Search result for sequence:
TACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGAGCTCAACTTGGGAACTGCATTTGAAACTGGCAAGCTAGAGTCTTGTAGAGGGGGGTAGAATTCCAGG
common ontology terms
term enrichment score
TermScore
oreochromis niloticus0.294737
snake0.294737
nile tilapia0.244898
snake farm0.244898
adula0.244898
intestine0.239203
ictalurus punctatus0.224719
channel catfish0.224719
zebra fish0.202020
texas0.196721
danio rerio0.192308
state of alabama0.177778
hunan province0.164384
research facility0.144856
digestive system0.141343
aquatic biome0.139535
fish0.125000
farm0.124031
mississippi river0.122449
state of minnesota0.115385
fresh water0.109589
catfish0.097561
elaphe carinata0.097561
king ratsnake0.097561
isla de salvora0.097561
age 8 days0.097561
larus michahellis0.097561
gull0.097561
naja atra0.097561
chinese cobra0.097561
ptyas mucosa0.097561
oriental ratsnake0.097561
age 6-10 weeks0.097561
tonsil0.093023
united states of america0.089856
state of oregon0.085106
age 4 weeks0.085106
river0.082192
bird0.078431
state of michigan0.078431
pig0.072727
sus scrofa0.072727
kingdom of spain0.067797
colon0.063830
c57bl/60.059701
caecum0.058252
china0.058065
LOWER IN age 9 weeks0.051282
LOWER IN cadmium0.051282
england0.051282
LOWER IN common carp0.051282
LOWER IN cyprinus carpio0.051282
LOWER IN age 12-19 weeks0.051282
southern united states0.051282
aquatic snake0.051282
LOWER IN terrestrial snake0.051282
particles0.051282
fish feed0.050000
fishpond0.050000
osteopilus septentrionalis0.050000
particle0.050000
LOWER IN pond0.048780
rainbow trout0.048780
oncorhynchus mykiss0.048780
pond water0.048780
LOWER IN free floating0.048780
LOWER IN larval stage0.047619
LOWER IN fasting0.047619
free floating0.047619
LOWER IN fresh water0.046512
tadpole0.046512
frog0.045455
early timepoints0.043478
LOWER IN late timepoints0.043478
LOWER IN caecum0.042553
LOWER IN water0.041667
larval stage0.040000
state of florida0.040000
female0.038095
LOWER IN adult0.037037
skin0.032258
mouse0.029630
feces0.027260
mus musculus0.026846
water0.023810
adult0.019512
control0.012048
Fraction of dbbact annotations with this term covered by the query
TermScore
ictalurus punctatus0.666667
channel catfish0.666667
oreochromis niloticus0.666667
snake0.666667
catfish0.500000
nile tilapia0.500000
snake farm0.500000
adula0.500000
elaphe carinata0.500000
king ratsnake0.500000
isla de salvora0.500000
age 8 days0.500000
larus michahellis0.500000
gull0.500000
naja atra0.500000
chinese cobra0.500000
ptyas mucosa0.500000
oriental ratsnake0.500000
state of alabama0.500000
LOWER IN age 9 weeks0.500000
LOWER IN cadmium0.500000
age 6-10 weeks0.500000
england0.500000
LOWER IN common carp0.500000
LOWER IN cyprinus carpio0.500000
LOWER IN age 12-19 weeks0.500000
aquatic biome0.500000
southern united states0.500000
aquatic snake0.500000
LOWER IN terrestrial snake0.500000
particles0.500000
zebra fish0.400000
danio rerio0.333333
tonsil0.333333
fish feed0.333333
fishpond0.333333
osteopilus septentrionalis0.333333
particle0.333333
fish0.272727
texas0.250000
LOWER IN pond0.250000
rainbow trout0.250000
oncorhynchus mykiss0.250000
pond water0.250000
mississippi river0.250000
LOWER IN free floating0.250000
intestine0.235294
state of minnesota0.200000
state of oregon0.200000
age 4 weeks0.200000
LOWER IN larval stage0.200000
LOWER IN fasting0.200000
free floating0.200000
hunan province0.166667
LOWER IN fresh water0.166667
tadpole0.166667
digestive system0.148148
bird0.142857
state of michigan0.142857
frog0.142857
pig0.111111
sus scrofa0.111111
early timepoints0.111111
LOWER IN late timepoints0.111111
fresh water0.111111
LOWER IN caecum0.100000
kingdom of spain0.090909
LOWER IN water0.090909
farm0.086957
river0.083333
research facility0.082474
larval stage0.076923
state of florida0.076923
c57bl/60.066667
LOWER IN adult0.058824
colon0.052632
