Search result for sequence:
TACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGCGCTTAACGTGGGAACTGCATTTGAAACTGGCAAGCTAGAGTCTTGTAGAGGGGGGTAGAATTCCAGG
common ontology terms
term enrichment score
TermScore
skin0.190250
beetle0.184971
poland0.161074
whole body0.144796
united states of america0.129689
child0.125000
foodon product type0.118519
nida basin0.113475
herbivorous beetle0.113475
plant0.111801
river0.107383
china0.105634
sweden0.097959
food (fermented)0.097448
homo sapiens0.089244
populus0.087591
rhizosphere0.083770
new york city0.080537
state of tennessee0.077419
tree0.077419
canada0.076923
water0.076364
newt0.075472
state of rhode island0.074074
soil0.070529
cultivated environment0.069364
infant0.063830
late timepoint0.061381
ensete ventricosum0.060150
ethiopian banana0.060150
cambridgeshire0.060150
detritivorous beetle0.060150
bulgaria0.060150
balkan mountains0.060150
carnivorous beetle0.060150
LOWER IN soil0.058394
autumn0.057831
intestine0.057143
ethiopia0.056738
air0.054422
kingdom of spain0.052980
digestive system0.051282
saliva0.050740
united kingdom0.049689
pond0.046875
fungus growing ant0.045802
age 2 years0.045802
bon portage island0.045802
oceanodroma leucorhoa0.045802
seabird0.045802
raba river0.045802
panama0.044776
research facility0.044586
bird0.040268
feces0.039604
adult0.039585
salamander0.031250
argoptochus quadrisignatus0.031008
garlic0.031008
nile tilapia0.031008
LOWER IN fresh0.031008
LOWER IN early timepoint0.031008
southern united states0.031008
pantherophis obsoletus0.031008
black rat snake0.031008
arboreal snake0.031008
skin of face0.031008
skin under eyes0.031008
contact lens0.031008
cloud0.031008
age 7 years0.031008
andrias japonicus0.031008
japanese giant salamander0.031008
douchi0.031008
aerobic fermentation0.031008
days 1-150.031008
pyrenees0.031008
pikas0.031008
LOWER IN late timepoint0.031008
triturus cristatus0.031008
lissotriton vulgaris0.031008
days 30-600.031008
anaerobic fermentation0.031008
LOWER IN chronic rhinosinusitis0.031008
LOWER IN sinusitis0.031008
siberia0.031008
chuquisaca department0.031008
forearm0.031008
commonwealth of virginia0.030769
peatland0.030769
oreochromis niloticus0.030534
snake0.030534
age 6 months0.030534
sputum0.030534
ochotonidae0.030534
tibetan plateau0.030534
age < 3 years0.030534
soybean0.030534
age 5-13 years0.030534
arm0.030534
Fraction of dbbact annotations with this term covered by the query
TermScore
pond1.000000
canada1.000000
foodon product type0.800000
late timepoint0.750000
newt0.666667
salamander0.666667
no antimicrobial treatment0.500000
LOWER IN antimicrobial treatment0.500000
ground beef food product0.500000
poland0.500000
nida basin0.500000
herbivorous beetle0.500000
argoptochus quadrisignatus0.500000
cheilotoma musciformis0.500000
state of rhode island0.500000
garlic0.500000
aphthona venustula0.500000
nile tilapia0.500000
food spoilage0.500000
LOWER IN fresh0.500000
LOWER IN early timepoint0.500000
fungus growing ant0.500000
atta colombica0.500000
polydrusus inustus0.500000
southern united states0.500000
pantherophis obsoletus0.500000
black rat snake0.500000
arboreal snake0.500000
human0.500000
skin under eye0.500000
LOWER IN conjunctiva0.500000
skin of face0.500000
skin under eyes0.500000
mycocepurus smithii0.500000
age 2 years0.500000
contact lens0.500000
cloud0.500000
crioceris quatuordecimpunctata0.500000
age 7 years0.500000
eusomus ovulum0.500000
zea mays subsp. mays0.500000
corn0.500000
fermented corn0.500000
days 2-300.500000
LOWER IN fresh corn0.500000
LOWER IN time 00.500000
andrias japonicus0.500000
japanese giant salamander0.500000
LOWER IN amphibian larval stage0.500000
squash0.500000
myrmicocrypta ednaella0.500000
LOWER IN age 7 years0.500000
douchi0.500000
ensete ventricosum0.500000
ethiopian banana0.500000
aerobic fermentation0.500000
days 1-150.500000
steno bredanensis0.500000
rough-toothed dolphin0.500000
