Search result for sequence:
TACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTATTAAGTCAGATGTGAAATCCCCGCGCTTAACGTGGGAACGGCATTTGAAACTAGTAGACTAGAGTCTTGTAGAGGGGGGTAGAATTCCAGG
common ontology terms
term enrichment score
TermScore
cinara0.666667
cinara atlantica0.333333
cinara contortae0.333333
cinara medispinosa0.333333
cinara murrayanae0.333333
Fraction of dbbact annotations with this term covered by the query
TermScore
cinara0.500000
cinara atlantica0.500000
cinara contortae0.500000
cinara medispinosa0.500000
cinara murrayanae0.500000
Fraction of annotations for the query sequences containing the term
TermScore
cinara1.000000
cinara atlantica0.250000
cinara contortae0.250000
cinara medispinosa0.250000
cinara murrayanae0.250000

Problems / suggestions? Please email info AT dbbact DOT org