united states of america0.048128
caecum0.045455
skin0.040000
china0.032967
female0.029412
water0.021277
mouse0.020408
mus musculus0.017857
feces0.014354
adult0.011905
control0.007752
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.675676
research facility0.594595
feces0.270270
intestine0.243243
china0.243243
farm0.216216
oreochromis niloticus0.189189
snake0.189189
texas0.162162
nile tilapia0.162162
snake farm0.162162
adula0.162162
hunan province0.162162
digestive system0.135135
ictalurus punctatus0.135135
channel catfish0.135135
danio rerio0.135135
zebra fish0.135135
state of alabama0.108108
fresh water0.108108
state of minnesota0.081081
colon0.081081
caecum0.081081
fish0.081081
river0.081081
mississippi river0.081081
aquatic biome0.081081
catfish0.054054
elaphe carinata0.054054
king ratsnake0.054054
bird0.054054
isla de salvora0.054054
kingdom of spain0.054054
age 8 days0.054054
larus michahellis0.054054
gull0.054054
naja atra0.054054
chinese cobra0.054054
ptyas mucosa0.054054
oriental ratsnake0.054054
mus musculus0.054054
mouse0.054054
c57bl/60.054054
female0.054054
state of oregon0.054054
age 4 weeks0.054054
adult0.054054
pig0.054054
sus scrofa0.054054
tonsil0.054054
state of michigan0.054054
age 6-10 weeks0.054054
LOWER IN age 9 weeks0.027027
control0.027027
LOWER IN cadmium0.027027
larval stage0.027027
LOWER IN caecum0.027027
LOWER IN pond0.027027
LOWER IN water0.027027
LOWER IN fresh water0.027027
LOWER IN larval stage0.027027
early timepoints0.027027
LOWER IN fasting0.027027
LOWER IN late timepoints0.027027
fish feed0.027027
england0.027027
rainbow trout0.027027
oncorhynchus mykiss0.027027
LOWER IN common carp0.027027
LOWER IN cyprinus carpio0.027027
LOWER IN age 12-19 weeks0.027027
water0.027027
pond water0.027027
fishpond0.027027
frog0.027027
osteopilus septentrionalis0.027027
tadpole0.027027
LOWER IN adult0.027027
state of florida0.027027
particle0.027027
free floating0.027027
skin0.027027
southern united states0.027027
aquatic snake0.027027
LOWER IN terrestrial snake0.027027
particles0.027027
LOWER IN free floating0.027027
Exp. ID User ID Description Date Region Flag Sequences
255amnonhighfreq catfish, digestive system, united states of america, state of minnesota, research facility, ictalurus punctatus, channel catfish2017-11-24v4No1 / 5
108amnonhighfreq research facility, texas, united states of america, colon, oreochromis niloticus, nile tilapia2017-04-07v4No1 / 6
112amnonhighfreq danio rerio, zebra fish, intestine, research facility, china2017-04-09v4No1 / 6
255amnoncommon catfish, digestive system, united states of america, state of minnesota, research facility, ictalurus punctatus, channel catfish2017-11-24v4No1 / 8
108amnonhighfreq research facility, texas, united states of america, caecum, oreochromis niloticus, nile tilapia2017-04-07v4No1 / 9
530amnonhighfreq snake, feces, snake farm, farm, adula, hunan province, elaphe carinata, king ratsnake, china2019-07-21v4No1 / 10
108amnoncommon research facility, texas, united states of america, caecum, oreochromis niloticus, nile tilapia2017-04-07v4No1 / 12
381amnoncommon bird, isla de salvora, kingdom of spain, age 8 days, feces, larus michahellis, gull2018-10-22v4No1 / 12
530amnonhighfreq snake, feces, snake farm, farm, adula, hunan province, naja atra, chinese cobra, china2019-07-21v4No1 / 13
530amnonhighfreq snake, feces, snake farm, farm, adula, hunan province, ptyas mucosa, oriental ratsnake, china2019-07-21v4No1 / 14
435amnoncommon mus musculus, mouse, feces, research facility, c57bl/6, female, united states of america, state of oregon, age 4 weeks2018-12-23v4No1 / 15
381amnonhighfreq bird, isla de salvora, kingdom of spain, age 8 days, feces, larus michahellis, gull2018-10-22v4No1 / 17
481amnonhighfreq united states of america, state of alabama, research facility, channel catfish, ictalurus punctatus, intestine2019-02-12v4No1 / 17