LOWER IN days 57-600.500000
days 0-30.500000
harvard forest0.500000
plant fluid0.500000
pitcher fluid0.500000
pitcher plant0.500000
sarracenia purpurea0.500000
pyrenees0.500000
LOWER IN zoo0.500000
area designated as a nature reserve0.500000
termite0.500000
reticulitermes flaviceps0.500000
LOWER IN wood diet0.500000
pikas0.500000
bon portage island0.500000
oceanodroma leucorhoa0.500000
seabird0.500000
brood patch0.500000
kimchi0.500000
LOWER IN days 1-90.500000
notophthalmus viridescens0.500000
age <1 year0.500000
LOWER IN acute respiratory illness0.500000
middle timepoint0.500000
two weeks0.500000
LOWER IN food spoilage0.500000
LOWER IN late timepoint0.500000
cambridgeshire0.500000
triturus cristatus0.500000
centricnemus leucogrammus0.500000
lissotriton vulgaris0.500000
ochotona0.500000
eastern red backed salamander0.500000
plethodon cinereus0.500000
LOWER IN temp 20c0.500000
temp 10c0.500000
LOWER IN days 30-600.500000
LOWER IN anaerobic fermentation0.500000
days 30-600.500000
anaerobic fermentation0.500000
ensete ventricosum var. ketishe0.500000
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.232000
homo sapiens0.232000
whole body0.128000
beetle0.128000
skin0.128000
china0.120000
child0.120000
poland0.096000
sweden0.096000
saliva0.096000
feces0.080000
plant0.072000
foodon product type0.064000
nida basin0.064000
herbivorous beetle0.064000
river0.064000
rhizosphere0.064000
research facility0.056000
adult0.056000
food (fermented)0.056000
water0.056000
soil0.056000
new york city0.048000
state of tennessee0.048000
populus0.048000
tree0.048000
cultivated environment0.048000
state of rhode island0.040000
digestive system0.040000
intestine0.040000
infant0.040000
canada0.040000
newt0.040000
late timepoint0.032000
air0.032000
autumn0.032000
ethiopia0.032000
ensete ventricosum0.032000
ethiopian banana0.032000
kingdom of spain0.032000
control0.032000
cambridgeshire0.032000
united kingdom0.032000
detritivorous beetle0.032000
bulgaria0.032000
balkan mountains0.032000
carnivorous beetle0.032000
LOWER IN soil0.032000
panama0.024000
fungus growing ant0.024000
age 2 years0.024000
pond0.024000
bon portage island0.024000
bird0.024000
oceanodroma leucorhoa0.024000
seabird0.024000
raba river0.024000
argoptochus quadrisignatus0.016000
garlic0.016000
texas0.016000
caecum0.016000
oreochromis niloticus0.016000
nile tilapia0.016000
LOWER IN fresh0.016000
LOWER IN early timepoint0.016000
age 1 year0.016000
snake0.016000
southern united states0.016000
pantherophis obsoletus0.016000
black rat snake0.016000
arboreal snake0.016000
skin of face0.016000
skin under eyes0.016000
age 6 months0.016000
age 3 months0.016000
contact lens0.016000
cloud0.016000
french republic0.016000
age 7 years0.016000
sputum0.016000
lung0.016000
bronchial epithelium0.016000
vancouver0.016000
andrias japonicus0.016000
japanese giant salamander0.016000
japan0.016000
douchi0.016000
early timepoint0.016000
aerobic fermentation0.016000
days 1-150.016000
pyrenees0.016000
winter0.016000
ochotonidae0.016000
pikas0.016000
mouth0.016000
commonwealth of virginia0.016000
nasopharynx0.016000
australia0.016000
LOWER IN late timepoint0.016000
triturus cristatus0.016000
Exp. ID User ID Description Date Region Flag Sequences
525amnonhigher in ground beef with no antimicrobial treatment ( high in no antimicrobial treatment compared to antimicrobial treatment in united states of america state of colorado foodon product type ground beef food product )2019-07-10v4No1 / 3
515amnondominant poland, whole body, beetle, plant, nida basin, herbivorous beetle, argoptochus quadrisignatus2019-04-18v4No1 / 4
515amnondominant poland, whole body, beetle, plant, nida basin, herbivorous beetle, cheilotoma musciformis2019-04-18v4No1 / 5
311amnondominant united states of america, state of rhode island, garlic, foodon product type2018-04-09v4No1 / 6
