Search result for sequence:
TACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGAGCTCAACTTGGGAACTGCATTTGAAACTGGCAAGCTAGAGTCTTGTAGAGGGGGGTAGAATTCCAGG
common ontology terms
term enrichment score
TermScore
oreochromis niloticus0.271845
snake0.271845
nile tilapia0.226415
snake farm0.226415
adula0.226415
intestine0.209302
ictalurus punctatus0.206186
channel catfish0.206186
zebra fish0.186916
texas0.184615
danio rerio0.178571
fresh water0.174545
state of alabama0.163265
spring water0.163265
hunan province0.155844
digestive system0.131579
research facility0.130178
aquatic biome0.127660
state of florida0.127389
caecum0.113208
mississippi river0.113208
fish0.111111
farm0.104575
state of minnesota0.101695
united states of america0.093398
catfish0.088889
elaphe carinata0.088889
king ratsnake0.088889
isla de salvora0.088889
age 8 days0.088889
larus michahellis0.088889
gull0.088889
naja atra0.088889
chinese cobra0.088889
ptyas mucosa0.088889
oriental ratsnake0.088889
age 6-10 weeks0.088889
tonsil0.085106
state of oregon0.078431
age 4 weeks0.078431
river0.077922
state of michigan0.072727
bird0.070175
pig0.067797
sus scrofa0.067797
colon0.061224
water0.060241
kingdom of spain0.059701
c57bl/60.054795
china0.050139
LOWER IN age 9 weeks0.046512
LOWER IN cadmium0.046512
england0.046512
LOWER IN common carp0.046512
LOWER IN cyprinus carpio0.046512
LOWER IN age 12-19 weeks0.046512
location 30.046512
location 10.046512
location 20.046512
location 40.046512
southern united states0.046512
aquatic snake0.046512
LOWER IN terrestrial snake0.046512
particles0.046512
fish feed0.045455
fishpond0.045455
osteopilus septentrionalis0.045455
particle0.045455
LOWER IN pond0.044444
rainbow trout0.044444
oncorhynchus mykiss0.044444
LOWER IN free floating0.044444
LOWER IN larval stage0.043478
LOWER IN fasting0.043478
pond water0.043478
free floating0.043478
LOWER IN fresh water0.042553
tadpole0.042553
frog0.041667
early timepoints0.040000
LOWER IN late timepoints0.040000
LOWER IN water0.038462
LOWER IN caecum0.037736
larval stage0.037037
LOWER IN adult0.033898
female0.033613
skin0.029412
mouse0.027586
mus musculus0.025157
feces0.024969
adult0.016878
control0.010989
Fraction of dbbact annotations with this term covered by the query
TermScore
ictalurus punctatus0.666667
channel catfish0.666667
oreochromis niloticus0.666667
snake0.666667
catfish0.500000
nile tilapia0.500000
snake farm0.500000
adula0.500000
elaphe carinata0.500000
king ratsnake0.500000
isla de salvora0.500000
age 8 days0.500000
larus michahellis0.500000
gull0.500000
naja atra0.500000
chinese cobra0.500000
ptyas mucosa0.500000
oriental ratsnake0.500000
state of alabama0.500000
LOWER IN age 9 weeks0.500000
LOWER IN cadmium0.500000
age 6-10 weeks0.500000
england0.500000
LOWER IN common carp0.500000
LOWER IN cyprinus carpio0.500000
LOWER IN age 12-19 weeks0.500000
spring water0.500000
location 30.500000
location 10.500000
location 20.500000
location 40.500000
aquatic biome0.500000
southern united states0.500000
aquatic snake0.500000
LOWER IN terrestrial snake0.500000
particles0.500000
zebra fish0.400000
danio rerio0.333333
tonsil0.333333
fish feed0.333333
fishpond0.333333
osteopilus septentrionalis0.333333
particle0.333333
texas0.250000
caecum0.250000
LOWER IN pond0.250000
rainbow trout0.250000
oncorhynchus mykiss0.250000
mississippi river0.250000
LOWER IN free floating0.250000
fish0.230769
intestine0.200000
state of oregon0.200000
age 4 weeks0.200000
LOWER IN larval stage0.200000
LOWER IN fasting0.200000
pond water0.200000
free floating0.200000
state of minnesota0.166667
hunan province0.166667
LOWER IN fresh water0.166667
tadpole0.166667
fresh water0.157895
digestive system0.142857
state of michigan0.142857
frog0.142857
state of florida0.133333
bird0.125000
pig0.111111
sus scrofa0.111111
early timepoints0.111111
LOWER IN late timepoints0.111111
LOWER IN water0.090909
LOWER IN caecum0.083333
river0.083333
kingdom of spain0.076923
larval stage0.076923
research facility0.074074
farm0.071429
c57bl/60.062500
LOWER IN adult0.055556
colon0.052632
united states of america0.050000
water0.040000
skin0.037037
china0.028302
