Search result for sequence:
TACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCTGATACTGGCAAGCTTGAGTCTCGTAGAGGGGGGTAGAATTCCAGG
common ontology terms
term enrichment score
TermScore
feces0.599392
homo sapiens0.444551
united states of america0.389300
adult0.256832
research facility0.232130
china0.204889
infant0.115241
soil0.111332
child0.097839
caecum0.093853
mus musculus0.093466
canis lupus familiaris0.088328
wild0.085618
mouse0.084965
dog0.080775
farm0.080525
state of california0.073286
adult organism0.072304
control0.067926
female0.066350
canada0.064372
LOWER IN control0.061111
chicken0.058755
gallus gallus0.058540
rural community0.055844
sus scrofa0.055604
pig0.050826
male0.050757
monkey0.049729
state of michigan0.047695
bird0.046285
city0.046139
captive0.044206
kingdom of spain0.043699
brazil0.042688
zoological garden0.042659
skin0.040908
australia0.040131
nigeria0.038961
ileum0.038363
obsolete_juvenile stage0.036908
french republic0.036852
israel0.036599
whole body0.036185
state of texas0.034091
hospital0.030850
iowa0.030732
depth (soil) 0-20cm0.030694
ulcerative colitis0.030564
water0.030349
colon0.029911
crohn's disease0.029126
india0.029107
male organism0.028731
rectum0.027611
antibiotic0.027450
broiler chicken0.027375
nicollet soil series0.027375
des moines0.027375
united states0.027375
austria0.025873
river0.025806
rat0.025806
kingdom of denmark0.025723
united kingdom0.025339
marine sediment0.025078
fresh water0.025067
zea mays0.024673
edo state0.024530
1-month-old human stage0.024470
diarrhea0.024380
ovis aries0.024275
commonwealth of pennsylvania0.024233
c57bl/60.024168
agricultural field0.024079
body proper0.023659
jiangsu province0.023566
rhizosphere0.023465
larval stage0.022768
duodenum0.022690
coyote0.022654
canis latrans0.022654
edmonton0.022654
age 6 weeks0.022654
kellogg biological station0.022654
mesic type hapludalf0.022654
kalamazoo loam0.022654
equus caballus0.022603
horse0.022603
glycine max0.022275
rectal swab0.021237
nepal0.021181
urocyon littoralis catalinae0.021070
santa catalina island fox0.021070
urocyon littoralis0.021070
age0.021048
thailand0.020996
santa catalina island0.020850
mangrove swamp0.020635
balb/c0.019645
Fraction of dbbact annotations with this term covered by the query
TermScore
marmosets2.000000
abnormality of the intestine1.000000
canine chronic enteropathy1.000000
chronic enteropathy1.000000
virginiamycin1.000000
state of indiana1.000000
salmonella infections1.000000
odontomachus chelifer1.000000
sao paulo state1.000000
atlantic rainforest1.000000
parque estadual serra do mar-núcleo picinguaba1.000000
odontomachus hastatus1.000000
edo state1.000000
nigeria1.000000
meconium1.000000
cuticle1.000000
chitin-based cuticle1.000000
cheese food product1.000000
canastra cheese1.000000
time 22 days1.000000
state of wyoming1.000000
raw milk1.000000
chicken farm1.000000
pig farm1.000000
bethesda1.000000
chlorocebus sabaeus1.000000
sabaeus monkey1.000000
anal swab1.000000
mexican american1.000000
zealand1.000000
9-month-old human stage1.000000
15-month-old human stage1.000000
house cat1.000000
LOWER IN bean flour diet1.000000
no bean flour diet1.000000
6-propyl-2-thiouracil1.000000
callithrix jacchus1.000000
los angeles1.000000
LOWER IN pig farm1.000000
LOWER IN 9-month-old human stage1.000000
callithrix <genus>1.000000
sea otter1.000000
enhydra lutris nereis1.000000
LOWER IN reserva biológica de mogi-guaçu1.000000
black soldier fly1.000000
hermetia illucens1.000000
tours1.000000
cane toad1.000000
bufo marinus1.000000
arapaho national forest1.000000
medicine bow - routt national forest1.000000
depth (snow) 0-5cm1.000000
LOWER IN new england source (neprc)1.000000
japanese source (clea)1.000000
LOWER IN fully formed stage1.000000
deqing county1.000000
crested ibis1.000000
nipponia nippon1.000000
antimicrobial agent1.000000
antibiotics supllemented diet1.000000
white cheese1.000000
canakkale district1.000000
ezine cheese1.000000
LOWER IN glacier peak wilderness1.000000
bornean orangutan1.000000
pongo pygmaeus1.000000
houston1.000000
orangutan1.000000
pongo sp.1.000000
columbus1.000000
LOWER IN farm21.000000
farm11.000000
state of texas0.875000
balb/c0.875000
1-month-old human stage0.833333
hospital0.800000
rectal swab0.800000
monkey0.800000
rural community0.769231
village0.750000
obese body mass index status0.750000
small village0.750000
state of arizona0.750000
rectum0.727273
adult organism0.714286
canis lupus familiaris0.689655
sus scrofa0.687500
diarrhea0.666667
felis catus0.666667
LOWER IN iron supplemented diet0.666667
iron deficient diet0.666667
iowa0.666667
ant0.666667
bangladesh0.666667
2-month-old human stage0.666667
deer0.666667
age 2 weeks0.666667
dust0.666667
amerindian0.666667
venezuela0.666667
Fraction of annotations for the query sequences containing the term
TermScore
feces0.558775
homo sapiens0.390728
united states of america0.302980
adult0.182119
research facility0.152318
china0.146523
soil0.073675
infant0.063742
child0.053808
caecum0.051325
mus musculus0.051325
canis lupus familiaris0.047185
wild0.047185
mouse0.046358
farm0.044702
dog0.043046
control0.042219
state of california0.038907
adult organism0.038079
female0.038079
LOWER IN control0.035596
canada0.034768
chicken0.031457
gallus gallus0.031457
sus scrofa0.028974
male0.028974
rural community0.028974
pig0.026490
monkey0.025662
state of michigan0.024834
bird0.024007
city0.024007
captive0.023179
kingdom of spain0.023179
brazil0.022351
zoological garden0.022351
skin0.021523
australia0.021523
ileum0.019868
nigeria0.019868
israel0.019040
french republic0.019040
whole body0.019040
obsolete_juvenile stage0.019040
depth (soil) 0-20cm0.018212
state of texas0.017384
water0.016556
colon0.015728
iowa0.015728
hospital0.015728
ulcerative colitis0.015728
male organism0.014901
crohn's disease0.014901
india0.014901
broiler chicken0.014073
antibiotic0.014073
nicollet soil series0.014073
des moines0.014073
united states0.014073
agricultural field0.014073
zea mays0.014073
rectum0.014073
united kingdom0.013245
austria0.013245
river0.013245
fresh water0.013245
kingdom of denmark0.013245
rat0.013245
marine sediment0.013245
diarrhea0.012417
commonwealth of pennsylvania0.012417
c57bl/60.012417
body proper0.012417
1-month-old human stage0.012417
edo state0.012417
jiangsu province0.012417
ovis aries0.012417
rhizosphere0.012417
larval stage0.011589
equus caballus0.011589
horse0.011589
duodenum0.011589
glycine max0.011589
coyote0.011589
canis latrans0.011589
edmonton0.011589
age 6 weeks0.011589
kellogg biological station0.011589
mesic type hapludalf0.011589
kalamazoo loam0.011589
age0.010762
urocyon littoralis catalinae0.010762
santa catalina island fox0.010762
santa catalina island0.010762
urocyon littoralis0.010762
rectal swab0.010762
thailand0.010762
nepal0.010762
mangrove swamp0.010762
kingdom of norway0.009934
Exp. ID User ID Description Date Region Flag Sequences
117amnonlower in sox10 mutant fish with high neutrophil count ( high in low neutrophils control compared to hirschsprung disease high neutrophils neutrophil in zebra fish danio rerio research facility larval stage united states of america intestine )2017-04-10v4No1 / 1
207amnonhigher in people hospitalized with diarrhea compared to healthy controls ( high in diarrhea compared to control in pathogen homo sapiens israel feces )2017-10-05v4No1 / 1
256amnonhigher in illeum compared to other gi tract locations in pigs ( high in ileum compared to duodenum jejunum caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 1
1010amnon high in abnormality of the intestine canine chronic enteropathy chronic enteropathy compared to control in feces dog canis lupus familiaris united states of america commonwealth of pennsylvania 2023-02-02v4No1 / 1
234amnoncandidate contaminant (high in blank) (contamination)2017-11-07v4No1 / 2
702amnondominant equus caballus, horse, state of north carolina, united states of america, feces2028-04-02v4No1 / 2
963amnon high in virginiamycin compared to control in chicken gallus gallus caecum research facility male organism broiler chicken united states of america state of indiana age 5 weeks 2022-12-21v4No1 / 2
16amnon high in diarrhea compared to control in felis catus state of california feces 2016-11-08v4No1 / 3
127amnonhigh in young (0-3 days) compared to old (28 day) chickens ( high in age young age compared to old age in gallus gallus chicken united states of america caecum )2017-04-14v4No1 / 3
399amnon high in crohn's disease compared to ulcerative colitis in feces united states of america homo sapiens 2018-11-16v4No1 / 3
456amnonreagent contaminant (high in blanks) in mouse nasopharynx study (contamination)2019-01-10v4No1 / 3
567amnon high in chronic rhinosinusitis sinusitis compared to control in homo sapiens adult belgium anterior naris pair of nares 2019-12-05v4No1 / 3
954amnonhigher in iron deficient diet in mice treated with antibiotics and salmonella ( high in iron deficient diet compared to iron supplemented diet in caecum united states of america state of florida female organism c57bl/6 research facility mus musculus mouse antibiotic streptomycin salmonella infections )2022-12-15v4No1 / 3
320amnonlower in CD patients with remission ( high in crohn's disease compared to remission in homo sapiens feces adult )2018-04-19v4No1 / 4
440amnoncommon galapagos islands, feces, bird, finch, geospiza fortis, medium ground finch2019-01-06v4No1 / 4
301amnon high in duodenum ileum compared to colon rectum in canis lupus familiaris dog united states of america 2018-03-05v4No1 / 5
108amnondominant state of texas, research facility, united states of america, colon, quail, coturnix coturnix2017-04-07v4No1 / 6
347amnondominant kingdom of norway, svalbard archipelago, permafrost, soil, depth 100-150cm2018-07-15v4No1 / 6
582amnondominant urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, urocyon littoralis, ear canal, external acoustic meatus2020-01-22v4No1 / 6
795amnoncommon uterine tube infundibulum, age 90 weeks, adult organism, research facility, china, gallus gallus, chicken2021-06-08v4No1 / 6
801sheryoDominant at depth 60-90cm in corn agriculture fields, Iowa USA (dominant depth (soil) 60-90cm, ph 8.3, kanawha, nicollet soil series, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 6
1010amnon high in antibiotic compared to no antimicrobial treatment in feces dog canis lupus familiaris united states of america commonwealth of pennsylvania abnormality of the intestine chronic enteropathy canine chronic enteropathy 2023-02-02v4No1 / 6
49amnonincreases during sample storage in giraffe feces (other giraffa camelopardalis, feces)2017-01-19v4No1 / 6
207amnoncommon in people hospitalized with diarrhea (common homo sapiens, israel, feces, diarrhea)2017-10-05v4No1 / 7
932amnoncommon odontomachus chelifer, sao paulo state, ant, gaster, brazil, stomach, tropical moist broadleaf forest biome2022-08-30v4No1 / 7
932amnondominant odontomachus chelifer, sao paulo state, ant, gaster, brazil, stomach, tropical moist broadleaf forest biome2022-08-30v4No1 / 7
891amnondominant urban slum, under-1-year-old human stage, infant stage, dhaka, bangladesh, infant, homo sapiens, feces2022-04-03v4No1 / 7
262amnondominant tick, ixodes scapularis, larval stage, body proper, research facility2017-12-10v4No1 / 8
332amnoncommon 2-month-old human stage, homo sapiens, infant, vellore district, city, india2018-05-14v4No1 / 8
406amnondominant feces, equus przewalskii, przewalski horse, zoological garden, united states of america2018-11-21v4No1 / 8
406amnondominant feces, zoological garden, french republic, connochaetes taurinus, blue wildebeest2018-11-21v4No1 / 8
406amnondominant feces, zoological garden, united states of america, myrmecophaga tridactyla, giant anteater2018-11-21v4No1 / 8
440amnoncommon galapagos islands, feces, bird, finch, geospiza difficilis, sharp-beaked ground finch2019-01-06v4No1 / 8
454amnondominant feces, elaphurus davidianus, pere deer, deer, wild, china2019-01-10v4No1 / 8
516amnoncommon homo sapiens, united states of america, state of ohio, adult, urine2019-05-29v4No1 / 8
801sheryoDominant in soybean and corn agriculture fields at depth 60-90cm, Iowa USA (dominant ph 7.7, depth (soil) 60-90cm, united states, nicollet soil series, glycine max, zea mays, ames, des moines, iowa, agricultural field, soil)2021-06-15v4No1 / 8
932amnoncommon stomach, gaster, atlantic rainforest, parque estadual serra do mar-núcleo picinguaba, odontomachus hastatus, sao paulo state, ant, brazil, tropical moist broadleaf forest biome2022-08-30v4No1 / 8
960amnoncommon 1-month-old human stage, feces, infant, edo state, nigeria, homo sapiens2022-12-20v4No1 / 8
960amnoncommon meconium, newborn human stage, infant, feces, edo state, nigeria, homo sapiens2022-12-20v4No1 / 8
56amnondominant nicotiana glauca, israel, flower, nectar2017-01-30v4No1 / 8
891amnoncommon under-1-year-old human stage, urban slum, infant stage, dhaka, bangladesh, infant, homo sapiens, feces2022-04-03v4No1 / 8
92amnoncommon air, japan2017-03-09v4No1 / 9
301amnondominant canis lupus familiaris, dog, united states of america, duodenum2018-03-05v4No1 / 9
332amnondominant 2-month-old human stage, homo sapiens, infant, vellore district, city, india2018-05-14v4No1 / 9
391amnoncommon under-1-year-old human stage, feces, infant, hospital, china, diarrhea2018-11-04v4No1 / 9
399amnondominant feces, united states of america, mustela putorius furo, ferret2018-11-16v4No1 / 9
423amnondominant bank vole, myodes glareolus, ukraine, skin2018-12-05v4No1 / 9
497amnondominant chicken, gallus gallus, broiler chicken, austria, farm, feces, age 2 weeks2019-03-04v4No1 / 9
932amnondominant atlantic rainforest, parque estadual serra do mar-núcleo picinguaba, odontomachus hastatus, sao paulo state, cuticle, chitin-based cuticle, ant, brazil, tropical moist broadleaf forest biome2022-08-30v4No1 / 9
10amnon high in female compared to male in homo sapiens feces toronto 2016-10-27v4No1 / 10
117amnondominant zebra fish, danio rerio, research facility, larval stage, united states of america, intestine2017-04-10v4No1 / 10
177amnonblooming bacteria (grows in storage at room temp.) (contamination)2017-07-30v4No1 / 10
234amnoncommon homo sapiens, lung, united states of america2017-11-07v4No1 / 10
256amnondominant sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 10
408amnoncommon ant, costa rica, united states of america, pseudomyrmex elongatus, stomach2018-11-22v4No1 / 10
497amnondominant chicken, gallus gallus, broiler chicken, austria, farm, feces, age 4 weeks2019-03-04v4No1 / 10
530amnondominant snake, feces, snake farm, farm, adula, hunan province, elaphe carinata, king ratsnake, china2019-07-21v4No1 / 10
544amnondominant vaccinium macrocarpon, american cranberry, united states of america, commonwealth of massachusetts, botanical fruit food product2019-08-04v4No1 / 10
859amnoncommon formula fed, 1-month-old human stage, hispanic, los angeles district, hispanic or latin american, state of california, infant, homo sapiens, feces2022-01-12v4No1 / 10
932amnondominant odontomachus chelifer, sao paulo state, cuticle, chitin-based cuticle, ant, brazil, tropical moist broadleaf forest biome2022-08-30v4No1 / 10
977amnondominant cheese food product, canastra cheese, minas gerais state, brazil, time 22 days2022-12-24v4No1 / 10
977amnondominant minas gerais state, brazil, cheese curd, canastra cheese2022-12-24v4No1 / 10
71amnondominant liolaemus ruibali, small intestine, argentina, research facility2017-02-25v4No1 / 10
78amnondominant nanger granti, kenya, feces, tropical grassland biome, gazelle2017-03-01v4No1 / 10
152amnonhigh in blanks compares to dust/nose samples (contamination)2017-05-04v4No1 / 10
206amnonhigh freq. in air from israel particles <10um size (dominant air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 11
371amnondominant feces, homo sapiens, hunter gatherer, amerindian, venezuela2018-09-06v4No1 / 11
391amnondominant under-1-year-old human stage, feces, infant, hospital, china, diarrhea2018-11-04v4No1 / 11