515amnondominant poland, whole body, beetle, aphthona venustula, plant, nida basin, herbivorous beetle2019-04-18v4No1 / 8
108amnondominant research facility, texas, united states of america, caecum, oreochromis niloticus, nile tilapia2017-04-07v4No1 / 9
269amnonincreases during one month in refrigeration of yao meat ( high in late timepoint food spoilage compared to fresh early timepoint in china foodon product type )2018-01-09v4No1 / 11
397amnondominant panama, digestive system, intestine, fungus growing ant, atta colombica2018-11-14v4No1 / 12
596amnondominant homo sapiens, sweden, saliva, child, age 1 year2020-03-17v3No1 / 12
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, polydrusus inustus2019-04-18v4No1 / 13
536amnondominant snake, skin, united states of america, southern united states, pantherophis obsoletus, black rat snake, arboreal snake2019-07-28v4No1 / 13
58amnon high in skin skin under eye compared to conjunctiva in human new york city 2017-02-02v4No1 / 14
58amnondominant homo sapiens, new york city, skin of face, skin under eyes2017-02-02v4No1 / 14
397amnoncommon panama, digestive system, intestine, fungus growing ant, mycocepurus smithii2018-11-14v4No1 / 14
596amnondominant homo sapiens, sweden, saliva, child, age 6 months, infant2020-03-17v3No1 / 14
596amnondominant homo sapiens, sweden, saliva, child, age 2 years2020-03-17v3No1 / 14
596amnondominant homo sapiens, sweden, saliva, child, age 3 months2020-03-17v3No1 / 14
58amnondominant homo sapiens, new york city, contact lens2017-02-02v4No1 / 15
228amnonhigh freq. in sinus brush of sinusitis patients (dominant homo sapiens, mucosa, sinusoidal space, paranasal sinus, united states of america, sinusitis)2017-10-31v4No1 / 15
253amnonhigh freq. in clouds in puy de dome mountain in france (dominant cloud, french republic, air, autumn)2017-11-22v4No1 / 15
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, crioceris quatuordecimpunctata2019-04-18v4No1 / 15
596amnondominant homo sapiens, sweden, saliva, child, age 7 years2020-03-17v3No1 / 15
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, eusomus ovulum2019-04-18v4No1 / 18
306amnonincreases after 2-30 days of fermentation of insiled whole plant corn ( high in fermented corn days 2-30 compared to fresh corn time 0 in zea mays subsp. mays corn whole plant israel )2018-03-19v4No1 / 19
33amnondominant homo sapiens, sputum, lung, bronchial epithelium, vancouver2016-12-06v4No1 / 21
58amnoncommon homo sapiens, new york city, skin of face, skin under eyes2017-02-02v4No1 / 21
596amnoncommon homo sapiens, sweden, saliva, child, age 3 months2020-03-17v3No1 / 21
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, argoptochus quadrisignatus2019-04-18v4No1 / 22
58amnoncommon homo sapiens, new york city, contact lens2017-02-02v4No1 / 23
338amnon high in adult compared to tadpole amphibian larval stage larval stage in andrias japonicus japanese giant salamander skin japan 2018-05-21v4No1 / 24
74amnoncommon squash, united states of america, foodon product type2017-02-27v4No1 / 27
58amnoncommon homo sapiens, new york city, conjunctiva2017-02-02v4No1 / 28
397amnoncommon panama, digestive system, intestine, fungus growing ant, myrmicocrypta ednaella2018-11-14v4No1 / 28
596amnon high in age 2 years compared to age 7 years in homo sapiens sweden saliva child 2020-03-18v3No1 / 28
90amnonincreases during douchi fermentation ( high in timepoint late timepoint compared to early timepoint in douchi china food (fermented) )2017-03-08v4No1 / 30
311amnoncommon united states of america, state of rhode island, garlic, foodon product type2018-04-09v4No1 / 34
539amnoncommon ethiopia, ensete ventricosum, ethiopian banana, early timepoint, aerobic fermentation, days 1-15, food (fermented)2019-07-31v4No1 / 35
79amnoncommon skin, united states of america, steno bredanensis, rough-toothed dolphin2017-03-03v4No1 / 35
596amnoncommon homo sapiens, sweden, saliva, child, age 6 months, infant2020-03-17v3No1 / 35