female0.025641
mouse0.019231
mus musculus0.016949
feces0.013158
adult0.010204
control0.007092
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.707317
research facility0.536585
feces0.243902
intestine0.219512
china0.219512
farm0.195122
fresh water0.195122
oreochromis niloticus0.170732
snake0.170732
texas0.146341
nile tilapia0.146341
snake farm0.146341
adula0.146341
hunan province0.146341
digestive system0.121951
ictalurus punctatus0.121951
channel catfish0.121951
danio rerio0.121951
zebra fish0.121951
water0.121951
state of florida0.121951
state of alabama0.097561
spring water0.097561
state of minnesota0.073171
colon0.073171
caecum0.073171
fish0.073171
river0.073171
mississippi river0.073171
aquatic biome0.073171
catfish0.048780
elaphe carinata0.048780
king ratsnake0.048780
bird0.048780
isla de salvora0.048780
kingdom of spain0.048780
age 8 days0.048780
larus michahellis0.048780
gull0.048780
naja atra0.048780
chinese cobra0.048780
ptyas mucosa0.048780
oriental ratsnake0.048780
mus musculus0.048780
mouse0.048780
c57bl/60.048780
female0.048780
state of oregon0.048780
age 4 weeks0.048780
adult0.048780
pig0.048780
sus scrofa0.048780
tonsil0.048780
state of michigan0.048780
age 6-10 weeks0.048780
LOWER IN age 9 weeks0.024390
control0.024390
LOWER IN cadmium0.024390
larval stage0.024390
LOWER IN caecum0.024390
LOWER IN pond0.024390
LOWER IN water0.024390
LOWER IN fresh water0.024390
LOWER IN larval stage0.024390
early timepoints0.024390
LOWER IN fasting0.024390
LOWER IN late timepoints0.024390
fish feed0.024390
england0.024390
rainbow trout0.024390
oncorhynchus mykiss0.024390
LOWER IN common carp0.024390
LOWER IN cyprinus carpio0.024390
LOWER IN age 12-19 weeks0.024390
pond water0.024390
fishpond0.024390
location 30.024390
location 10.024390
location 20.024390
frog0.024390
osteopilus septentrionalis0.024390
tadpole0.024390
LOWER IN adult0.024390
location 40.024390
particle0.024390
free floating0.024390
skin0.024390
southern united states0.024390
aquatic snake0.024390
LOWER IN terrestrial snake0.024390
particles0.024390
LOWER IN free floating0.024390
Exp. ID User ID Description Date Region Flag Sequences
255amnondominant catfish, digestive system, united states of america, state of minnesota, research facility, ictalurus punctatus, channel catfish2017-11-24v4No1 / 5
108amnondominant research facility, texas, united states of america, colon, oreochromis niloticus, nile tilapia2017-04-07v4No1 / 6
112amnondominant danio rerio, zebra fish, intestine, research facility, china2017-04-09v4No1 / 6
255amnoncommon catfish, digestive system, united states of america, state of minnesota, research facility, ictalurus punctatus, channel catfish2017-11-24v4No1 / 8
108amnondominant research facility, texas, united states of america, caecum, oreochromis niloticus, nile tilapia2017-04-07v4No1 / 9
530amnondominant snake, feces, snake farm, farm, adula, hunan province, elaphe carinata, king ratsnake, china2019-07-21v4No1 / 10
108amnoncommon research facility, texas, united states of america, caecum, oreochromis niloticus, nile tilapia2017-04-07v4No1 / 12
381amnoncommon bird, isla de salvora, kingdom of spain, age 8 days, feces, larus michahellis, gull2018-10-22v4No1 / 12
530amnondominant snake, feces, snake farm, farm, adula, hunan province, naja atra, chinese cobra, china2019-07-21v4No1 / 13
530amnondominant snake, feces, snake farm, farm, adula, hunan province, ptyas mucosa, oriental ratsnake, china2019-07-21v4No1 / 14
435amnoncommon mus musculus, mouse, feces, research facility, c57bl/6, female, united states of america, state of oregon, age 4 weeks2018-12-23v4No1 / 15
381amnondominant bird, isla de salvora, kingdom of spain, age 8 days, feces, larus michahellis, gull2018-10-22v4No1 / 17
481amnondominant united states of america, state of alabama, research facility, channel catfish, ictalurus punctatus, intestine2019-02-12v4No1 / 17
435amnonlower in mice at end of experiment compared to initial sample ( high in age 4 weeks compared to age 9 weeks in feces united states of america female research facility mus musculus c57bl/6 state of oregon mouse )2018-12-23v4No1 / 23
