoncommon in river sediment (5cm) with mussels (common united states of america, river, sediment, freshwater biome, mississippi river, depth 5cm, upper mississippi river, mussel, unionidae)2017-07-18v4No1 / 2254
155amnoncommon in soil loosely bound to wheat root (common triticum aestivum, wheat, soil, rhizosphere, china)2017-07-02v4No1 / 2425
101amnoncommon vitis vinifera, united states of america, merlot, grapevine, new york, soil2017-04-03v4No1 / 2537
271amnoncommon depth 0-20cm, soil, china2018-01-09v4No1 / 2856
166amnoncommon in river sediment (5cm) without mussels (common freshwater biome, river, united states of america, sediment, mississippi river, depth 5cm, upper mississippi river)2017-07-18v4No1 / 2877
155amnonlower in tightly bound root soil compared to loose soil and bulk soil ( high in bulk soil compared to root in triticum aestivum wheat soil china )2017-07-02v4No1 / 2933
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>5, ph<6, china2018-02-11v4No1 / 3508
103amnonhigher in particle bound fraction compared to free floating bacteria in mississippi river ( high in particles compared to free floating in river united states of america mississippi river fresh water aquatic biome )2017-04-05v4No1 / 3559
462amnon high in rhizosphere compared to root in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 4630

Problems / suggestions? Please email info AT dbbact DOT org