406amnondominant feces, zoological garden, french republic, antidorcas marsupialis, springbok2018-11-21v4No1 / 11
418amnondominant coral, ocean, pocillopora damicornis, mucus2018-12-02v4No1 / 11
513amnondominant waste water, hospital, city, xinxiang city prefecture, china2019-03-25v4No1 / 11
558amnondominant bird, centrocercus urophasianus, greater sage-grouse, united states of america, state of wyoming, crop2019-09-20v4No1 / 11
644amnonhigher in older adults (total age range 20-80) ( high in age old age compared to young age in adult united states of america hispanic or latin american feces homo sapiens )2020-08-31v4No1 / 11
879amnondominant adult organism, chest, captive, dog, austria, canis lupus familiaris, skin, research facility2022-03-12v4No1 / 11
898amnondominant coyote, canis latrans, edmonton, adult organism, anatomical space, wild, canada, male, jejunum2022-04-19v4No1 / 11
932amnondominant atlantic rainforest, parque estadual serra do mar-núcleo picinguaba, odontomachus hastatus, sao paulo state, ant, gaster, brazil, stomach, tropical moist broadleaf forest biome2022-08-30v4No1 / 11
977amnondominant in raw milk used for cheese production (dominant minas gerais state, brazil, milk, raw milk)2022-12-24v4No1 / 11
89amnondominant junco hyemalis, commonwealth of virginia, songbird, cloaca2017-03-08v4No1 / 12
161amnonhigh freq. in barn swallows in colorado (dominant state of colorado, hirundo rustica, feces, united states of america, barn swallow)2017-07-12v4No1 / 12
206amnonhigh freq. in dust storm air from israel particles <10um size (dominant israel, air, size < 10um, dust, dust storm)2017-10-04v4No1 / 12
231amnonhigh freq. in dog genitalia (dominant dog, canis lupus familiaris, united states of america, reproductive system, reproductive organ, genitalia)2017-11-02v4No1 / 12
301amnondominant canis lupus familiaris, dog, united states of america, ileum2018-03-05v4No1 / 12
381amnoncommon bird, isla de salvora, kingdom of spain, age 8 days, feces, larus michahellis, gull2018-10-22v4No1 / 12
408amnondominant ant, cephalotes, costa rica, united states of america, larval stage2018-11-22v4No1 / 12
440amnondominant galapagos islands, feces, bird, finch, geospiza difficilis, sharp-beaked ground finch2019-01-06v4No1 / 12
495amnondominant gallus gallus, chicken, caecum, broiler chicken, age 3 days, kingdom of spain, farm2019-03-03v4No1 / 12
582amnondominant urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, external ear, urocyon littoralis2020-01-22v4No1 / 12
595amnondominant ixodes ricinus, castor bean tick, whole body, switzerland2020-03-16v4No1 / 12
645amnondominant feces, state of idaho, captive, california condor, gymnogyps californianus, bird2020-09-03v4No1 / 12
669amnoncommon 2-month-old human stage, sweden, infant, feces, homo sapiens2020-09-26v4No1 / 12
689amnoncommon non c. diff diarrhea, hospital, adult, tucson, united states of america, feces, homo sapiens2028-03-11v4No1 / 12
766amnoncommon puppy, age 2 days, french republic, rectal swab, feces, canis lupus familiaris, dog2021-04-12v4No1 / 12
879amnondominant wolf, canis lupus, adult organism, chest, captive, austria, skin, research facility2022-03-12v4No1 / 12
898amnoncommon duodenum, coyote, canis latrans, edmonton, adult organism, anatomical space, wild, canada, male2022-04-19v4No1 / 12
898amnondominant coyote, canis latrans, edmonton, adult organism, anatomical space, wild, canada, male, duodenum2022-04-19v4No1 / 12
906amnon high in female organism compared to male organism in grey squirrel sciurus carolinensis province of ontario canada feces 2022-05-19v4No1 / 12
932amnoncommon cuticle, chitin-based cuticle, odontomachus chelifer, sao paulo state, ant, brazil, tropical moist broadleaf forest biome2022-08-30v4No1 / 12
941amnondominant homo sapiens, feces, thailand, farm, adult, nan province, village, rural community, chicken farm2022-11-25v4No1 / 12
71amnondominant liolaemus ruibali, argentina, research facility, stomach2017-02-25v4No1 / 12
210amnonhigher in bangladeshi diet compared to american diet in mice with american human FMT ( high in bangladesh diet diet compared to american diet in feces research facility mus musculus mouse humanized mouse )2017-10-21v4No1 / 13
241amnonhigher in babies age <1 year compared to age 1-3 years ( high in under-1-year-old human stage age compared to 2-year-old human stage 1-year-old human stage age 1-3 years in homo sapiens feces infant )2017-11-13v4No1 / 13
243amnondominant beetle, anoplophora glabripennis, digestive system, united states of america2017-11-15v4No1 / 13
389amnondominant pig, sus scrofa, vagina, united states of america, state of michigan, farm2018-11-04v4No1 / 13
405amnondominant mouse, mus musculus, research facility, feces, united states of america, swiss webster, ketogenic diet2018-11-20v4No1 / 13
515amnondominant whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, onthophagus similis2019-04-18v4No1 / 13
516amnondominant homo sapiens, united states of america, state of ohio, adult, urine2019-05-29v4No1 / 13
530amnondominant snake, feces, snake farm, farm, adula, hunan province, naja atra, chinese cobra, china2019-07-21v4No1 / 13
534amnondominant river, water, fresh water, depth (water) 10cm, koshi river, tributary, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 13
620amnondominant village, rural community, homo sapiens, nouabale-ndoki national park, republic of congo, feces2020-05-06v4No1 / 13
644amnondominant adult, united states of america, hispanic or latin american, feces, homo sapiens2020-08-31v4No1 / 13
669amnondominant 2-month-old human stage, sweden, infant, feces, homo sapiens2020-09-26v4No1 / 13
673amnondominant salmonellosis, salmonella enterica subsp. enterica serovar typhimurium, ileum, research facility, age 6 weeks, male, male organism, province of alberta, canada, pig, sus scrofa2020-09-28v4No1 / 13
785amnondominant state of iowa, ileum, research facility, age 9 weeks, sus scrofa, pig2021-05-16v4No1 / 13
795amnoncommon vagina, age 90 weeks, adult organism, research facility, china, gallus gallus, chicken2021-06-08v4No1 / 13
859amnoncommon breast fed, 1-month-old human stage, hispanic, los angeles district, hispanic or latin american, state of california, infant, homo sapiens, feces2022-01-12v4No1 / 13
859amnoncommon breast fed, 6-month-old human stage, hispanic, los angeles district, hispanic or latin american, state of california, infant, homo sapiens, feces2022-01-12v4No1 / 13
868amnon high in iga positive fraction compared to iga negative fraction in clostridium difficile colitis clostridium difficile infection human adult stage adult province of alberta canada homo sapiens feces 2022-02-12v4No1 / 13
48amnondominant homo sapiens, kingdom of denmark, infant, hypopharynx2017-01-19v4No1 / 13
954amnondominant caecum, united states of america, state of florida, female organism, c57bl/6, research facility, mus musculus, mouse, antibiotic, streptomycin2022-12-15v4No1 / 13
129amnonfound INSIDE leaves of cactus (common mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, leaf, leaf interior)2017-04-15v4No1 / 14
185amnoncommon in patients with c. diff infection before treatment (common homo sapiens, feces, united states of america, state of minnesota, clostridium difficile intestinal infectious disease)2017-08-20v4No1 / 14
190amnondominant homo sapiens, tanzania, hadza, hunter gatherer, feces2017-09-04v4No1 / 14
232amnoncommon in foot ulcer of diabetic patients (common homo sapiens, skin, australia, foot, wound, ulcer, diabetes mellitus)2017-11-05v4No1 / 14
290amnon high in city compared to rural community small village in homo sapiens feces adult china 2018-02-01v4No1 / 14
302amnonhigh freq. in feces of Cockatiel pet birds (dominant bird, mexico, feces, pet, nymphicus hollandicus, cockatiel)2018-03-05v4No1 / 14
389amnondominant pig, sus scrofa, united states of america, state of michigan, farm, tonsil, age 8 hours2018-11-04v4No1 / 14
400amnonhigh freq. in karen (burma) females from thailand (dominant homo sapiens, feces, adult, female, thailand, karen, myanmar)2018-11-18v4No1 / 14
404amnon high in high bmi obesity compared to lean body mass low bmi in homo sapiens feces adult colombia city 2018-11-20v4No1 / 14
406amnondominant feces, zoological garden, united states of america, giraffa camelopardalis, giraffe2018-11-21v4No1 / 14
438amnondominant tenth decade human stage, ninth decade human stage, feces, homo sapiens, age >94, adult, jiangsu province, china2018-12-30v4No1 / 14
477amnondominant homo sapiens, feces, adult, nepal, himalayas, rural community, tharu, agrarian2019-01-28v4No1 / 14
499amnondominant ranatra, water stick-insect, brazil, pond, digestive system, intestine2019-03-05v4No1 / 14
515amnondominant whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, onthophagus ruficapillus2019-04-18v4No1 / 14
530amnondominant snake, feces, snake farm, farm, adula, hunan province, ptyas mucosa, oriental ratsnake, china2019-07-21v4No1 / 14
622amnondominant caecum, age 42 days, research facility, liverpool, great britain, chicken, gallus gallus2020-05-08v4No1 / 14
648amnon high in antibiotic metronidazole compared to control in united states of america dog canis lupus familiaris feces state of louisiana 2020-09-06v4No1 / 14
673amnondominant control, ileum, research facility, age 6 weeks, male, male organism, province of alberta, canada, pig, sus scrofa2020-09-28v4No1 / 14
759amnondominant state of alabama, united states of america, feces, wild, wild boar, sus scrofa2021-04-04v4No1 / 14
781amnondominant giraffe, giraffa tippelskirchi, masai mara national park, kenya, wild, feces2021-04-28v4No1 / 14
862amnondominant himalayan griffon, gyps himalayensis, china, qinghai province, bird, feces2022-01-20v4No1 / 14
876amnondominant neonate, monkey, age 1 week, state of washington, macaca mulatta, research facility, united states of america, feces2022-03-06v4No1 / 14
960amnondominant homo sapiens, nigeria, edo state, feces, infant, newborn human stage, meconium2022-12-20v4No1 / 14
850amnondominant in vitro fertilization clinic, anambra state, female organism, nigeria, adult, vagina, homo sapiens2021-12-16v4No1 / 14
891amnondominant urban slum, 1-year-old human stage, infant stage, dhaka, bangladesh, infant, homo sapiens, feces2022-04-03v4No1 / 14
42amnonhigher on stressed mice compared to control in c57bl tcr-b deficient mice ( high in stress compared to control in c57bl/6 mus musculus research facility feces japan )2016-12-10v4No1 / 15
159amnondominant siganidae, rabbitfish, hindgut, australia2017-07-06v4No1 / 15
228amnonhigh freq. in sinus brush of sinusitis patients (dominant homo sapiens, mucosa, sinusoidal space, paranasal sinus, united states of america, sinusitis)2017-10-31v4No1 / 15
339amnondominant under-1-year-old human stage, homo sapiens, feces, infant, india2018-05-24v4No1 / 15
405amnondominant mouse, mus musculus, research facility, feces, united states of america, swiss webster, control diet2018-11-20v4No1 / 15
409amnondominant homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 15
425amnondominant homo sapiens, feces, africa, child, central african republic, bangui2018-12-08v4No1 / 15
425amnondominant homo sapiens, feces, africa, child, madagascar, antananarivo2018-12-08v4No1 / 15
502amnondominant homo sapiens, feces, adult, united states of america, schizophrenia2019-03-12v4No1 / 15
586amnoncommon rattus norvegicus, rat, sprague dawley, research facility, male, israel, feces, antibiotic, ampicillin, neomycin2020-02-09v4No1 / 15
651amnondominant control, state of alabama, united states of america, adult, feces, homo sapiens2020-09-13v4No1 / 15
651amnondominant parkinson's disease, state of alabama, united states of america, adult, feces, homo sapiens2020-09-13v4No1 / 15
673amnoncommon salmonellosis, salmonella enterica subsp. enterica serovar typhimurium, ileum, research facility, age 6 weeks, male, male organism, province of alberta, canada, pig, sus scrofa2020-09-28v4No1 / 15
702amnoncommon canis lupus familiaris, dog, state of north carolina, united states of america, feces2028-04-02v4No1 / 15
898amnoncommon jejunum, coyote, canis latrans, edmonton, adult organism, anatomical space, wild, canada, male2022-04-19v4No1 / 15
960amnondominant homo sapiens, nigeria, edo state, infant, feces, 1-month-old human stage2022-12-20v4No1 / 15
48amnoncommon homo sapiens, kingdom of denmark, infant, hypopharynx2017-01-19v4No1 / 15
51amnondominant feces, homo sapiens, united states of america2017-01-19v4No1 / 15
850amnondominant in vitro fertilization clinic, anambra state, sperm, semen, male organism, nigeria, adult, homo sapiens2021-12-16v4No1 / 15
15amnondominant namibia, feces, canis mesomelas2016-11-08v4No1 / 16
19amnonhigh freq in biopsies of children (IBD study) (dominant rectum, terminal ileum, sigmoid colon, caecum, colon, biopsy, children, homo sapiens, united states of america)2016-11-14v4No1 / 16
46amnonsmj: higher in female mice feces treated with antibiotics ( high in antibiotic pulsed antibiotic treatment, macrolide tylosin tartrate compared to control in feces mus musculoides united states of america nyulmc nod/shiltj (no. 001976, jackson labs) research facility female )2017-01-12v4No1 / 16
94amnoncommon homo sapiens, clostridium difficile intestinal infectious disease, feces, state of michigan, diarrhea2017-03-12v4No1 / 16
150amnonlow in healthy dogs compared to EPI dogs recieving enzyme supplementation ( high in enzyme supplementation exocrine pancreatic insufficiency compared to control in canis lupus familiaris dog feces united states of america )2017-04-26v4No1 / 16
229amnonhigh freq. in sinuses from chronic rhinosinositis patients (dominant homo sapiens, paranasal sinus, sinusoidal space, australia, sinusitis)2017-10-31v4No1 / 16
273amnoncommon 1-month-old human stage, feces, homo sapiens, kingdom of denmark, infant2018-01-14v4No1 / 16
310amnondominant homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 16
352amnondominant homo sapiens, feces, new delhi, india2018-07-30v4No1 / 16
363amnondominant ovis aries, age 30 days, obsolete_juvenile stage, italy, dairy, caecum, colon, rectum2018-08-29v4No1 / 16
365amnondominant homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 16
395amnonhigher in kids with ibd compared to healthy donors ( high in child ulcerative colitis inflammatory bowel disease crohn's disease compared to control in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 16
407amnondominant costa rica, feces, monkey, cebus capucinus, white-faced capuchin, wild2018-11-21v4No1 / 16
440amnondominant galapagos islands, feces, bird, finch, geospiza fortis, medium ground finch2019-01-06v4No1 / 16
448amnondominant equus caballus, horse, feces, farm, equine grass sickness, disease, united kingdom2019-01-08v4No1 / 16
567amnondominant belgium, adult, homo sapiens, nasopharynx2019-12-05v4No1 / 16
582amnondominant urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, urocyon littoralis, axilla2020-01-22v4No1 / 16
586amnondominant rattus norvegicus, rat, sprague dawley, research facility, male, israel, feces, antibiotic, ampicillin, neomycin2020-02-09v4No1 / 16
645amnondominant cloaca, state of idaho, captive, california condor, gymnogyps californianus, bird2020-09-03v4No1 / 16
659amnondominant ulcerative colitis, acute severe colitis, homo sapiens, child, feces2020-09-19v4No1 / 16
683amnondominant during antibiotics treatment in feces (dominant metronidazole, vancomycin, neomycin, antibiotic, state of california, united states of america, adult, feces, homo sapiens)2028-03-04v4No1 / 16
932amnoncommon chitin-based cuticle, cuticle, atlantic rainforest, parque estadual serra do mar-núcleo picinguaba, odontomachus hastatus, sao paulo state, ant, brazil, tropical moist broadleaf forest biome2022-08-30v4No1 / 16
941amnondominant homo sapiens, feces, thailand, farm, pig farm, adult, nan province, village, rural community2022-11-25v4No1 / 16
49amnondominant giraffa camelopardalis, feces2017-01-19v4No1 / 16