113amnoncommon danio rerio, zebra fish, research facility, united states of america, intestine, adult2017-04-10v4No1 / 40
267amnonlower in gut of fish in water with cadmium contamination compared to control ( high in control compared to cadmium in fish digestive system oreochromis niloticus research facility china )2017-12-24v4No1 / 40
112amnoncommon danio rerio, zebra fish, intestine, research facility, china2017-04-09v4No1 / 41
108amnoncommon research facility, texas, united states of america, colon, oreochromis niloticus, nile tilapia2017-04-07v4No1 / 43
113amnoncommon danio rerio, zebra fish, research facility, united states of america, intestine, larval stage2017-04-10v4No1 / 45
530amnoncommon snake, feces, snake farm, farm, adula, hunan province, elaphe carinata, king ratsnake, china2019-07-21v4No1 / 63
530amnoncommon snake, feces, snake farm, farm, adula, hunan province, ptyas mucosa, oriental ratsnake, china2019-07-21v4No1 / 86
530amnoncommon snake, feces, snake farm, farm, adula, hunan province, naja atra, chinese cobra, china2019-07-21v4No1 / 90
108amnon high in colon compared to caecum in research facility texas united states of america oreochromis niloticus nile tilapia 2017-04-07v4No1 / 103
388amnoncommon pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 6-10 weeks2018-11-03v4No1 / 112
481amnonhigher in channel catfish intestine compared to the growing pond water ( high in fish ictalurus punctatus channel catfish intestine compared to pond water fresh water in united states of america state of alabama research facility )2019-02-12v4No1 / 118
113amnon high in adult compared to larval stage in danio rerio zebra fish research facility united states of america intestine 2017-04-10v4No1 / 120
108amnondecreases during fasting in nile tilapia caecum ( high in early timepoints compared to fasting late timepoints in research facility texas united states of america caecum oreochromis niloticus nile tilapia )2017-04-07v4No1 / 122
255amnoncommon in fish feed (common united states of america, state of minnesota, research facility, fish feed)2017-11-24v4No1 / 141
396amnon high in rainbow trout oncorhynchus mykiss compared to common carp cyprinus carpio in fish england intestine digestive system 2018-11-14v4No1 / 142
481amnoncommon united states of america, state of alabama, research facility, channel catfish, ictalurus punctatus, intestine2019-02-12v4No1 / 151
388amnon high in age 6-10 weeks compared to age 12-19 weeks in pig sus scrofa tonsil farm united states of america state of michigan 2018-11-03v4No1 / 210
481amnoncommon united states of america, state of alabama, research facility, water, fresh water, pond water, fishpond2019-02-12v4No1 / 210
612amnoncommon state of florida, united states of america, spring water, water, fresh water, location 32020-04-22v4No1 / 420
612amnoncommon state of florida, united states of america, spring water, water, fresh water, location 12020-04-22v4No1 / 518
612amnoncommon state of florida, united states of america, spring water, water, fresh water, location 22020-04-22v4No1 / 596
471amnon high in tadpole compared to adult in digestive system frog osteopilus septentrionalis research facility united states of america state of florida 2019-01-14v4No1 / 648
612amnoncommon state of florida, united states of america, spring water, water, fresh water, location 42020-04-22v4No1 / 655
103amnoncommon river, united states of america, mississippi river, fresh water, aquatic biome, particle2017-04-05v4No1 / 909
103amnoncommon river, united states of america, mississippi river, fresh water, aquatic biome, free floating2017-04-05v4No1 / 909
536amnon high in aquatic snake compared to terrestrial snake in snake skin united states of america southern united states 2019-07-28v4No1 / 1772
103amnonhigher in particle bound fraction compared to free floating bacteria in mississippi river ( high in particles compared to free floating in river united states of america mississippi river fresh water aquatic biome )2017-04-05v4No1 / 3559

Problems / suggestions? Please email info AT dbbact DOT org