596amnoncommon homo sapiens, sweden, saliva, child, age 1 year2020-03-17v3No1 / 36
33amnoncommon homo sapiens, sputum, lung, bronchial epithelium, vancouver2016-12-06v4No1 / 40
614amnondecreases in picher plant fluid grown in lab ( high in wild early time points days 0-3 compared to research facility late time points days 57-60 in harvard forest plant fluid pitcher fluid united states of america commonwealth of massachusetts pitcher plant sarracenia purpurea )2020-04-26v4No1 / 42
403amnoncommon air, kingdom of spain, pyrenees, winter2018-11-18v4No1 / 42
338amnonhigher in wild salamanders compared to zoo grown salamanders ( high in pond area designated as a nature reserve compared to zoological garden zoo in andrias japonicus japanese giant salamander skin japan )2018-05-21v4No1 / 51
416amnon high in fasting compared to wood diet in termite reticulitermes flaviceps colon research facility united states of america 2018-11-30v4No1 / 52
279amnon high in mouth compared to small intestine stomach in ochotonidae pikas china 2018-01-24v4No1 / 53
237amnoncommon canada, bon portage island, bird, oceanodroma leucorhoa, seabird, brood patch2017-11-07v4No1 / 57
596amnoncommon homo sapiens, sweden, saliva, child, age 2 years2020-03-17v3No1 / 57
237amnoncommon bird, oceanodroma leucorhoa, seabird, canada, bon portage island, uropygial gland2017-11-07v4No1 / 58
596amnoncommon homo sapiens, sweden, saliva, child, age 7 years2020-03-17v3No1 / 59
90amnoncommon douchi, china, food (fermented)2017-03-08v4No1 / 61
311amnonlower in fermneted kimchi days>1 compared to day 0 ( high in day 0 early timepoints compared to days 1-9 in united states of america state of rhode island kimchi food (fermented) )2018-04-09v4No1 / 62
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, notophthalmus viridescens, newt2017-04-02v4No1 / 74
596amnon high in age <1 year compared to age 1-7 years in homo sapiens sweden saliva child 2020-03-18v3No1 / 78
108amnon high in caecum compared to colon in research facility texas united states of america oreochromis niloticus nile tilapia 2017-04-07v4No1 / 80
133amnonhigher in healthy babies (<1yr) compared to acute respiratory illness ( high in control compared to acute respiratory illness respiratory system disease in homo sapiens infant nasopharynx australia )2017-04-16v4No1 / 80
269amnonpeaks at 2 weeks in refrigeration of yao meat ( high in middle timepoint two weeks compared to fresh food spoilage late timepoint in china foodon product type )2018-01-09v4No1 / 83
353amnoncommon in captive Triturus cristatus newts skin (common newt, adult, skin, cambridgeshire, triturus cristatus, research facility, united kingdom)2018-07-30v4No1 / 84
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, centricnemus leucogrammus2019-04-18v4No1 / 84
353amnoncommon in captive Lissotriton vulgaris newts skin (common newt, adult, skin, cambridgeshire, research facility, lissotriton vulgaris, united kingdom)2018-07-30v4No1 / 86
17amnon high in low altitude compared to high altitude in ochotona feces stomach tibetan plateau 2016-11-09v4No1 / 95
427amnonlower in salamanders kept at 20C compared to 10C ( high in temp 10c compared to temp 20c in united states of america eastern red backed salamander plethodon cinereus salamander feces commonwealth of virginia )2018-12-08v4No1 / 95
279amnoncommon ochotonidae, pikas, mouth, china2018-01-24v4No1 / 103
377amnoncommon salamandra salamandra, salamander, skin, germany2018-09-12v4No1 / 106
353amnonhigher in captive compared to wild caught Lissotriton vulgaris newts skin ( high in research facility compared to wild in newt adult skin cambridgeshire lissotriton vulgaris united kingdom )2018-07-30v4No1 / 110
539amnon high in early timepoint days 1-15 aerobic fermentation compared to late timepoint days 30-60 anaerobic fermentation in ethiopia ensete ventricosum ethiopian banana food (fermented) 2019-07-31v4No1 / 110