159amnondominant siganidae, rabbitfish, australia, midgut2017-07-06v4No1 / 17
215amnonhigher in people with Roux-en-Y gastric bypass compared to controls ( high in gastric bypass compared to control in homo sapiens feces united states of america )2017-10-23v4No1 / 17
227amnonhigh freq. in baby nasopharynx age <= 1 day (dominant 1-month-old human stage, homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, age <= 24 hours)2017-10-30v4No1 / 17
237amnondominant bird, oceanodroma leucorhoa, seabird, canada, bon portage island, uropygial gland2017-11-07v4No1 / 17
337amnonhigh freq. in feces of house mice from new york city (dominant mus musculus, house mice, mouse, new york city, united states of america, city)2018-05-18v4No1 / 17
352amnonhigh freq. in duodenal biopsies (dominant homo sapiens, new delhi, duodenum, small intestine, india)2018-07-30v4No1 / 17
365amnondominant homo sapiens, feces, child, obsolete_juvenile stage, nigeria2018-08-30v4No1 / 17
368amnondominant feces, homo sapiens, commonwealth of virginia, united states of america, adult, systemic lupus erythematosus2018-09-03v4No1 / 17
381amnondominant bird, isla de salvora, kingdom of spain, age 8 days, feces, larus michahellis, gull2018-10-22v4No1 / 17
389amnondominant pig, sus scrofa, united states of america, state of michigan, farm, skin, nipple, adult2018-11-04v4No1 / 17
406amnondominant feces, zoological garden, south africa, aardvark, orycteropus afer2018-11-21v4No1 / 17
428amnondominant homo sapiens, adult, feces, nanchang city prefecture, pancreatitis, acute pancreatitis, china2018-12-09v4No1 / 17
591amnondominant human late adulthood stage, homo sapiens, feces, adult, united states of america, control2020-02-17v4No1 / 17
607amnondominant germany, homo sapiens, feces, control2020-04-19v4No1 / 17
661amnondominant lung, farm, maojian district, age 3 years, china, chinese giant salamander, andrias davidianus2020-09-20v4No1 / 17
674amnondominant mosquito, culex coronator, whole body, body proper, female, panama2020-09-28v4No1 / 17
674amnondominant mosquito, coquillettidia, coquilettidia venezuelensis, whole body, body proper, female, panama2020-09-28v4No1 / 17
759amnondominant state of new york, new york city, wild, feces, united states of america, rattus norvegicus, rat2021-04-06v4No1 / 17
859amnondominant 1-month-old human stage, hispanic, los angeles district, hispanic or latin american, breast fed, state of california, infant, homo sapiens, feces2022-01-12v4No1 / 17
859amnondominant 6-month-old human stage, hispanic, los angeles district, hispanic or latin american, breast fed, state of california, infant, homo sapiens, feces2022-01-12v4No1 / 17
898amnondominant coyote, canis latrans, edmonton, adult organism, ascending colon, anatomical space, wild, canada, male2022-04-19v4No1 / 17
941amnondominant homo sapiens, feces, thailand, adult, nan province, village, rural community2022-11-25v4No1 / 17
960amnondominant homo sapiens, nigeria, edo state, feces, female, adult2022-12-20v4No1 / 17
36amnondominant homo sapiens, feces, sichuan province2016-12-06v4No1 / 18
207amnonhigh freq. in people hospitalized with diarrhea (dominant homo sapiens, israel, feces, diarrhea)2017-10-05v4No1 / 18
215amnondominant homo sapiens, feces, united states of america2017-10-23v4No1 / 18
273amnondominant 1-month-old human stage, feces, homo sapiens, kingdom of denmark, infant2018-01-14v4No1 / 18
284amnondominant 6-month-old human stage, homo sapiens, female, feces, state of california, infant2018-01-27v4No1 / 18
339amnondominant homo sapiens, feces, adult, india2018-05-24v4No1 / 18
387amnonhigh freq. in feces of wild brown bear (dominant ursus arctos, brown bear, feces, sweden, wild)2018-11-03v4No1 / 18
440amnondominant galapagos islands, feces, bird, finch, geospiza fuliginosa, small ground finch2019-01-06v4No1 / 18
477amnondominant homo sapiens, feces, adult, nepal, himalayas, rural community, forager, chepang2019-01-28v4No1 / 18
488amnondominant canis lupus familiaris, dog, feces, italy, lymphoma2019-02-25v4No1 / 18
563amnondominant homo sapiens, feces, rectal swab, united states of america, male, msm, homosexual, control2019-11-18v4No1 / 18
567amnon high in chronic rhinosinusitis sinusitis compared to control in homo sapiens adult belgium nasopharynx 2019-12-05v4No1 / 18
582amnondominant urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, urocyon littoralis, lip, labial commissure2020-01-22v4No1 / 18
607amnondominant germany, homo sapiens, feces, parkinson's disease2020-04-19v4No1 / 18
607amnondominant germany, homo sapiens, nasopharynx, nasal wash, rem sleep behavior disorder2020-04-19v4No1 / 18
636amnon high in tracheal aspirate endotracheal aspirate trachea compared to oropharynx oropharyngeal swab in hospital commonwealth of pennsylvania united states of america respiratory failure acute respiratory failure adult homo sapiens 2020-08-08v4No1 / 18
650amnondominant asian, state of new york, united states of america, homo sapiens, adult, feces2020-09-09v4No1 / 18
663amnondominant poland, obese body mass index status, obesity, adult, feces, homo sapiens2020-09-22v4No1 / 18
795amnondominant cloaca, age 90 weeks, adult organism, research facility, china, gallus gallus, chicken2021-06-08v4No1 / 18
898amnondominant coyote, canis latrans, edmonton, adult organism, wild, canada, male, feces2022-04-19v4No1 / 18
898amnondominant coyote, canis latrans, edmonton, adult organism, descending colon, anatomical space, wild, canada, male2022-04-19v4No1 / 18
898amnondominant coyote, canis latrans, edmonton, adult organism, anatomical space, wild, canada, male, ileum2022-04-19v4No1 / 18
1006amnondominant feces, monkey, captive, united states of america, state of maryland, research facility, bethesda, chlorocebus sabaeus, sabaeus monkey2023-01-08v4No1 / 18
121amnondominant homo sapiens, feces, bangladesh, adult2017-04-13v4No1 / 19
276amnondominant feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 19
292amnondominant homo sapiens, adult, feces, control, china2018-02-05v4No1 / 19
301amnondominant canis lupus familiaris, dog, united states of america, colon2018-03-05v4No1 / 19
330amnon high in infant age 1 year compared to fourth decade human stage adult in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 19
339amnoncommon under-1-year-old human stage, homo sapiens, feces, infant, india2018-05-24v4No1 / 19
404amnondominant homo sapiens, feces, colombia, city, adult2018-11-20v4No1 / 19
438amnondominant young adult stage, homo sapiens, feces, china2018-12-30v4No1 / 19
438amnondominant 65-79 year-old human stage, feces, homo sapiens, adult, jiangsu province, china2018-12-30v4No1 / 19
449amnondominant homo sapiens, feces, colombia2019-01-09v4No1 / 19
455amnondominant homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 19
477amnondominant homo sapiens, feces, himalayas, nepal, rural community, raute2019-01-29v4No1 / 19
482amnondominant homo sapiens, feces, colombia, medellin metropolitan area, child, daycare, 1-5-years-old human2019-02-12v4No1 / 19
489amnondominant feces, anal swab, myotis myotis, bat, greater mouse eared bat, french republic2019-02-25v4No1 / 19
495amnondominant gallus gallus, chicken, caecum, broiler chicken, kingdom of spain, farm, age 4 weeks2019-03-03v4No1 / 19
516amnondominant homo sapiens, feces, united states of america, state of ohio, adult2019-05-29v4No1 / 19
558amnondominant bird, centrocercus urophasianus, greater sage-grouse, united states of america, state of wyoming, colon2019-09-20v4No1 / 19
567amnondominant belgium, adult, homo sapiens, maxillary sinus, ethmoid sinus2019-12-05v4No1 / 19
573amnondominant feces, canis lupus familiaris, dog, united states of america, commonwealth of pennsylvania, juvenile stage2019-12-22v4No1 / 19
582amnondominant urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, urocyon littoralis, external naris, pair of nares2020-01-22v4No1 / 19
582amnondominant urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, urocyon littoralis, perianal skin, rectum2020-01-22v4No1 / 19
689amnoncommon clostridium difficile infection, clostridium difficile colitis, hospital, adult, tucson, united states of america, feces, homo sapiens2028-03-11v4No1 / 19
706amnondominant state of north carolina, united states of america, feces, canis lupus familiaris, dog2028-04-10v4No1 / 19
795amnoncommon cloaca, age 90 weeks, adult organism, research facility, china, gallus gallus, chicken2021-06-08v4No1 / 19
803amnondominant human late adulthood stage, type 2 diabetes mellitus, commonwealth of massachusetts, caribbean latino, adult, united states of america, feces, homo sapiens2021-06-18v4No1 / 19
866amnon high in crohn's disease crohn's disease compared to control in human adult stage adult united states of america homo sapiens feces 2022-02-08v4No1 / 19
898amnondominant coyote, canis latrans, edmonton, adult organism, anatomical space, wild, canada, male, caecum2022-04-19v4No1 / 19
963amnondominant chicken, gallus gallus, caecum, research facility, male organism, broiler chicken, united states of america, state of indiana, age 1 week2022-12-20v4No1 / 19
963amnondominant chicken, gallus gallus, caecum, research facility, male organism, broiler chicken, united states of america, state of indiana, age 5 weeks2022-12-21v4No1 / 19
972amnondominant homo sapiens, feces, united states of america, state of california, adult2022-12-24v4No1 / 19
59amnoncommon geniotrigona thoracica, digestive system2017-02-03v4No1 / 19
60amnondominant anser cygnoides, feces, china2017-02-03v4No1 / 19
954amnoncommon streptomycin, antibiotic, mouse, mus musculus, research facility, c57bl/6, female organism, state of florida, united states of america, caecum2022-12-15v4No1 / 19
45amnonhigh freq. in feces babies <2 years in india (dominant homo sapiens, feces, infant, india)2016-12-19v4No1 / 20
197amnondominant 13-year-old human stage, feces, homo sapiens, obsolete_juvenile stage, juvenile organism, finland2017-09-12v4No1 / 20
227amnoncommon in baby nasopharynx age <= 1 day (common 1-month-old human stage, homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, age <= 24 hours)2017-10-30v4No1 / 20
238amnondominant homo sapiens, feces, colombia2017-11-07v4No1 / 20
271amnoncommon depth (soil) 0-20cm, glycine max, soybean, root structure, root, root nodule, china2018-01-09v4No1 / 20
273amnoncommon 1-month-old human stage, feces, homo sapiens, kingdom of denmark, infant, age one week2018-01-14v4No1 / 20
273amnondominant 1-month-old human stage, feces, homo sapiens, kingdom of denmark, infant, age one week2018-01-14v4No1 / 20
273amnondominant 1-year-old human stage, feces, homo sapiens, kingdom of denmark, infant2018-01-14v4No1 / 20
284amnoncommon homo sapiens, female, feces, state of california, infant, age 2 months2018-01-27v4No1 / 20
284amnondominant homo sapiens, female, feces, state of california, infant, age 2 months2018-01-27v4No1 / 20
286amnonhigh freq. in feces of individuals with kidney stones (dominant sixth decade human stage, homo sapiens, feces, adult, nanning city prefecture, nephrolithiasis, china)2018-01-27v4No1 / 20
292amnondominant homo sapiens, adult, feces, ulcerative colitis, china2018-02-05v4No1 / 20
292amnondominant homo sapiens, adult, feces, crohn's disease, china2018-02-05v4No1 / 20
390amnondominant homo sapiens, feces, australia, hospital, salmonella gastroenteritis, diarrhea2018-11-04v4No1 / 20
390amnondominant homo sapiens, feces, australia, hospital, diarrhea2018-11-04v4No1 / 20
394amnondominant homo sapiens, feces, adult, united states of america, state of california, ulcerative colitis2018-11-06v4No1 / 20
399amnoncommon feces, united states of america, mustela putorius furo, ferret2018-11-16v4No1 / 20
409amnondominant homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v4No1 / 20
477amnondominant homo sapiens, feces, himalayas, nepal, rural community, raji2019-01-29v4No1 / 20
495amnondominant gallus gallus, chicken, caecum, kingdom of spain, farm, free range chicken, age 4 days2019-03-03v4No1 / 20
535amnonhigh freq. in adult vaginal samples with ICC (dominant homo sapiens, vagina, female, adult, united states of america, phoenix, state of arizona, invasive carcinoma, invasive cervical carcinoma, cervical carcinoma)2019-07-25v4No1 / 20
563amnondominant homo sapiens, feces, rectal swab, united states of america, male, msm, homosexual, hiv infection2019-11-18v4No1 / 20
629amnondominant amsterdam, kingdom of the netherlands, adult, homosexual, msm, feces, homo sapiens2020-05-31v4No1 / 20
629amnondominant msw, heterosexual, amsterdam, kingdom of the netherlands, adult, feces, homo sapiens2020-05-31v4No1 / 20
766amnondominant puppy, age 2 days, french republic, rectal swab, feces, canis lupus familiaris, dog2021-04-12v4No1 / 20
803amnondominant human late adulthood stage, control, commonwealth of massachusetts, caribbean latino, adult, united states of america, feces, homo sapiens2021-06-18v4No1 / 20
879amnondominant wolf, canis lupus, adult organism, captive, austria, research facility, feces2022-03-12v4No1 / 20
958amnondominant feces, homo sapiens, adult, united states of america, state of texas, mexican american, mexico2022-12-19v4No1 / 20
59amnoncommon sundatrigona moorei, digestive system2017-02-03v4No1 / 20
333amnonhigh freq. in healthy controls feces (dominant homo sapiens, feces, guangzhou city prefecture, adult, control, china)2018-05-15v4No1 / 20
15amnondominant acinonyx jubatus, namibia, feces2016-11-08v4No1 / 21
24amnonappears on transition to cow milk ( high in mammalian milk beverage compared to breast milk in homo sapiens feces infant )2016-12-01v4No1 / 21
108amnondominant state of texas, research facility, united states of america, caecum, mus musculus, mouse2017-04-07v4No1 / 21
108amnondominant quail, state of texas, research facility, united states of america, caecum, coturnix coturnix2017-04-07v4No1 / 21
122amnondominant homo sapiens, feces, united kingdom2017-04-13v4No1 / 21
240amnonhigh freq. in infants age <3 years (dominant homo sapiens, feces, finland, infant, age < 3 years)2017-11-12v4No1 / 21
241amnonhigh freq. in babies age < 3 years in finland (dominant homo sapiens, feces, infant, age < 3 years, finland)2017-11-13v4No1 / 21
249amnondominant homo sapiens, feces, united states of america2017-11-22v4No1 / 21
320amnondominant homo sapiens, feces, adult, crohn's disease2018-04-19v4No1 / 21
350amnonhigh freq. in feces of white faced capuchin from costa rica rain forest (dominant monkey, cebus capucinus, feces, costa rica, white-faced capuchin, woodland area)2018-07-30v4No1 / 21
390amnondominant homo sapiens, feces, clostridium difficile intestinal infectious disease, australia, hospital, diarrhea2018-11-04v4No1 / 21
429amnondominant rat, rattus norvegicus, dahl salt-sensitive, feces, israel, research facility, salt rich diet, salt2018-12-13v4No1 / 21
497amnoncommon chicken, gallus gallus, broiler chicken, austria, farm, feces, age 4 weeks2019-03-04v4No1 / 21
591amnondominant human late adulthood stage, homo sapiens, feces, adult, united states of america, parkinson's disease2020-02-17v4No1 / 21
642amnon high in gastrointestinal system alimentary part of gastrointestinal system compared to feces digesta in fish chub mackerel scomber japonicus san diego pacific ocean 2020-08-28v4No1 / 21
779amnondominant crohn's disease, feces, china, adult, homo sapiens, guangzhou city prefecture2021-04-28v4No1 / 21
794amnondominant antiretroviral therapy, human immunodeficiency virus infectious disease, hiv infection, municipality of logrono, kingdom of spain, adult, homo sapiens, feces2021-06-08v4No1 / 21
814amnondominant high bmi, age 50-70 years, adult, obese body mass index status, overweight body mass index status, obesity, female, germany, homo sapiens, feces2021-06-30v4No1 / 21
859amnoncommon formula fed, 6-month-old human stage, hispanic, los angeles district, hispanic or latin american, state of california, infant, homo sapiens, feces2022-01-12v4No1 / 21