435amnonlower in mice at end of experiment compared to initial sample ( high in age 4 weeks compared to age 9 weeks in feces united states of america female research facility mus musculus c57bl/6 state of oregon mouse )2018-12-23v4No1 / 23
113amnoncommon danio rerio, zebra fish, research facility, united states of america, intestine, adult2017-04-10v4No1 / 40
267amnonlower in gut of fish in water with cadmium contamination compared to control ( high in control compared to cadmium in fish digestive system oreochromis niloticus research facility china )2017-12-24v4No1 / 40
112amnoncommon danio rerio, zebra fish, intestine, research facility, china2017-04-09v4No1 / 41
108amnoncommon research facility, texas, united states of america, colon, oreochromis niloticus, nile tilapia2017-04-07v4No1 / 43
113amnoncommon danio rerio, zebra fish, research facility, united states of america, intestine, larval stage2017-04-10v4No1 / 45
530amnoncommon snake, feces, snake farm, farm, adula, hunan province, elaphe carinata, king ratsnake, china2019-07-21v4No1 / 63
530amnoncommon snake, feces, snake farm, farm, adula, hunan province, ptyas mucosa, oriental ratsnake, china2019-07-21v4No1 / 86
530amnoncommon snake, feces, snake farm, farm, adula, hunan province, naja atra, chinese cobra, china2019-07-21v4No1 / 90
108amnon high in colon compared to caecum in research facility texas united states of america oreochromis niloticus nile tilapia 2017-04-07v4No1 / 103
388amnoncommon pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 6-10 weeks2018-11-03v4No1 / 112
481amnonhigher in channel catfish intestine compared to the growing pond water ( high in fish ictalurus punctatus channel catfish intestine compared to pond water fresh water in united states of america state of alabama research facility )2019-02-12v4No1 / 118
113amnon high in adult compared to larval stage in danio rerio zebra fish research facility united states of america intestine 2017-04-10v4No1 / 120
108amnondecreases during fasting in nile tilapia caecum ( high in early timepoints compared to fasting late timepoints in research facility texas united states of america caecum oreochromis niloticus nile tilapia )2017-04-07v4No1 / 122
255amnoncommon in fish feed (common united states of america, state of minnesota, research facility, fish feed)2017-11-24v4No1 / 141
396amnon high in rainbow trout oncorhynchus mykiss compared to common carp cyprinus carpio in fish england intestine digestive system 2018-11-14v4No1 / 142
481amnoncommon united states of america, state of alabama, research facility, channel catfish, ictalurus punctatus, intestine2019-02-12v4No1 / 151
388amnon high in age 6-10 weeks compared to age 12-19 weeks in pig sus scrofa tonsil farm united states of america state of michigan 2018-11-03v4No1 / 210
481amnoncommon united states of america, state of alabama, research facility, water, fresh water, pond water, fishpond2019-02-12v4No1 / 210
471amnon high in tadpole compared to adult in digestive system frog osteopilus septentrionalis research facility united states of america state of florida 2019-01-14v4No1 / 648
103amnoncommon river, united states of america, mississippi river, fresh water, aquatic biome, particle2017-04-05v4No1 / 909
103amnoncommon river, united states of america, mississippi river, fresh water, aquatic biome, free floating2017-04-05v4No1 / 909
536amnon high in aquatic snake compared to terrestrial snake in snake skin united states of america southern united states 2019-07-28v4No1 / 1772
103amnonhigher in particle bound fraction compared to free floating bacteria in mississippi river ( high in particles compared to free floating in river united states of america mississippi river fresh water aquatic biome )2017-04-05v4No1 / 3559

Problems / suggestions? Please email info AT dbbact DOT org