539amnon high in ensete ventricosum var. ketishe compared to ensete ventricosum var. gena in ethiopia ensete ventricosum ethiopian banana late timepoint days 30-60 anaerobic fermentation food (fermented) 2019-07-31v4No1 / 110
269amnoncommon in fresh yao meat food (common china, foodon product type)2018-01-09v4No1 / 113
567amnon high in control compared to chronic rhinosinusitis sinusitis in homo sapiens adult belgium nasopharynx 2019-12-05v4No1 / 114
410amnonlower in feces compared to rectal biopsies in children with treatment naive uc ( high in rectum biopsy biopsy site compared to feces in homo sapiens child united states of america ulcerative colitis )2018-11-22v4No1 / 118
515amnoncommon whole body, beetle, aphodius depressus, detritivorous beetle, feces, bulgaria, balkan mountains2019-04-18v4No1 / 121
515amnoncommon whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, aphodius sphacelatus2019-04-18v4No1 / 127
515amnoncommon carnivorous beetle, river, poland, raba river, whole body, beetle, bembidion modestum2019-04-18v4No1 / 131
109amnon high in distribution system compared to water treatment plant in water drinking water united states of america site e 2017-04-08v4No1 / 143
241amnonhigher in babies from russia compared to estonia ( high in russia compared to estonia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 146
355amnoncommon canada, province of british columbia, calvert island, pacific ocean, ocean, gloiopeltis, gloiopeltis furcata, alga, glueweed2018-08-01v4No1 / 147
515amnoncommon whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, aphodius haemorrhoidalis2019-04-18v4No1 / 147
362amnoncommon hydrothermal vent, greece, marine sediment, mediterranean sea, marine hydrothermal vent, volcanic rock, volcanic crater, water, sea water, active vent2018-08-29v4No1 / 150
192amnoncommon seed, seed structure, brassica napus2017-09-05v4No1 / 161
539amnoncommon ethiopia, ensete ventricosum, ethiopian banana, late timepoint, days 30-60, anaerobic fermentation, food (fermented)2019-07-31v4No1 / 161
462amnon high in populus deltoides compared to populus trichocarpa x deltoides in united states of america state of tennessee populus tree stem cultivated environment 2019-01-13v4No1 / 166
403amnon high in winter compared to summer in air kingdom of spain pyrenees autumn 2018-11-18v4No1 / 176
311amnoncommon ginger, united states of america, state of rhode island, foodon product type2018-04-09v4No1 / 180
536amnoncommon snake, skin, united states of america, southern united states, pantherophis obsoletus, black rat snake, arboreal snake2019-07-28v4No1 / 184
567amnon high in control compared to sinusitis chronic rhinosinusitis in homo sapiens adult belgium anterior naris pair of nares 2019-12-05v4No1 / 191
80amnon high in dry forest compared to tropical moist broadleaf forest biome in feces alouatta pigra howler monkey central america state of florida 2017-03-03v4No1 / 193
109amnon high in water treatment plant compared to distribution system in usa water drinking water site c 2017-04-08v4No1 / 193
515amnoncommon bembidion decorum, carnivorous beetle, river, poland, raba river, whole body, beetle2019-04-18v4No1 / 198
161amnoncommon in barn swallows in colorado (common hirundo rustica, feces, united states of america, colorado, barn swallow)2017-07-12v4No1 / 245
351amnoncommon sea urchin, lytechinus variegatus, coelomic fluid, research facility, eagle harbor, state of florida, united states of america2018-07-30v4No1 / 249
253amnoncommon in clouds in puy de dome mountain in france (common cloud, french republic, air, autumn)2017-11-22v4No1 / 267
499amnoncommon brazil, pond, digestive system, intestine, astyanax paranae, fish, astyanax2019-03-05v4No1 / 273
423amnoncommon bank vole, myodes glareolus, ukraine, skin2018-12-05v4No1 / 291