879amnondominant adult organism, captive, dog, austria, canis lupus familiaris, research facility, feces2022-03-12v4No1 / 21
911amnondominant human adult stage, china, nanjing city prefecture, control, homo sapiens, feces2022-05-21v4No1 / 21
961amnondominant feces, homo sapiens, child, kingdom of denmark, zealand, 6-year-old human stage2022-12-20v4No1 / 21
47amnonsmj: higher in bullied, non-immunized mouse ( high in stress: chronic subordinate colony housing compared to no stress: single housed control in c57bc/6ncrl feces united states of america mus musculus male research facility no immunization: vehicle as control )2017-01-13v4No1 / 21
58amnoncommon homo sapiens, new york city, skin of face, skin under eyes2017-02-02v4No1 / 21
72amnondominant canis lupus familiaris, feces, united states of america, iowa2017-02-25v4No1 / 21
94amnondominant homo sapiens, clostridium difficile intestinal infectious disease, feces, state of michigan, diarrhea2017-03-12v4No1 / 22
185amnonhigh freq. in patients with c. diff infection before treatment (dominant homo sapiens, feces, united states of america, state of minnesota, clostridium difficile intestinal infectious disease)2017-08-20v4No1 / 22
284amnondominant homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 22
297amnondominant adolescent stage, immature stage, homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 22
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, tonsil, age 8 hours2018-11-04v4No1 / 22
395amnondominant homo sapiens, feces, united states of america, commonwealth of pennsylvania, child, inflammatory bowel disease, crohn's disease, ulcerative colitis2018-11-14v4No1 / 22
399amnoncommon feces, united states of america, zoological garden, state of tennessee, ailurus fulgens, red panda2018-11-16v4No1 / 22
502amnondominant homo sapiens, feces, adult, united states of america, control2019-03-12v4No1 / 22
509amnondominant 10-15-years-old human, feces, homo sapiens, nigeria, kebbi state, rural community, child, control2019-03-18v4No1 / 22
670amnon high in adult adult organism compared to larval stage in dolphin parasite croatia opatija anisakis pegreffii 2020-09-26v4No1 / 22
674amnondominant sand fly, lutzomyia gomezi, whole body, body proper, female, panama2020-09-28v4No1 / 22
674amnondominant psychodopygus panamensis, sand fly, whole body, body proper, female, panama2020-09-28v4No1 / 22
689amnondominant clostridium difficile infection, clostridium difficile colitis, hospital, adult, tucson, united states of america, feces, homo sapiens2028-03-11v4No1 / 22
759amnondominant state of minnesota, domestic, dog, canis lupus familiaris, united states of america, feces2021-04-04v4No1 / 22
779amnoncommon crohn's disease, feces, china, adult, homo sapiens, guangzhou city prefecture2021-04-28v4No1 / 22
779amnondominant control, feces, china, adult, homo sapiens, guangzhou city prefecture2021-04-28v4No1 / 22
795amnondominant uterine tube infundibulum, age 90 weeks, adult organism, research facility, china, gallus gallus, chicken2021-06-08v4No1 / 22
859amnon high in breast fed compared to formula fed in 6-month-old human stage hispanic los angeles district hispanic or latin american state of california infant homo sapiens feces 2022-01-12v4No1 / 22
859amnondominant 1-month-old human stage, hispanic, los angeles district, hispanic or latin american, formula fed, state of california, infant, homo sapiens, feces2022-01-12v4No1 / 22
960amnondominant homo sapiens, nigeria, edo state, infant, feces, 9-month-old human stage2022-12-20v4No1 / 22
960amnondominant homo sapiens, nigeria, edo state, infant, feces, 15-month-old human stage2022-12-20v4No1 / 22
69amnondominant canis lupus familiaris, beagle dog, united states of america, research facility, feces2017-02-21v4No1 / 22
333amnonhigh freq. in stroke patient feces (dominant homo sapiens, feces, guangzhou city prefecture, adult, stroke, china)2018-05-15v4No1 / 22
197amnondominant 13-year-old human stage, feces, homo sapiens, obsolete_juvenile stage, juvenile organism, india2017-09-12v4No1 / 23
241amnonhigh freq. in babies age < 3 years in russia (dominant homo sapiens, feces, infant, russia, age < 3 years)2017-11-13v4No1 / 23
241amnoncommon in babies age < 3 years in finland (common homo sapiens, feces, infant, age < 3 years, finland)2017-11-13v4No1 / 23
241amnonhigh freq. in babies age < 3 years in estonia (dominant homo sapiens, feces, infant, age < 3 years, estonia)2017-11-13v4No1 / 23
284amnondominant 12-month-old human stage, homo sapiens, female, feces, state of california, infant2018-01-27v4No1 / 23
312amnondominant feces, homo sapiens, french republic, adult, spondyloarthritis, spondylitis2018-04-09v4No1 / 23
394amnondominant homo sapiens, feces, adult, united states of america, state of california, control2018-11-06v4No1 / 23
399amnondominant feces, united states of america, zoological garden, panthera leo, lion, state of tennessee2018-11-16v4No1 / 23
509amnondominant 10-15-years-old human, feces, homo sapiens, nigeria, kebbi state, rural community, child, urinary schistosomiasis, schistosomiasis2019-03-18v4No1 / 23
542amnon high in child age 1-7 years compared to adult age 12-23 years in subgingival plaque dentition monkey macaca mulatta research facility puerto rico 2019-08-01v4No1 / 23
601amnondominant homo sapiens, feces, china, adult, type 2 diabetes mellitus2020-03-30v4No1 / 23
636amnondominant hospital, commonwealth of pennsylvania, united states of america, trachea, tracheal aspirate, endotracheal aspirate, respiratory failure, acute respiratory failure, adult, homo sapiens2020-08-08v4No1 / 23
702amnondominant canis lupus familiaris, dog, state of north carolina, united states of america, feces2028-04-02v4No1 / 23
779amnondominant ulcerative colitis, feces, china, adult, homo sapiens, guangzhou city prefecture2021-04-28v4No1 / 23
795amnondominant vagina, age 90 weeks, adult organism, research facility, china, gallus gallus, chicken2021-06-08v4No1 / 23
830amnondominant homo sapiens, feces, age 9-17 years, teenager, peru2021-09-10v4No1 / 23
841amnondominant human adult stage, state of texas, adult, united states of america, homo sapiens, feces2021-11-08v4No1 / 23
952amnondominant cat, felis catus, state of oregon, united states of america, house cat, adult organism, feces2022-12-09v4No1 / 23
956amnon high in no bean flour diet compared to bean flour diet in 6-propyl-2-thiouracil high fat diet caecum research facility brazil adult organism male organism balb/c mus musculus mouse 2022-12-17v4No1 / 23
978amnondominant feces, monkey, callithrix jacchus, marmosets, captive, research facility2022-12-24v4No1 / 23
1010amnondominant feces, dog, canis lupus familiaris, united states of america, commonwealth of pennsylvania, abnormality of the intestine, chronic enteropathy, canine chronic enteropathy2023-02-02v4No1 / 23
53amnondominant homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 23
58amnoncommon homo sapiens, new york city, contact lens2017-02-02v4No1 / 23
239amnondominant homo sapiens, feces, united states of america2017-11-08v4No1 / 24
241amnoncommon in babies age < 3 years in estonia (common homo sapiens, feces, infant, age < 3 years, estonia)2017-11-13v4No1 / 24
330amnondominant homo sapiens, feces, kingdom of norway, oslo, infant, age 1 year2018-05-13v4No1 / 24
365amnondominant homo sapiens, feces, child, obsolete_juvenile stage, sudan2018-08-30v4No1 / 24
489amnoncommon feces, anal swab, myotis myotis, bat, greater mouse eared bat, french republic2019-02-25v4No1 / 24
566amnondominant feces, china, homo sapiens, adult2019-11-24v4No1 / 24
580amnondominant homo sapiens, feces, israel, adult, female, pregnancy, first trimester2020-01-14v4No1 / 24
670amnoncommon dolphin parasite, croatia, opatija, anisakis pegreffii, adult organism, adult2020-09-26v4No1 / 24
702amnondominant felis catus, cat, state of north carolina, united states of america, feces2028-04-02v4No1 / 24
898amnoncommon ileum, coyote, canis latrans, edmonton, adult organism, anatomical space, wild, canada, male2022-04-19v4No1 / 24
959amnondominant homo sapiens, feces, child, 6-12 year-old child stage, adolescent stage, united states of america, state of california, los angeles, ulcerative colitis, ulcerative colitis2022-12-19v4No1 / 24
960amnoncommon 9-month-old human stage, feces, infant, edo state, nigeria, homo sapiens2022-12-20v4No1 / 24
960amnondominant homo sapiens, nigeria, edo state, infant, feces, 18-month-old human stage2022-12-20v4No1 / 24
978amnondominant monkey, callithrix jacchus, marmosets, captive, research facility, rectal swab2022-12-24v4No1 / 24
35amnoncommon tanzania, dense settlement biome, hospital, breast milk, homo sapiens2016-12-06v4No1 / 25
108amnondominant state of texas, research facility, united states of america, colon, mus musculus, mouse2017-04-07v4No1 / 25
159amnon high in midgut compared to hindgut in siganidae rabbitfish australia 2017-07-06v4No1 / 25
284amnoncommon 6-month-old human stage, homo sapiens, female, feces, state of california, infant2018-01-27v4No1 / 25
290amnondominant homo sapiens, feces, adult, city, china2018-02-01v4No1 / 25
379amnondominant gallus gallus, chicken, feces, age 15 - 35 days, united kingdom2018-09-14v4No1 / 25
395amnoncommon homo sapiens, feces, united states of america, commonwealth of pennsylvania, child, ulcerative colitis, inflammatory bowel disease, crohn's disease2018-11-14v4No1 / 25
428amnoncommon homo sapiens, adult, feces, nanchang city prefecture, pancreatitis, acute pancreatitis, china2018-12-09v4No1 / 25
544amnoncommon flower, vaccinium macrocarpon, american cranberry, united states of america, commonwealth of massachusetts2019-08-04v4No1 / 25
673amnoncommon control, ileum, research facility, age 6 weeks, male, male organism, province of alberta, canada, pig, sus scrofa2020-09-28v4No1 / 25
683amnoncommon during antibiotics treatment in feces (common metronidazole, vancomycin, neomycin, antibiotic, state of california, united states of america, adult, feces, homo sapiens)2028-03-04v4No1 / 25
779amnoncommon ulcerative colitis, feces, china, adult, homo sapiens, guangzhou city prefecture2021-04-28v4No1 / 25
859amnondominant 6-month-old human stage, hispanic, los angeles district, hispanic or latin american, formula fed, state of california, infant, homo sapiens, feces2022-01-12v4No1 / 25
895amnondominant 6-12 year-old child stage, bordeaux, cystic fibrosis, french republic, child, homo sapiens, feces2022-04-16v4No1 / 25
911amnondominant human adult stage, china, spinal cord injury, nanjing city prefecture, homo sapiens, feces2022-05-21v4No1 / 25
53amnondominant lima, homo sapiens, feces, city, shantytown2017-01-21v4No1 / 25
891amnoncommon 1-year-old human stage, urban slum, infant stage, dhaka, bangladesh, infant, homo sapiens, feces2022-04-03v4No1 / 25
301amnondominant canis lupus familiaris, dog, united states of america, rectum2018-03-05v4No1 / 26
354amnoncommon homo sapiens, united states of america, adult, pair of nares, nasal cavity, nasal brush2018-07-30v4No1 / 26
438amnondominant fifth decade human stage, fourth decade human stage, feces, homo sapiens, jiangsu province, adult, china2018-12-30v4No1 / 26
674amnoncommon mosquito, coquillettidia, coquilettidia venezuelensis, whole body, body proper, female, panama2020-09-28v4No1 / 26
689amnondominant non c. diff diarrhea, hospital, adult, tucson, united states of america, feces, homo sapiens2028-03-11v4No1 / 26
766amnondominant age 8 weeks, puppy, french republic, rectal swab, feces, canis lupus familiaris, dog2021-04-12v4No1 / 26
785amnoncommon state of iowa, ileum, research facility, age 9 weeks, sus scrofa, pig2021-05-16v4No1 / 26
941amnon high in chicken farm compared to pig farm in homo sapiens feces thailand adult nan province village rural community farm 2022-11-25v4No1 / 26
956amnondominant mouse, mus musculus, balb/c, male organism, adult organism, brazil, research facility, caecum, mouse chow2022-12-17v4No1 / 26
1010amnoncommon canine chronic enteropathy, chronic enteropathy, abnormality of the intestine, commonwealth of pennsylvania, united states of america, canis lupus familiaris, dog, feces2023-02-02v4No1 / 26
131amnondominant homo sapiens, feces, south korea2017-04-16v4No1 / 27
228amnoncommon in sinus brush of sinusitis patients (common homo sapiens, mucosa, sinusoidal space, paranasal sinus, united states of america, sinusitis)2017-10-31v4No1 / 27
387amnoncommon in feces of wild brown bear (common ursus arctos, brown bear, feces, sweden, wild)2018-11-03v4No1 / 27
399amnon high in crohn's disease compared to control in feces united states of america homo sapiens 2018-11-16v4No1 / 27
404amnon high in hard stool compared to normal stool in homo sapiens feces columbia city adult 2018-11-20v4No1 / 27
438amnondominant 6-12 year-old child stage, homo sapiens, feces, jiangsu province, child, age 8-12, china2018-12-30v4No1 / 27
495amnondominant gallus gallus, chicken, caecum, kingdom of spain, farm, free range chicken, age 3 weeks2019-03-03v4No1 / 27
540amnondominant dog, canis lupus familiaris, feces, united states of america, flagstaff, state of arizona2019-07-31v4No1 / 27
601amnondominant homo sapiens, feces, china, adult, control2020-03-30v4No1 / 27
659amnoncommon ulcerative colitis, acute severe colitis, homo sapiens, child, feces2020-09-19v4No1 / 27
674amnoncommon sand fly, lutzomyia gomezi, whole body, body proper, female, panama2020-09-28v4No1 / 27
674amnoncommon nyssomyia trapidoi, sand fly, whole body, body proper, female, panama2020-09-28v4No1 / 27
695amnondominant milk allergy, food allergy, age 4-10 years, child, israel, feces, homo sapiens2028-03-27v4No1 / 27
838amnondominant wild turkey, meleagris gallopavo, state of ohio, caecum, research facility, united states of america2021-10-13v4No1 / 27
959amnon high in ulcerative colitis ulcerative colitis compared to control in homo sapiens feces child 6-12 year-old child stage adolescent stage united states of america state of california los angeles 2022-12-19v4No1 / 27
961amnondominant feces, homo sapiens, child, kingdom of denmark, zealand, 4-year-old human stage2022-12-20v4No1 / 27
127amnondominant gallus gallus, chicken, united states of america, caecum, age 14-28 days2017-04-14v4No1 / 28
365amnondominant homo sapiens, feces, jordan, child, obsolete_juvenile stage2018-08-30v4No1 / 28
495amnondominant gallus gallus, chicken, caecum, broiler chicken, kingdom of spain, farm, age 2 weeks2019-03-03v4No1 / 28
540amnoncommon dog, canis lupus familiaris, feces, united states of america, flagstaff, state of arizona2019-07-31v4No1 / 28
710amnonsuspected contaminant (common in blanks) (contamination)2028-05-20v4No1 / 28
766amnoncommon age 8 weeks, puppy, french republic, rectal swab, feces, canis lupus familiaris, dog2021-04-12v4No1 / 28
822amnondominant dog, canis lupus familiaris, feces, australia, city of melbourne, foxhound, research facility, high protein diet, meat diet2021-08-29v4No1 / 28
862amnoncommon qinghai province, china, himalayan griffon, gyps himalayensis, bird, feces2022-01-19v4No1 / 28
26amnoncommon in combined swab of inguinal region and axilla (common homo sapiens, united states of america, inguinal region, axilla, sebum)2016-12-05v4No1 / 29
165amnoncommon in house fly larva grown on moist wheat bran (common research facility, musca domestica, house fly, larval stage, digestive system, china)2017-07-16v4No1 / 29
438amnondominant 14-year-old human stage, 13-year-old human stage, homo sapiens, feces, jiangsu province, age 13-14, china2018-12-30v4No1 / 29
622amnon high in ileum compared to caecum in age 42 days research facility liverpool great britain chicken gallus gallus 2020-05-08v4No1 / 29
822amnondominant dog, canis lupus familiaris, feces, australia, city of melbourne, foxhound, research facility, hydrolized diet2021-08-29v4No1 / 29
822amnondominant dog, canis lupus familiaris, feces, australia, city of melbourne, foxhound, research facility, high fiber2021-08-29v4No1 / 29
36amnonhigher in centernarians ( high in centererians compared to adult in homo sapiens feces sichuan province )2016-12-06v4No1 / 30
211amnon high in female compared to male in feces united states of america research facility mus musculus mouse diet high fat diet 2017-10-22v4No1 / 30
284amnoncommon 12-month-old human stage, homo sapiens, female, feces, state of california, infant2018-01-27v4No1 / 30
320amnoncommon homo sapiens, feces, adult, crohn's disease2018-04-19v4No1 / 30
438amnondominant 2-5 year-old child stage, homo sapiens, feces, jiangsu province, child, age 3-6, china2018-12-30v4No1 / 30
573amnoncommon feces, canis lupus familiaris, dog, united states of america, commonwealth of pennsylvania, juvenile stage2019-12-22v4No1 / 30
582amnoncommon urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, urocyon littoralis, ear canal, external acoustic meatus2020-01-22v4No1 / 30
695amnondominant sesame allergy, food allergy, age 4-10 years, child, israel, feces, homo sapiens2028-03-27v4No1 / 30
876amnoncommon age 1 week, neonate, monkey, state of washington, macaca mulatta, research facility, united states of america, feces2022-03-06v4No1 / 30
960amnoncommon 15-month-old human stage, feces, infant, edo state, nigeria, homo sapiens2022-12-20v4No1 / 30
45amnoncommon in feces babies age 0-2 in india (common homo sapiens, feces, infant, india)2016-12-19v4No1 / 31
108amnonincreases during fasting in mouse colon ( high in fasting late timepoints compared to early timepoints in state of texas research facility united states of america colon mus musculus mouse )2017-04-07v4No1 / 31
189amnonhigherin stems of grape vines with pierce disease compared to control ( high in xylella fastidiosa temecula1 pierce disease compared to control in united states of america state of california grape vitis vinifera stem endosphere )2017-08-30v4No1 / 31
262amnoncommon tick, ixodes scapularis, larval stage, body proper, research facility2017-12-10v4No1 / 31
390amnoncommon homo sapiens, feces, clostridium difficile intestinal infectious disease, australia, hospital, diarrhea2018-11-04v4No1 / 31
544amnoncommon vaccinium macrocarpon, american cranberry, united states of america, commonwealth of massachusetts, botanical fruit food product2019-08-04v4No1 / 31
673amnon high in ileum compared to caecum ascending colon in control research facility age 6 weeks male male organism province of alberta canada pig sus scrofa 2020-09-28v4No1 / 31
674amnoncommon mosquito, culex coronator, whole body, body proper, female, panama2020-09-28v4No1 / 31
165amnoncommon in moist wheat bran (common research facility, wheat bran, china)2017-07-16v4No1 / 32
292amnon high in crohn's disease ulcerative colitis compared to control in homo sapiens adult feces china 2018-02-05v4No1 / 32
411amnonhigher in wild baboons feeding on discarded human foods ( high in human contact compared to low human contact in zambia feces papio kindae wild monkey kinda baboon )2018-11-23v4No1 / 33
669amnon high in 14-days-old human compared to 12-month-old human stage in sweden infant feces homo sapiens 2020-09-26v4No1 / 33
19amnonhigher in CD compared to control in biopsies ( high in crohn's disease compared to control in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 34
269amnondecreases during one month in refrigeration of yao meat ( high in fresh early timepoint compared to late timpoint food spoilage in china foodon product type )2018-01-09v4No1 / 34
407amnoncommon costa rica, feces, monkey, cebus capucinus, white-faced capuchin, wild2018-11-21v4No1 / 34
674amnoncommon psychodopygus panamensis, sand fly, whole body, body proper, female, panama2020-09-28v4No1 / 34
977amnoncommon time 22 days, brazil, minas gerais state, canastra cheese, cheese food product2022-12-24v4No1 / 34
108amnoncommon state of texas, research facility, united states of america, colon, quail, coturnix coturnix2017-04-07v4No1 / 35
240amnonhigher in infants age<1 year compared to 1-3 years in baby feces ( high in under-1-year-old human stage age compared to 1-year-old human stage in homo sapiens feces infant finland )2017-11-12v4No1 / 35
262amnonhigher in tick larvae fed on PIXR immunized mice compared to non immunized ( high in pixr immunized compared to control in tick ixodes scapularis larval stage body proper research facility )2017-12-10v4No1 / 35
287amnoncommon snow field, mountain, depth 1-2m, japan2018-01-29v4No1 / 35
350amnoncommon in feces of white faced capuchin from costa rica rain forest (common monkey, cebus capucinus, feces, costa rica, white-faced capuchin, woodland area)2018-07-30v4No1 / 35
669amnoncommon 12-month-old human stage, sweden, infant, feces, homo sapiens2020-09-26v4No1 / 35
955amnon high in control compared to periodontitis periodontitis in chile dog canis lupus familiaris subgingival dental plaque subgingival plaque adult organism 2022-12-17v4No1 / 35
48amnonlower in 3 months compared to 1 week in infant hypopharynx ( high in 1-month-old human stage age age 1 week compared to 3-month-old human stage in homo sapiens kingdom of denmark hypopharynx infant )2017-01-19v4No1 / 35
219amnonhigher in pre-weaning compared to post-weaning in mouse feces ( high in age age 21 days breast milk compared to age 28 days mouse chow in mus musculus mouse feces c57bl/6 male research facility south korea )2017-10-24v4No1 / 36
240amnoncommon in infants age <3 years (common homo sapiens, feces, finland, infant, age < 3 years)2017-11-12v4No1 / 36
674amnoncommon culex declarator, mosquito, whole body, body proper, female, panama2020-09-28v4No1 / 36
963amnon high in age 1 week compared to age 3 weeks in state of indiana united states of america broiler chicken male organism research facility caecum gallus gallus chicken 2022-12-20v4No1 / 36
232amnoncommon in foot of diabetic patients (common homo sapiens, skin, australia, foot, diabetes mellitus)2017-11-05v4No1 / 37
345amnoncommon homo sapiens, nasal cavity, nasal cavity mucosa, austria, adult, graz city district2018-06-11v4No1 / 37
706amnoncommon state of north carolina, united states of america, feces, canis lupus familiaris, dog2028-04-10v4No1 / 37
960amnon high in 1-month-old human stage compared to 9-month-old human stage in feces infant edo state nigeria homo sapiens 2022-12-20v4No1 / 37
50amnoncommon in mitten crab gills (common gill, eriocheir sinensis, china)2017-01-19v4No1 / 37
723amnon high in age 0-6 months infant compared to 2-5 year-old child stage in homo sapiens indonesia municipality of yogyakarta feces child 2021-01-02v3No1 / 37
243amnoncommon beetle, anoplophora glabripennis, digestive system, united states of america2017-11-15v4No1 / 38
390amnoncommon homo sapiens, feces, australia, hospital, diarrhea2018-11-04v4No1 / 38
409amnonhigher in colon biopsies compared to stool and luminal content ( high in biopsy biopsy site compared to feces luminal content in homo sapiens united states of america )2018-11-22v4No1 / 38
503amnonincreases following malaria infection ( high in late time points experimental cerebral malaria malaria compared to control early time points in mouse mus musculus research facility c57bl/6 feces japan )2019-03-12v4No1 / 38
866amnon high in iga positive fraction compared to iga negative fraction in human adult stage adult united states of america homo sapiens feces 2022-02-08v4No1 / 38
102amnonlower in saliva compared to teeth, cheek ( high in dentition cheek compared to saliva in homo sapiens atlanta united states of america mouth )2017-04-03v4No1 / 39
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, infant, age 1 year2018-05-13v4No1 / 39
360amnoncommon agave salmiana, agave, leaf, leaf endosphere, desert, guanajuato, mexico2018-08-21v4No1 / 39
497amnoncommon chicken, gallus gallus, broiler chicken, austria, farm, feces, age 2 weeks2019-03-04v4No1 / 39
959amnoncommon ulcerative colitis, ulcerative colitis, los angeles, state of california, united states of america, adolescent stage, 6-12 year-old child stage, child, feces, homo sapiens2022-12-19v4No1 / 39
19amnoncommon in biopsies of children (IBD study) (common rectum, terminal ileum, sigmoid colon, caecum, colon, biopsy, children, homo sapiens, united states of america)2016-11-14v4No1 / 40
119amnonhigher in late timepoints (>4weeks) of worm infected mice ( high in parasitic helminthiasis infectious disease trichuris muris late timepoints compared to control in mus musculus mouse feces research facility sweden )2017-04-12v4No1 / 40
212amnonlower in obese mice fed quinoa diet compared to ain-93g rodent diet ( high in diet ain-93g rodent diet compared to quinoa food product in mouse mus musculus feces research facility united states of america obese body mass index status db/db mouse obesity )2017-10-22v4No1 / 40
79amnoncommon skin, united states of america, stenella attenuata2017-03-03v4No1 / 40
102amnonhigher in cheeks compared to teeth, saliva ( high in cheek compared to saliva dentition in homo sapiens atlanta united states of america mouth )2017-04-03v4No1 / 41
117amnoncommon zebra fish, danio rerio, research facility, larval stage, united states of america, intestine2017-04-10v4No1 / 41
352amnoncommon homo sapiens, feces, new delhi, india2018-07-30v4No1 / 41
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, adult, tonsil2018-11-04v4No1 / 41
400amnonhigher in children of hmong migrands born in the usa compared to non-migrant usa people ( high in hmong 2nd generation hmong compared to united states of america in homo sapiens feces )2018-11-18v4No1 / 41
401amnonlower in endospore enriched (lysis resistant) replicates ( high in control compared to endospore enriched fraction lysis in homo sapiens feces united states of america adult )2018-11-18v4No1 / 41
542amnoncommon subgingival plaque, dentition, monkey, macaca mulatta, research facility, puerto rico, child, age 1-7 years2019-08-01v4No1 / 41
51amnoncommon feces, homo sapiens, united states of america2017-01-19v4No1 / 41
14amnon high in stomach duodenum jejunum ileum compared to caecum right colon transverse colon left colon feces in mus musculus united states of america gastrointestinal system 2016-11-08v4No1 / 42
95amnoncommon in root canal (common homo sapiens, brazil, tooth, root canal)2017-03-12v4No1 / 42
595amnoncommon ixodes ricinus, castor bean tick, whole body, switzerland2020-03-16v4No1 / 42
60amnoncommon anser cygnoides, feces, china2017-02-03v4No1 / 42
79amnoncommon skin, united states of america, globicephala macrorhynchus, short finned pilot whale2017-03-03v4No1 / 42
89amnoncommon junco hyemalis, uropygial gland, commonwealth of virginia, songbird2017-03-08v4No1 / 43
189amnoncommon united states of america, state of california, grape, vitis vinifera, stem, endosphere2017-08-30v4No1 / 43
389amnoncommon pig, sus scrofa, vagina, united states of america, state of michigan, farm2018-11-04v4No1 / 43
406amnoncommon feces, south africa, acinonyx jubatus, cheetah2018-11-21v4No1 / 43
876amnon high in age 1 week neonate compared to age 20 months juvenile organism in monkey state of washington macaca mulatta research facility united states of america feces 2022-03-06v4No1 / 43
36amnoncommon homo sapiens, feces, sichuan province2016-12-06v4No1 / 44
241amnoncommon in babies age < 3 years in russia (common homo sapiens, feces, infant, russia, age < 3 years)2017-11-13v4No1 / 44
268amnoncommon fish, gadus morhua, atlantic cod, digestive system, kingdom of norway2017-12-24v4No1 / 44
302amnoncommon in feces of parakeet pet birds (common bird, melopsittacus undulatus, parakeet, mexico, feces, pet)2018-03-05v4No1 / 44
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, sudan2018-08-30v4No1 / 44
406amnoncommon feces, zoological garden, united states of america, myrmecophaga tridactyla, giant anteater2018-11-21v4No1 / 44
898amnoncommon descending colon, coyote, canis latrans, edmonton, adult organism, anatomical space, wild, canada, male2022-04-19v4No1 / 44
974amnoncommon anal swab, monkey, callithrix <genus>, marmosets, feces, brazil, captive, zoological garden2022-12-24v4No1 / 44
244amnoncommon drosophila melanogaster, fruit fly, research facility, digestive system, united kingdom2017-11-15v4No1 / 45
327amnonlower in nasopharynx of antibiotics treated cows compared to cows without antibiotic injection ( high in control compared to antibiotic in bos taurus cow nasopharynx canada )2018-04-30v4No1 / 45
558amnoncommon bird, centrocercus urophasianus, greater sage-grouse, united states of america, state of wyoming, duodenum2019-09-20v4No1 / 45
773amnoncommon recurrent tonsillitis, tonsillitis, homo sapiens, adult, japan, tonsillectomy, palatine tonsil2021-04-23v4No1 / 45
984amnoncommon feces, sea otter, enhydra lutris nereis, united states of america, state of california, wild2022-12-26v4No1 / 45
273amnoncommon 1-year-old human stage, feces, homo sapiens, kingdom of denmark, infant2018-01-14v4No1 / 46
428amnon high in pancreatitis acute pancreatitis compared to control in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 46
287amnoncommon snow field, mountain, depth 6-7m, japan2018-01-29v4No1 / 47
301amnoncommon canis lupus familiaris, dog, united states of america, duodenum2018-03-05v4No1 / 47
302amnoncommon in feces of canary pet birds (common bird, mexico, feces, pet, serinus canaria, canary)2018-03-05v4No1 / 47
482amnoncommon homo sapiens, feces, colombia, medellin metropolitan area, child, daycare, 1-5-years-old human2019-02-12v4No1 / 47
591amnoncommon human late adulthood stage, homo sapiens, feces, adult, united states of america, parkinson's disease2020-02-17v4No1 / 47
708amnonhigher in mice with iron deficient diet ( high in low iron iron deficient diet compared to iron supplemented diet iron in c57bl/6 state of montana united states of america research facility feces mouse mus musculus )2028-05-16v4No1 / 47
779amnoncommon control, feces, china, adult, homo sapiens, guangzhou city prefecture2021-04-28v4No1 / 47
830amnoncommon peru, teenager, age 9-17 years, feces, homo sapiens2021-09-10v4No1 / 47
898amnoncommon anatomical space, ascending colon, coyote, canis latrans, edmonton, adult organism, wild, canada, male2022-04-19v4No1 / 47
89amnoncommon junco hyemalis, commonwealth of virginia, songbird, cloaca2017-03-08v4No1 / 48
495amnon high in typhlitis disease intestinal disease compared to control in gallus gallus chicken caecum kingdom of spain farm free range chicken 2019-03-03v4No1 / 48
258amnoncommon in lungs of hiv patients with pneumonia (common homo sapiens, hiv infection, uganda, bronchoalveolar lavage, bronchial epithelium, lung, pneumonia)2017-11-27v4No1 / 49
645amnoncommon feces, state of idaho, captive, california condor, gymnogyps californianus, bird2020-09-03v4No1 / 49
651amnoncommon parkinson's disease, state of alabama, united states of america, adult, feces, homo sapiens2020-09-13v4No1 / 49
674amnoncommon biting midge, culicoides foxi, culicoides <genus>, whole body, body proper, female, panama2020-09-28v4No1 / 49
1010amnoncommon control, commonwealth of pennsylvania, united states of america, canis lupus familiaris, dog, feces2023-02-02v4No1 / 49
121amnoncommon homo sapiens, feces, bangladesh, adult2017-04-13v4No1 / 50
327amnoncommon bos taurus, cow, nasopharynx, canada2018-04-30v4No1 / 50
339amnon high in under-1-year-old human stage infant compared to adult in homo sapiens feces india 2018-05-24v4No1 / 50
406amnoncommon feces, equus przewalskii, przewalski horse, zoological garden, united states of america2018-11-21v4No1 / 50
898amnoncommon wild, feces, coyote, canis latrans, adult organism, male, edmonton, canada2022-04-19v4No1 / 50
960amnoncommon 18-month-old human stage, feces, infant, edo state, nigeria, homo sapiens2022-12-20v4No1 / 50
702amnoncommon felis catus, cat, state of north carolina, united states of america, feces2028-04-02v4No1 / 51
911amnoncommon spinal cord injury, human adult stage, china, nanjing city prefecture, homo sapiens, feces2022-05-21v4No1 / 51
932amnon high in atlantic rainforest parque estadual serra do mar-núcleo picinguaba compared to savanna reserva biológica de mogi-guaçu in stomach gaster odontomachus chelifer sao paulo state ant brazil tropical moist broadleaf forest biome 2022-08-30v4No1 / 51