237amnonlower in burrow soil compared to bird ( high in oceanodroma leucorhoa bird seabird compared to soil burrow in canada bon portage island )2017-11-07v4No1 / 298
515amnoncommon carnivorous beetle, river, poland, raba river, whole body, beetle, bembidion punctulatum2019-04-18v4No1 / 305
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 306
499amnoncommon brazil, pond, poecilia reticulata, digestive system, intestine, fish, guppy2019-03-05v4No1 / 308
311amnoncommon in floor of kimchi production facility (common united states of america, state of rhode island, floor, food processing factory)2018-04-09v4No1 / 324
160amnoncommon in river water upstream of WTP effluent in autumn in china (common river, water, autumn, china)2017-07-12v4No1 / 376
147amnoncommon soil, siberia, peatland, ph 4.5, lichen, moss2017-04-20v4No1 / 396
147amnoncommon tundra, soil, pinus siberica, pine forest, ph 4, siberia, forest ecosystem2017-04-20v4No1 / 416
515amnoncommon whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, aphodius pusillus2019-04-18v4No1 / 421
353amnoncommon in wild Triturus cristatus newts skin (common newt, adult, skin, cambridgeshire, triturus cristatus, united kingdom)2018-07-30v4No1 / 456
504amnon high in water sea water compared to sediment marine sediment in nan'ao island china 2019-03-14v4No1 / 462
462amnon high in stem compared to leaf in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 477
512amnoncommon fen, peatland, peat soil, soil, ph 5.5-6.5, tibetan plateau, riganqiao peatland, china2019-03-22v4No1 / 483
357amnoncommon soil, topsoil, depth 0-10cm, southern temperate forest, temperate broadleaf and mixed forest biome, woodland area, forest ecosystem2018-08-19v4No1 / 499
373amnoncommon soil, rhizosphere, oryza sativa, rice, hunan province, rice field, china2018-09-08v4No1 / 501
200amnoncommon in river downstream of wastewater treatment plant (common river, fresh water, water, united states of america, wastewater treatment plant, effluent)2017-10-01v4No1 / 655
271amnon high in rhizosphere glycine max soybean compared to soil in depth 0-20cm china 2018-01-09v4No1 / 750
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 836
517amnon high in skin arm forearm compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 836
462amnoncommon united states of america, state of tennessee, depth 30-75cm, silt clay loam, rhizosphere, populus, tree, cultivated environment2019-01-13v4No1 / 908
462amnoncommon united states of america, state of tennessee, rhizosphere, populus, tree, depth 0-30cm, silt loam, cultivated environment2019-01-13v4No1 / 997
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014
252amnoncommon in river rock biofilm (common kingdom of spain, biofilm, river, rock, epilithic)2017-11-22v4No1 / 1081
515amnon high in carabidae compared to staphylinidae in whole body beetle carnivorous beetle river poland 2019-04-19v4No1 / 1130
266amnon high in leaf compared to root in brassicaceae boechera stricta plant united states of america state of idaho 2017-12-19v4No1 / 1175
252amnoncommon in river sand biofilm (common river, biofilm, kingdom of spain, sand)2017-11-22v4No1 / 1181
40amnoncommon soil, field soil, nicotiana tabacum, rhizosphere, china2016-12-09v4No1 / 1420
462amnon high in rhizosphere compared to soil in united states of america state of tennessee populus tree cultivated environment 2019-01-12v4No1 / 1428
271amnoncommon rhizosphere, glycine max, depth 0-20cm, soybean, china2018-01-09v4No1 / 1459
155amnonhigher in tightly bound root soil compared to loose soil and bulk soil ( high in root compared to bulk soil in triticum aestivum wheat soil china )2017-07-02v4No1 / 1714
265amnon high in soilwater water compared to soil in canada province of quebec 2017-12-11v4No1 / 3277
462amnon high in rhizosphere compared to root in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 4630

Problems / suggestions? Please email info AT dbbact DOT org