321amnonhigher in mice treated with ampicillin compared to untreated mice ( high in ampicillin antibiotic compared to control in mus musculus mouse c57bl/6j feces united states of america research facility )2018-04-22v4No1 / 52
650amnoncommon african american, state of new york, united states of america, homo sapiens, adult, feces2020-09-09v4No1 / 52
671amnon high in state of california compared to state of oregon in 3-month-old human stage united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 52
93amnon high in egg jelly shelled egg compared to shell gland in hawaii bobtail squid euprymna scolopes 2017-03-12v4No1 / 53
292amnoncommon homo sapiens, adult, feces, ulcerative colitis, china2018-02-05v4No1 / 53
661amnoncommon lung, farm, maojian district, age 3 years, china, chinese giant salamander, andrias davidianus2020-09-20v4No1 / 53
333amnoncommon in stroke patient feces (common feces, homo sapiens, stroke, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 53
109amnoncommon united states of america, water, drinking water, site a2017-04-08v4No1 / 54
286amnonhigher in feces of individuals with kidney stones ( high in nephrolithiasis compared to control in sixth decade human stage homo sapiens feces adult nanning city prefecture china )2018-01-27v4No1 / 54
773amnoncommon iga glomerulonephritis, homo sapiens, adult, japan, tonsillectomy, palatine tonsil2021-04-23v4No1 / 54
15amnoncommon acinonyx jubatus, namibia, feces2016-11-08v4No1 / 55
292amnoncommon homo sapiens, adult, feces, crohn's disease, china2018-02-05v4No1 / 55
313amnonhigher in gut content of fish grown in 12C compared to 18C water ( high in temp 12c cold environment compared to warm temperature habitat temp 18c in sweden fish rainbow trout oncorhynchus mykiss research facility digestive system gut content )2018-04-10v4No1 / 55
390amnoncommon homo sapiens, feces, australia, hospital, salmonella gastroenteritis, diarrhea2018-11-04v4No1 / 55
683amnonhigher in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in metronidazole vancomycin neomycin antibiotic compared to control in state of california united states of america adult feces homo sapiens )2028-03-04v4No1 / 55
814amnoncommon high bmi, age 50-70 years, adult, obese body mass index status, overweight body mass index status, obesity, female, germany, homo sapiens, feces2021-06-30v4No1 / 55
898amnoncommon caecum, coyote, canis latrans, edmonton, adult organism, anatomical space, wild, canada, male2022-04-19v4No1 / 55
649amnoncommon ileum, lamb, age 6 weeks, research facility, new zealand, ovis aries, sheep2020-09-07v3No1 / 55
45amnonhigher in younf babies compared to 2 year olds in india ( high in under-1-year-old human stage age compared to 1-year-old human stage in homo sapiens feces infant india )2016-12-19v4No1 / 56
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, systemic lupus erythematosus2018-09-03v4No1 / 56
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, ulcerative colitis2018-11-06v4No1 / 56
488amnoncommon canis lupus familiaris, dog, feces, italy, lymphoma2019-02-25v4No1 / 56
591amnoncommon human late adulthood stage, homo sapiens, feces, adult, united states of america, control2020-02-17v4No1 / 56
308amnoncommon in neonatal intensive care unit floor (common united states of america, state of california, hospital, floor, dust)2018-03-31v4No1 / 57
759amnoncommon state of minnesota, domestic, dog, canis lupus familiaris, united states of america, feces2021-04-04v4No1 / 57
56amnoncommon nicotiana galuca, flower, nectar, israel2017-01-30v4No1 / 57
237amnoncommon bird, oceanodroma leucorhoa, seabird, canada, bon portage island, uropygial gland2017-11-07v4No1 / 58
651amnoncommon control, state of alabama, united states of america, adult, feces, homo sapiens2020-09-13v4No1 / 58
759amnoncommon wildlife sactuary, state of minnesota, canis lupus, wolf, united states of america, feces2021-04-04v4No1 / 58
814amnonhigher after 2 months of caloric restriction diet ( high in caloric restriction diet compared to control diet in high bmi age 50-70 years adult obese body mass index status overweight body mass index status obesity female germany homo sapiens feces )2021-06-30v4No1 / 58
281amnoncommon shinisaurus crocodilurus, crocodile lizard, cloaca, china2018-01-25v4No1 / 59
9amnonhigher in sea water with coral ( high in porites astreoides compared to control in bermuda sea water )2016-10-27v4No1 / 61
977amnoncommon canastra cheese, cheese curd, brazil, minas gerais state2022-12-24v4No1 / 61
333amnoncommon in healthy controls feces (common homo sapiens, feces, guangzhou city prefecture, adult, control, china)2018-05-15v4No1 / 61
948amnoncommon larval stage, black soldier fly, hermetia illucens, research facility, tours, french republic2022-12-05v3No1 / 62
302amnoncommon in feces of Cockatiel pet birds (common bird, mexico, feces, pet, nymphicus hollandicus, cockatiel)2018-03-05v4No1 / 63
380amnoncommon tibet autonomous region, feces, homo sapiens, tibetan plateau, adult2018-10-03v4No1 / 63
442amnonhigher in tnbs induced colitis compared to controls ( high in tnbs colitis compared to control in rattus norvegicus rat sprague dawley male research facility feces china )2019-01-06v4No1 / 63
502amnoncommon homo sapiens, feces, adult, united states of america, schizophrenia2019-03-12v4No1 / 63
530amnoncommon snake, feces, snake farm, farm, adula, hunan province, elaphe carinata, king ratsnake, china2019-07-21v4No1 / 63
242amnoncommon in native-americans (common homo sapiens, feces, united states of america, state of oklahoma, native american, arapaho, cheyenne)2017-11-14v4No1 / 65
448amnoncommon equus caballus, horse, feces, farm, equine grass sickness, disease, united kingdom2019-01-08v4No1 / 65
895amnoncommon 6-12 year-old child stage, cystic fibrosis, bordeaux, french republic, child, feces, homo sapiens2022-04-16v4No1 / 65
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, nigeria2018-08-30v4No1 / 66
558amnoncommon bird, centrocercus urophasianus, greater sage-grouse, united states of america, state of wyoming, colon2019-09-20v4No1 / 66
650amnoncommon asian, state of new york, united states of america, homo sapiens, adult, feces2020-09-09v4No1 / 66
671amnon high in state of california compared to state of oregon in age 8 months united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 66
114amnon high in adult compared to tadpole in rana pipiens northern leopard frog research facility digesta intestine state of wisconsin united states of america 2017-04-10v4No1 / 67
365amnoncommon homo sapiens, feces, jordan, child, obsolete_juvenile stage2018-08-30v4No1 / 67
642amnon high in chub mackerel scomber japonicus skin compared to saline water sea water water in san diego pacific ocean 2020-08-28v4No1 / 67
879amnon high in canis lupus wolf compared to dog canis lupus familiaris in adult organism captive austria research facility feces 2022-03-12v4No1 / 67
941amnoncommon chicken farm, rural community, village, nan province, adult, farm, thailand, feces, homo sapiens2022-11-25v4No1 / 67
941amnoncommon rural community, village, nan province, adult, thailand, feces, homo sapiens2022-11-25v4No1 / 67
71amnon high in small intestine stomach compared to feces hindgut colon in liolaemus ruibali argentina research facility 2017-02-25v4No1 / 67
398amnon high in crohn's disease compared to control in homo sapiens feces belgium 2018-11-15v4No1 / 68
582amnoncommon urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, urocyon littoralis, lip, labial commissure2020-01-22v4No1 / 68
690amnoncommon in squamous esophagos samples from patients undergoing endoscopy (common squamous esophagus, esophagus, esophageal disease, hospital, new york city, united states of america, homo sapiens)2028-03-11v4No1 / 68
902amnoncommon antibiotics induced colitis, antibiotic, colitis, colitis, adult organism, horse, equus caballus, united states of america, feces2022-05-02v4No1 / 68
952amnoncommon feces, adult organism, house cat, united states of america, state of oregon, felis catus, cat2022-12-09v4No1 / 68
301amnoncommon canis lupus familiaris, dog, united states of america, ileum2018-03-05v4No1 / 69
495amnoncommon gallus gallus, chicken, caecum, kingdom of spain, farm, free range chicken, age 4 days2019-03-03v4No1 / 69
941amnoncommon rural community, village, nan province, adult, pig farm, farm, thailand, feces, homo sapiens2022-11-25v4No1 / 69
978amnoncommon rectal swab, research facility, captive, marmosets, callithrix jacchus, monkey2022-12-24v4No1 / 69
72amnoncommon canis lupus familiaris, feces, united states of america, iowa2017-02-25v4No1 / 69
417amnoncommon anser cygnoides, swan goose, bird, feces, winter, china2018-12-01v4No1 / 70
803amnoncommon human late adulthood stage, type 2 diabetes mellitus, commonwealth of massachusetts, caribbean latino, adult, united states of america, feces, homo sapiens2021-06-18v4No1 / 70
313amnoncommon in fishfeed (common sweden, fish feed)2018-04-10v4No1 / 71
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, tonsil, age 4 weeks2018-11-04v4No1 / 71
404amnon high in barranquilla bucaramanga municipality of santiago de cali compared to bogota medellin metropolitan area in homo sapiens feces adult colombia city 2018-11-20v4No1 / 71
644amnoncommon adult, united states of america, hispanic or latin american, feces, homo sapiens2020-08-31v4No1 / 71
645amnon high in cloaca compared to feces in state of idaho captive california condor gymnogyps californianus bird 2020-09-03v4No1 / 71
663amnoncommon obese body mass index status, obesity, switzerland, adult, feces, homo sapiens2020-09-22v4No1 / 71
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, skin, nipple, adult2018-11-04v4No1 / 72
441amnonhigher in mice treated with indomethacin NSAID compared to non-treated controls ( high in indomethacin non-steroidal anti-inflammatory drug compared to control in mus musculus mouse c57bl/6j feces research facility united states of america )2019-01-06v4No1 / 72
448amnon high in equine grass sickness disease compared to control in equus caballus horse feces farm united kingdom 2019-01-08v4No1 / 72
541amnoncommon phascolarctos cinereus, koala, feces, australia, wild, cape otway, eucalyptus viminalis diet2019-08-01v4No1 / 72
663amnon high in poland compared to switzerland in adult feces homo sapiens 2020-09-22v4No1 / 72
879amnoncommon canis lupus familiaris, dog, adult organism, captive, austria, research facility, feces2022-03-12v4No1 / 72
26amnoncommon united states of america, homo sapiens, pair of nares, mucus2016-12-05v4No1 / 73
425amnoncommon homo sapiens, feces, africa, child, madagascar, antananarivo2018-12-08v4No1 / 73
879amnoncommon canis lupus, wolf, adult organism, captive, austria, research facility, feces2022-03-12v4No1 / 73
477amnoncommon homo sapiens, feces, adult, nepal, himalayas, rural community, tharu, agrarian2019-01-28v4No1 / 74
832amnoncommon nigeria, ibadan, adult, feces, homo sapiens2021-09-11v4No1 / 74
960amnon high in 9-month-old human stage compared to 18-month-old human stage in feces infant edo state nigeria homo sapiens 2022-12-20v4No1 / 74
963amnoncommon age 1 week, state of indiana, united states of america, broiler chicken, male organism, research facility, caecum, gallus gallus, chicken2022-12-20v4No1 / 74
395amnoncommon homo sapiens, feces, united states of america, commonwealth of pennsylvania, control2018-11-14v4No1 / 75
719amnoncommon charles river laboratories, icr/cd-1 mice, state of georgia, united states of america, research facility, dentition, mus musculus, mouse2028-05-23v4No1 / 75
794amnoncommon antiretroviral therapy, human immunodeficiency virus infectious disease, hiv infection, municipality of logrono, kingdom of spain, adult, homo sapiens, feces2021-06-08v4No1 / 75
477amnoncommon homo sapiens, feces, himalayas, nepal, rural community, raute2019-01-29v4No1 / 76
484amnoncommon feces, united states of america, adult, state of michigan, 17-29-years-old human, homo sapiens2019-02-13v4No1 / 76
74amnoncommon united states of america, feces, homo sapiens2017-02-27v4No1 / 76
431amnonhigher in midgut of hibernating bumble bees compared to non-hibernating ( high in hibernation compared to non hibernating in bombus terrestris bumble bee midgut research facility queen belgium )2018-12-16v4No1 / 77
516amnoncommon homo sapiens, feces, united states of america, state of ohio, adult2019-05-29v4No1 / 77
541amnoncommon phascolarctos cinereus, koala, feces, australia, wild, cape otway, eucalyptus obliqua diet2019-08-01v4No1 / 77
360amnoncommon agave, leaf, leaf endosphere, desert, guanajuato, mexico, agave tequiliana, cultivated environment2018-08-21v4No1 / 78
974amnoncommon in feces of marmosets reintroduced to the wild (common anal swab, captive, brazil, feces, marmosets, callithrix <genus>, monkey)2022-12-24v4No1 / 78
399amnoncommon feces, united states of america, zoological garden, panthera leo, lion, state of tennessee2018-11-16v4No1 / 79
401amnoncommon homo sapiens, feces, united states of america, adult2018-11-18v4No1 / 79
404amnoncommon homo sapiens, feces, colombia, city, adult2018-11-20v4No1 / 79
407amnon high in wet season compared to dry season in costa rica feces monkey cebus capucinus white-faced capuchin wild 2018-11-21v4No1 / 79
425amnoncommon homo sapiens, feces, africa, child, central african republic, bangui2018-12-08v4No1 / 79
26amnoncommon united states of america, felis catus, mucus, pair of nares2016-12-05v4No1 / 80
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, tonsil, age 1-3 weeks2018-11-04v4No1 / 80
483amnoncommon hawaii, pearl harbor, research facility, hydroides elegans, tubeworm, united states of america, adult2019-02-13v4No1 / 80
534amnoncommon river, water, fresh water, depth (water) 10cm, koshi river, tributary, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 80
695amnoncommon sesame allergy, food allergy, age 4-10 years, child, israel, feces, homo sapiens2028-03-27v4No1 / 80
292amnoncommon homo sapiens, adult, feces, control, china2018-02-05v4No1 / 81
339amnoncommon homo sapiens, feces, adult, india2018-05-24v4No1 / 81
643amnoncommon adult, south korea, feces, homo sapiens2020-08-30v4No1 / 81
911amnoncommon control, human adult stage, china, nanjing city prefecture, homo sapiens, feces2022-05-21v4No1 / 81
344amnoncommon in feces of heterosexuals (common homo sapiens, feces, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 82
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, control2018-09-03v4No1 / 82
562amnoncommon feces, quito, ecuador, child, age 5-13 years2019-11-05v4No1 / 82
955amnoncommon chile, dog, canis lupus familiaris, subgingival dental plaque, subgingival plaque, adult organism2022-12-17v4No1 / 82
977amnoncommon in raw milk used for cheese production (common raw milk, milk, brazil, minas gerais state)2022-12-24v4No1 / 82
334amnonhigher in dss induced colitis compared to controls ( high in dss induced colitis colitis compared to control in mus musculus mouse feces israel research facility c57bl/6 )2018-05-15v4No1 / 83
502amnoncommon homo sapiens, feces, adult, united states of america, control2019-03-12v4No1 / 83
648amnoncommon united states of america, dog, canis lupus familiaris, feces, state of louisiana2020-09-06v4No1 / 83
921amnon high in costa rica compared to puerto rico in cane toad bufo marinus skin epidermis skin 2022-07-24v4No1 / 83
959amnoncommon control, los angeles, state of california, united states of america, adolescent stage, 6-12 year-old child stage, child, feces, homo sapiens2022-12-19v4No1 / 83
231amnoncommon in dog rectum (common dog, canis lupus familiaris, united states of america, rectum, feces)2017-11-02v4No1 / 84
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msw, heterosexual2018-11-06v4No1 / 84
663amnoncommon lung, bronchoalveolar lavage, poland, adult, homo sapiens2020-09-22v4No1 / 84
961amnoncommon 4-year-old human stage, zealand, kingdom of denmark, child, homo sapiens, feces2022-12-20v4No1 / 84
972amnoncommon adult, state of california, united states of america, feces, homo sapiens2022-12-24v4No1 / 84
227amnonhiger in first 24hrs compared to later timepoints in baby nasopharynx ( high in newborn human stage age age <=24 hours compared to newborn human stage age >= 7 days in homo sapiens nasopharynx nasal cavity infant kingdom of the netherlands )2017-10-30v4No1 / 85
247amnoncommon homo sapiens, italy, feces, high bmi, obesity2017-11-21v4No1 / 85
405amnon high in ketogenic diet compared to control diet in mouse mus musculus research facility feces united states of america swiss webster 2018-11-20v4No1 / 85
601amnoncommon homo sapiens, feces, china, adult, type 2 diabetes mellitus2020-03-30v4No1 / 85
663amnoncommon low bmi, switzerland, adult, feces, homo sapiens2020-09-22v4No1 / 85
26amnon high in pair of nares mucus compared to saliva mouth in united states of america felis catus 2016-12-05v4No1 / 86
109amnoncommon united states of america, water, drinking water, site c2017-04-08v4No1 / 86
249amnoncommon homo sapiens, feces, united states of america2017-11-22v4No1 / 86
318amnoncommon canada, vancouver, ocean, pacific ocean, kelp, nereocystis2018-04-16v4No1 / 86
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, control2018-11-06v4No1 / 86
513amnoncommon waste water, hospital, city, xinxiang city prefecture, china2019-03-25v4No1 / 86
530amnoncommon snake, feces, snake farm, farm, adula, hunan province, ptyas mucosa, oriental ratsnake, china2019-07-21v4No1 / 86
766amnon high in age 2 days compared to age 8 weeks in puppy french republic rectal swab feces canis lupus familiaris dog 2021-04-12v4No1 / 86
841amnoncommon feces, human adult stage, state of texas, adult, united states of america, homo sapiens2021-11-08v4No1 / 86
340amnoncommon feces, felis catus, cat, city of melbourne, australia2018-05-27v4No1 / 87
344amnoncommon in feces of homosexual males (common homo sapiens, feces, united states of america, state of colorado, denver, homosexual, gay, msm)2018-05-31v4No1 / 87
360amnoncommon agave, desert, root endosphere, agave salmiana, mexico, guanajuato, root2018-08-21v4No1 / 87
430amnoncommon 20-year-old human stage, homo sapiens, adult, united states of america, state of arizona, city, feces2018-12-15v4No1 / 87
477amnoncommon homo sapiens, feces, himalayas, nepal, rural community, raji2019-01-29v4No1 / 88
487amnoncommon homo sapiens, feces, united states of america, metabolic syndrome, metabolic syndrome x2019-02-24v4No1 / 88
582amnoncommon urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, urocyon littoralis, perianal skin, rectum2020-01-22v4No1 / 88
673amnon high in control compared to salmonellosis salmonella enterica subsp. enterica serovar typhimurium in caecum ascending colon research facility age 6 weeks male male organism province of alberta canada pig sus scrofa 2020-09-28v4No1 / 88
830amnon high in iga positive fraction compared to iga igg negative fraction iga negative fraction in homo sapiens feces age 9-17 years teenager peru 2021-09-10v4No1 / 88
884amnoncommon state of california, united states of america, human adult stage, adult, feces, homo sapiens2022-03-24v4No1 / 88
71amnoncommon liolaemus ruibali, argentina, research facility, stomach2017-02-25v4No1 / 88
293amnoncommon homo sapiens, feces, adult, united states of america, american diet2018-02-07v4No1 / 89
382amnoncommon water, hot spring, geothermal field, ganzi tibetan autonomous prefecture, china, high temperature environment2018-10-22v4No1 / 89
629amnoncommon female, amsterdam, kingdom of the netherlands, adult, feces, homo sapiens2020-05-31v4No1 / 89
803amnoncommon human late adulthood stage, control, commonwealth of massachusetts, caribbean latino, adult, united states of america, feces, homo sapiens2021-06-18v4No1 / 89
530amnoncommon snake, feces, snake farm, farm, adula, hunan province, naja atra, chinese cobra, china2019-07-21v4No1 / 90
199amnonhigher in bathroom shower compared to kitchen sink ( high in bathroom shower tile building wall compared to kitchen sink in building urban biome united states of america )2017-10-01v4No1 / 91
503amnon high in balb/c compared to c57bl/6 in mouse mus musculus research facility feces japan 2019-03-12v4No1 / 91
915amnoncommon arapaho national forest, state of wyoming, medicine bow - routt national forest, state of colorado, depth (snow) 0-5cm, snow, united states of america2022-07-02v4No1 / 91
958amnoncommon mexico, mexican american, state of texas, united states of america, adult, homo sapiens, feces2022-12-19v4No1 / 91
978amnon high in japanese source (clea) compared to new england source (neprc) in rectal swab research facility captive marmosets callithrix jacchus monkey 2022-12-24v4No1 / 91
582amnoncommon urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, urocyon littoralis, external naris, pair of nares2020-01-22v4No1 / 92
649amnon high in ileum compared to jejunum duodenum in lamb age 6 weeks research facility new zealand ovis aries sheep 2020-09-07v3No1 / 92
428amnoncommon homo sapiens, adult, feces, nanchang city prefecture, control, china2018-12-09v4No1 / 93
601amnoncommon homo sapiens, feces, china, adult, control2020-03-30v4No1 / 93
363amnoncommon ovis aries, age 30 days, obsolete_juvenile stage, italy, dairy, caecum, colon, rectum2018-08-29v4No1 / 94
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msm, gay, homosexual2018-11-06v4No1 / 94
488amnoncommon canis lupus familiaris, dog, feces, italy, control2019-02-25v4No1 / 94
695amnoncommon milk allergy, food allergy, age 4-10 years, child, israel, feces, homo sapiens2028-03-27v4No1 / 94
838amnoncommon state of ohio, united states of america, research facility, caecum, wild turkey, meleagris gallopavo2021-10-13v4No1 / 94
400amnoncommon in feces of european american females (common homo sapiens, feces, united states of america, adult, female)2018-11-18v4No1 / 95
400amnoncommon in hmong (chinese) females from thailand (common homo sapiens, feces, adult, female, thailand, hmong, china)2018-11-18v4No1 / 95
238amnoncommon homo sapiens, feces, colombia2017-11-07v4No1 / 96
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 97
409amnoncommon homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v4No1 / 97
477amnoncommon homo sapiens, feces, adult, nepal, himalayas, rural community, forager, chepang2019-01-28v4No1 / 97
558amnoncommon bird, centrocercus urophasianus, greater sage-grouse, united states of america, state of wyoming, gizzard2019-09-20v4No1 / 97
629amnoncommon msw, heterosexual, amsterdam, kingdom of the netherlands, adult, feces, homo sapiens2020-05-31v4No1 / 97
839amnoncommon morning, south africa, kalahari desert, feces, meerkat, suricata suricatta2021-11-08v4No1 / 97
663amnoncommon poland, low bmi, adult, feces, homo sapiens2020-09-22v4No1 / 98
753amnoncommon zoological garden, captive, canis lupus, wolf, china, adult, feces2021-03-12v4No1 / 98
645amnoncommon cloaca, state of idaho, captive, california condor, gymnogyps californianus, bird2020-09-03v4No1 / 99
455amnoncommon homo sapiens, adult, canada, saliva, atherosclerosis2019-01-10v4No1 / 100
804amnon high in iga positive fraction compared to iga negative fraction in central african republic madagascar age 2-5 years child africa homo sapiens feces 2021-06-18v4No1 / 100
363amnon high in caecum colon rectum compared to rumen ruminant reticulum omasum in ovis aries age 30 days obsolete_juvenile stage italy dairy 2018-08-29v4No1 / 101
438amnoncommon young adult stage, homo sapiens, feces, china2018-12-30v4No1 / 101
961amnoncommon 6-year-old human stage, zealand, kingdom of denmark, child, homo sapiens, feces2022-12-20v4No1 / 101
948amnon high in larva larval stage compared to fully formed stage in french republic tours research facility hermetia illucens black soldier fly 2022-12-05v3No1 / 101
499amnoncommon brazil, pond, digestive system, intestine, dendropsophus minutus, frog, tadpole2019-03-05v4No1 / 102
877amnoncommon human early adulthood stage, austria, adult, homo sapiens, feces2022-03-08v4No1 / 102
198amnoncommon yellowstone national park, united states of america, geothermal field, water, hot spring, high temperature environment2017-09-13v4No1 / 103
213amnoncommon homo sapiens, south africa, vagina2017-10-22v4No1 / 103
425amnon high in antananarivo madagascar compared to central african republic bangui in homo sapiens africa child duodenum 2018-12-08v4No1 / 103
477amnoncommon homo sapiens, feces, adult, united states of america2019-01-28v4No1 / 103
563amnoncommon homo sapiens, feces, rectal swab, united states of america, male, msm, homosexual, control2019-11-18v4No1 / 103
580amnoncommon homo sapiens, feces, israel, adult, female, pregnancy, third trimester2020-01-14v4No1 / 103
956amnoncommon mouse chow, caecum, research facility, brazil, adult organism, male organism, balb/c, mus musculus, mouse2022-12-17v4No1 / 103
499amnoncommon digestive system, pond, intestine, brazil, remartinia, aeshnidae, dragonfly, larval stage2019-03-05v4No1 / 104
515amnoncommon whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, onthophagus similis2019-04-18v4No1 / 104
673amnon high in control compared to salmonellosis salmonella enterica subsp. enterica serovar typhimurium in caecum ascending colon research facility age 6 weeks male male organism province of alberta canada pig sus scrofa 2020-09-28v4No1 / 104
284amnoncommon homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 105
301amnoncommon canis lupus familiaris, dog, united states of america, colon2018-03-05v4No1 / 105
683amnoncommon state of california, united states of america, adult, feces, homo sapiens2028-03-04v4No1 / 105
438amnoncommon 6-12 year-old child stage, homo sapiens, feces, jiangsu province, child, age 8-12, china2018-12-30v4No1 / 106
215amnoncommon homo sapiens, feces, united states of america2017-10-23v4No1 / 107
213amnonlower in patients with bacterial vaginosis compared to healthy controls ( high in control compared to bacterial vaginosis in homo sapiens vagina south africa )2017-10-31v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 107
406amnoncommon feces, zoological garden, south africa, aardvark, orycteropus afer2018-11-21v4No1 / 107
409amnoncommon homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 108
436amnoncommon felis catus, cat, feces, united states of america, state of colorado2018-12-25v4No1 / 108
289amnoncommon homo sapiens, feces, adult, united states of america, state of michigan2018-02-01v4No1 / 109
438amnoncommon 2-5 year-old child stage, homo sapiens, feces, jiangsu province, child, age 3-6, china2018-12-30v4No1 / 109
960amnoncommon adult, female, feces, edo state, nigeria, homo sapiens2022-12-20v4No1 / 109
271amnon high in root structure root compared to soil rhizosphere in depth (soil) 0-20cm glycine max soybean china 2018-01-09v4No1 / 110
276amnoncommon feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v4No1 / 110
53amnoncommon homo sapiens, feces, lima, city, shantytown2017-01-21v4No1 / 110
425amnoncommon homo sapiens, africa, child, stunted growth, stomach2018-12-08v4No1 / 111
438amnoncommon 65-79 year-old human stage, feces, homo sapiens, adult, jiangsu province, china2018-12-30v4No1 / 111
477amnon high in nepal rural community himalayas compared to united states of america in homo sapiens feces adult 2019-01-28v4No1 / 111
563amnoncommon homo sapiens, feces, rectal swab, united states of america, male, msm, homosexual, hiv infection2019-11-18v4No1 / 111
388amnoncommon pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 6-10 weeks2018-11-03v4No1 / 112
580amnoncommon homo sapiens, feces, israel, adult, female, pregnancy, first trimester2020-01-14v4No1 / 112
663amnoncommon poland, obese body mass index status, obesity, adult, feces, homo sapiens2020-09-22v4No1 / 112
1007amnoncommon captive, deqing county, crested ibis, nipponia nippon, china, adult organism, cloacal swab, bird2023-01-25v4No1 / 112
198amnoncommon sediment, yellowstone national park, united states of america, thermophilic sediment, geothermal field, high temperature environment2017-09-13v4No1 / 113
269amnoncommon in fresh yao meat food (common china, foodon product type)2018-01-09v4No1 / 113
517amnoncommon feces, homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department2019-05-29v4No1 / 113
79amnoncommon skin, united states of america, delphinus delphis2017-03-03v4No1 / 113
388amnoncommon pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 12-19 weeks2018-11-03v4No1 / 114
438amnoncommon fifth decade human stage, fourth decade human stage, feces, homo sapiens, jiangsu province, adult, china2018-12-30v4No1 / 115
195amnoncommon in boston subway surfaces (common city, urban biome, train, boston)2017-09-07v4No1 / 116
301amnoncommon canis lupus familiaris, dog, united states of america, rectum2018-03-05v4No1 / 116
48amnonhigher in 3 months compared to 1 week in infant hypopharynx ( high in 3-month-old human stage age compared to 1-month-old human stage age 1 week in homo sapiens kingdom of denmark hypopharynx infant )2017-01-19v4No1 / 116
149amnonhigher in larvae transferred to stream compared to pond ( high in stream compared to pond in salamandra salamandra fire salamander germany larval stage amphibian larval stage skin mucus )2017-04-24v4No1 / 117
239amnoncommon homo sapiens, feces, united states of america2017-11-08v4No1 / 117
343amnoncommon in apple flowers (common apple, malus x domestica, flower structure, flower, united states of america, state of connecticut)2018-05-28v4No1 / 118
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 118
410amnonlower in feces compared to rectal biopsies in children with treatment naive uc ( high in rectum biopsy biopsy site compared to feces in homo sapiens child united states of america ulcerative colitis )2018-11-22v4No1 / 118
212amnoncommon mouse, mus musculus, feces, research facility, united states of america, lean body mass, control2017-10-22v4No1 / 120
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
753amnoncommon china, farm, dog breeding center, adult, feces, canis lupus familiaris, dog2021-03-12v4No1 / 120
954amnoncommon iron supplemented diet, , caecum, united states of america, state of florida, female organism, c57bl/6, research facility, mus musculus, mouse2022-12-15v4No1 / 120
352amnoncommon in duodenal biopsies (common homo sapiens, new delhi, duodenum, small intestine, india)2018-07-30v4No1 / 121
371amnoncommon feces, homo sapiens, hunter gatherer, amerindian, venezuela2018-09-06v4No1 / 121
438amnoncommon tenth decade human stage, ninth decade human stage, feces, homo sapiens, age >94, jiangsu province, adult, china2018-12-30v4No1 / 121
515amnoncommon whole body, beetle, aphodius depressus, detritivorous beetle, feces, bulgaria, balkan mountains2019-04-18v4No1 / 121
517amnoncommon homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department, skin, arm, forearm2019-05-29v4No1 / 121
632amnonhigher following metronidazole treatment in horse feces ( high in metronidazole compared to control in feces adult united states of america state of texas research facility horse equus caballus )2020-06-10v4No1 / 121
425amnoncommon homo sapiens, africa, child, duodenum, antananarivo, madagascar2018-12-08v4No1 / 123
660amnoncommon shuar population, village, rural community, ecuador, feces, homo sapiens2020-09-20v4No1 / 123
449amnoncommon homo sapiens, feces, colombia2019-01-09v4No1 / 124
582amnoncommon urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, external ear, urocyon littoralis2020-01-22v4No1 / 124
10amnonnegatively correlated with age (6-35) ( high in child compared to adult in homo sapiens feces toronto )2016-10-27v4No1 / 125
425amnoncommon homo sapiens, africa, child, duodenum, stunted growth, central african republic, bangui2018-12-08v4No1 / 125
607amnoncommon germany, homo sapiens, feces, parkinson's disease2020-04-19v4No1 / 125
69amnoncommon canis lupus familiaris, beagle dog, united states of america, research facility, feces2017-02-21v4No1 / 125
347amnoncommon kingdom of norway, svalbard archipelago, permafrost, soil, depth 150-200cm2018-07-15v4No1 / 126
67amnoncommon in dry processing of coffee beans (common coffea arabica, dry processing, ecuador)2017-02-19v4No1 / 126
113amnon high in larval stage compared to adult in danio rerio zebra fish research facility united states of america intestine 2017-04-10v4No1 / 128
131amnoncommon homo sapiens, feces, south korea2017-04-16v4No1 / 128
280amnoncommon atlantic ocean, depth (water) 20m, portuguese republic, eunicella labiata, gorgonian coral, coral, coral reef2018-01-25v4No1 / 128
607amnoncommon germany, homo sapiens, feces, control2020-04-19v4No1 / 128
173amnoncommon homo sapiens, saliva, austria, graz city district2017-07-26v4No1 / 129
841amnoncommon saliva, human adult stage, state of texas, adult, united states of america, homo sapiens2021-11-08v4No1 / 129
330amnoncommon fourth decade human stage, homo sapiens, feces, kingdom of norway, oslo, adult2018-05-13v4No1 / 130
721amnoncommon obesity, overweight body mass index status, adult, scotland, gaz:00052100, feces, homo sapiens2028-05-23v4No1 / 131
39amnoncommon in obese lepr-db mice (common mus musculus, research facility, feces, obesity)2016-12-09v4No1 / 132
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
625amnoncommon emperor tamarin, saguinus imperator, state of minnesota, como zoo, united states of america, zoological garden, feces2020-05-16v4No1 / 132
176amnoncommon in skin of hairless mice (common mouse, mus musculus, skin, female, skh-1 hairless mouse, dorsum, research facility, united states of america)2017-07-29v4No1 / 133
775amnoncommon jinan city prefecture, adult, saliva, china, homo sapiens2021-04-24v4No1 / 133
794amnoncommon control, municipality of logrono, kingdom of spain, adult, homo sapiens, feces2021-06-08v4No1 / 133
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
438amnoncommon 14-year-old human stage, 13-year-old human stage, homo sapiens, feces, jiangsu province, age 13-14, china2018-12-30v4No1 / 134
495amnoncommon gallus gallus, chicken, caecum, broiler chicken, kingdom of spain, farm, age 2 weeks2019-03-03v4No1 / 134
511amnoncommon snow, depth 0-5cm, united states of america, state of colorado2019-03-20v4No1 / 134
607amnoncommon germany, homo sapiens, feces, rem sleep behavior disorder2020-04-19v4No1 / 134
197amnoncommon 13-year-old human stage, feces, homo sapiens, obsolete_juvenile stage, juvenile organism, finland2017-09-12v4No1 / 136
594amnoncommon adult, cameroon, feces, homo sapiens, ngoantet, rural community2020-03-12v4No1 / 136
212amnoncommon mouse, mus musculus, feces, research facility, united states of america, obese body mass index status, db/db mouse, obesity2017-10-22v4No1 / 137
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 137
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 138
582amnoncommon urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, urocyon littoralis, axilla2020-01-22v4No1 / 140
255amnoncommon in fish feed (common united states of america, state of minnesota, research facility, fish feed)2017-11-24v4No1 / 141
629amnoncommon amsterdam, kingdom of the netherlands, adult, homosexual, msm, feces, homo sapiens2020-05-31v4No1 / 141
291amnoncommon canis lupus familiaris, dog, pair of nares, nasal cavity, germany2018-02-01v4No1 / 144
62amnon high in egypt compared to united states of america in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 144
132amnoncommon homo sapiens, feces, united states of america2017-04-16v4No1 / 145
611amnoncommon caecum, mouse, mus musculus, canada, research facility, age 9 months, cecal content2020-04-21v4No1 / 145
822amnoncommon hydrolized diet, research facility, foxhound, city of melbourne, australia, feces, canis lupus familiaris, dog2021-08-29v4No1 / 145
509amnoncommon 10-15-years-old human, feces, homo sapiens, nigeria, kebbi state, rural community, child, urinary schistosomiasis, schistosomiasis2019-03-18v4No1 / 146
15amnoncommon namibia, feces, canis mesomelas2016-11-08v4No1 / 147
85amnoncommon litopenaeus vannamei, pacific white shrimp, shenzhen city prefecture, digestive system, china, sea water2017-03-06v4No1 / 147
406amnoncommon feces, south africa, lycaon pictus, african wild dog2018-11-21v4No1 / 147
458amnonhigher in BALB/c strain compared to A/J and C57BL/6 strains ( high in balb/c compared to a/j c57bl/6 in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 147
475amnoncommon in air next to subway stations in hong kong (common air, hong kong, city)2019-01-20v4No1 / 147
509amnoncommon 10-15-years-old human, feces, homo sapiens, nigeria, kebbi state, rural community, child, control2019-03-18v4No1 / 147
515amnoncommon whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, aphodius haemorrhoidalis2019-04-18v4No1 / 147
73amnoncommon homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 147
74amnonHigher in animal product diet compared to plant diet ( high in diet animal product diet compared to plant diet in homo sapiens feces united states of america )2017-02-27v4No1 / 149
362amnoncommon hydrothermal vent, greece, marine sediment, mediterranean sea, marine hydrothermal vent, volcanic rock, volcanic crater, water, sea water, active vent2018-08-29v4No1 / 150
822amnoncommon meat diet, high protein diet, research facility, foxhound, city of melbourne, australia, feces, canis lupus familiaris, dog2021-08-29v4No1 / 151
866amnoncommon restraint stress, stress, mouse, state of illinois, c57bl/6, mus musculus, research facility, united states of america, feces2022-02-08v4No1 / 152
822amnoncommon high fiber, research facility, foxhound, city of melbourne, australia, feces, canis lupus familiaris, dog2021-08-29v4No1 / 153
358amnonhigher in dnbs induced colitis compared to controls in rat feces ( high in dnbs induced colitis colitis compared to control in rattus rat research facility wistar rat czech republic feces )2018-08-19v4No1 / 154
594amnoncommon adult, cameroon, feces, homo sapiens, city, yaounde2020-03-12v4No1 / 154
673amnoncommon caecum, control, ascending colon, research facility, age 6 weeks, male, male organism, province of alberta, canada, pig, sus scrofa2020-09-28v4No1 / 154
273amnon high in 1-month-old human stage age compared to 1-year-old human stage in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 155
53amnoncommon homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 155
108amnon high in colon compared to caecum in quail state of texas research facility united states of america coturnix coturnix 2017-04-07v4No1 / 157
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 157
108amnoncommon state of texas, research facility, united states of america, colon, mus musculus, mouse2017-04-07v4No1 / 158
180amnoncommon dermanyssus gallinae, red poulty mite, czech republic, poulty farm, larval stage, shelled egg2017-08-14v4No1 / 158
902amnoncommon salmonella gastroenteritis, salmonellosis, adult organism, horse, equus caballus, antibiotic, united states of america, feces2022-05-02v4No1 / 158
379amnoncommon gallus gallus, chicken, feces, age 15 - 35 days, united kingdom2018-09-14v4No1 / 160
192amnoncommon seed, seed structure, brassica napus2017-09-05v4No1 / 161
475amnoncommon in air in subway train in hong kong (common air, hong kong, city, subway)2019-01-20v4No1 / 161
121amnonhigh in diarrhea compared to recovery period ( high in diarrhea compared to control in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 162
290amnoncommon homo sapiens, feces, adult, city, china2018-02-01v4No1 / 162
297amnoncommon adolescent stage, immature stage, homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 162
337amnoncommon in feces of house mice from new york city (common mus musculus, house mice, mouse, new york city, united states of america, city)2018-05-18v4No1 / 165
906amnoncommon feces, sciurus carolinensis, grey squirrel, province of ontario, canada2022-05-19v4No1 / 165
209amnon high in cape cod canal atlantic ocean compared to vancouver pacific ocean in sea water ocean north america depth (water) 25cm 2017-10-15v4No1 / 166
232amnoncoomon in foot of healthy controls (common homo sapiens, skin, australia, foot)2017-11-05v4No1 / 166
159amnoncommon siganidae, rabbitfish, australia, midgut2017-07-06v4No1 / 169
190amnoncommon homo sapiens, tanzania, hadza, hunter gatherer, feces2017-09-04v4No1 / 169
241amnonlower in babies from russia compared to estonia ( high in estonia compared to russia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 169
123amnon high in high fat diet diet compared to normal diet mouse chow in mus musculus mouse feces research facility united states of america c57bl/6j 2017-04-13v4No1 / 170
197amnoncommon 13-year-old human stage, feces, homo sapiens, obsolete_juvenile stage, juvenile organism, india2017-09-12v4No1 / 170
374amnoncommon skin, costa rica, amphibia, craugastor bransfordii, bransford’s litter frog, frog2018-09-09v4No1 / 171
963amnoncommon age 5 weeks, state of indiana, united states of america, broiler chicken, male organism, research facility, caecum, gallus gallus, chicken2022-12-21v4No1 / 171
534amnoncommon river, water, fresh water, depth (water) 10cm, koshi river, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 172
589amnoncommon in high fat diet supplemented with cellulose in mice feces (common mouse, mus musculus, c57bl/6, research facility, feces, jackson laboratories, united states of america, state of georgia, high fat diet)2020-02-10v4No1 / 172
347amnoncommon kingdom of norway, svalbard archipelago, permafrost, soil, depth 100-150cm2018-07-15v4No1 / 173
403amnon high in winter compared to summer in air kingdom of spain pyrenees autumn 2018-11-18v4No1 / 176
405amnoncommon mouse, mus musculus, research facility, feces, united states of america, swiss webster, ketogenic diet2018-11-20v4No1 / 177
515amnoncommon whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, onthophagus ruficapillus2019-04-18v4No1 / 178
530amnoncommon snake, deinagkistrodon acutus, pit viper, feces, snake farm, farm, adula, hunan province, china2019-07-21v4No1 / 178
960amnon high in 18-month-old human stage infant compared to female adult in homo sapiens nigeria edo state feces 2022-12-20v4No1 / 178
671amnon high in age 8 months compared to female adult in united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 182
179amnoncommon mus musculus, mouse, oral cavity, research facility, united states of america, balb/c, mouth2017-08-13v4No1 / 183
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 183
399amnoncommon feces, united states of america, research facility, rat, rattus norvegicus2018-11-16v4No1 / 184
495amnoncommon gallus gallus, chicken, caecum, broiler chicken, kingdom of spain, farm, age 4 weeks2019-03-03v4No1 / 185
73amnonhigh in children with Crohn's disease compared to healthy adult controls ( high in obsolete_juvenile stage child crohn's disease compared to control adult in homo sapiens feces glasgow )2017-02-26v4No1 / 185
299amnoncommon saliva, adult, homo sapiens, mouth neoplasm, cancer, china2018-02-27v4No1 / 188
197amnon high in india compared to finland in 13-year-old human stage feces homo sapiens obsolete_juvenile stage juvenile organism 2017-09-12v4No1 / 189
386amnoncommon mouse, mus musculus, caecum, wild, brazil2018-10-28v4No1 / 189
402amnon high in zone 1 compared to zone 2,3 in sediment soil mine tailing alkaline mine tailing guangxi zhuang autonomous region china 2018-11-18v4No1 / 189
495amnoncommon gallus gallus, chicken, caecum, kingdom of spain, farm, free range chicken, age 8 weeks2019-03-03v4No1 / 189
352amnon high in feces compared to small intestine duodenum in homo sapiens new delhi india 2018-07-30v4No1 / 190
75amnoncommon homo sapiens, skin, arm, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 190
80amnon high in dry forest compared to tropical moist broadleaf forest biome in feces alouatta pigra howler monkey central america state of florida 2017-03-03v4No1 / 193
109amnon high in water treatment plant compared to distribution system in united states of america water drinking water site c 2017-04-08v4No1 / 193
534amnoncommon river, water, fresh water, depth (water) 10cm, koshi river, tributary, nepal, particle bound, filtered 2.7um2019-07-22v4No1 / 193
866amnoncommon control, mouse, state of illinois, c57bl/6, mus musculus, research facility, united states of america, feces2022-02-08v4No1 / 193
371amnoncommon homo sapiens, skin, amerindian, hunter gatherer, venezuela2018-09-06v4No1 / 195
620amnoncommon feces, wild, nouabale-ndoki national park, republic of congo, gorilla gorilla2020-05-06v4No1 / 196
312amnoncommon feces, homo sapiens, french republic, adult, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
620amnoncommon village, rural community, homo sapiens, nouabale-ndoki national park, republic of congo, feces2020-05-06v4No1 / 197
80amnoncommon feces, alouatta pigra, howler monkey, tropical broadleaf forest biome, central america, woodland area2017-03-03v4No1 / 198
411amnoncommon zambia, feces, monkey, papio kindae, kinda baboon, wild2018-11-23v4No1 / 200
42amnoncommon in tcr-b deficient c57bl6 mice (common feces, research facility, mus musculus, c57bl/6, japan)2016-12-10v4No1 / 201
248amnoncommon mouse, mus musculus, research facility, fvb/n mice, germany, feces2017-11-22v4No1 / 203
405amnoncommon mouse, mus musculus, research facility, feces, united states of america, swiss webster, control diet2018-11-20v4No1 / 203
702amnoncommon equus caballus, horse, state of north carolina, united states of america, feces2028-04-02v4No1 / 207
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
150amnoncommon canis lupus familiaris, dog, feces, united states of america2017-04-26v4No1 / 208
159amnoncommon siganidae, rabbitfish, hindgut, australia2017-07-06v4No1 / 208
542amnoncommon subgingival plaque, dentition, monkey, macaca mulatta, research facility, puerto rico, age 12-23 years, adult2019-08-01v4No1 / 208
388amnon high in age 6-10 weeks compared to age 12-19 weeks in pig sus scrofa tonsil farm united states of america state of michigan 2018-11-03v4No1 / 210
495amnoncommon gallus gallus, chicken, caecum, broiler chicken, kingdom of spain, farm, age 6 weeks2019-03-03v4No1 / 210
511amnoncommon snow, depth 0-5cm, lapland, finland, sweden, kingdom of norway2019-03-20v4No1 / 213
495amnoncommon gallus gallus, chicken, caecum, kingdom of spain, farm, free range chicken, age 12 weeks2019-03-03v4No1 / 214
520amnonhigher in gastric cancer compared to paired normal tissue ( high in gastric carcinoma stomach neoplasm compared to control in homo sapiens zhejiang province stomach adult china )2019-06-26v3No1 / 214
201amnonhigher in cactus fly compared to decaying cactus ( high in drosophila fly drosophila nigrospiracula compared to cactus decaying in mexico desert )2017-10-01v4No1 / 215
433amnoncommon sea water, ocean, depth (water) 4m, south china sea, coast2018-12-19v4No1 / 215
108amnoncommon quail, state of texas, research facility, united states of america, caecum, coturnix coturnix2017-04-07v4No1 / 216
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon homo sapiens, feces, adult, small village, rural community, china2018-02-01v4No1 / 218
347amnon high in depth 100-150cm depth 150-200cm compared to depth (soil) 20-30cm in kingdom of norway svalbard archipelago permafrost soil 2018-07-15v4No1 / 221
566amnoncommon feces, china, homo sapiens, adult2019-11-24v4No1 / 221
411amnoncommon zambia, feces, monkey, wild, papio ursinus, grayfoot chacma baboon2018-11-23v4No1 / 224
265amnoncommon in tree leaves (common canada, province of quebec, tree, leaf)2017-12-11v4No1 / 226
902amnon high in salmonella gastroenteritis salmonellosis compared to control in adult organism horse equus caballus united states of america feces 2022-05-02v4No1 / 226
916amnon high in antimicrobial agent antibiotics supllemented diet antibiotic compared to normal diet control in rabbit age 2 months kingdom of spain oryctolagus cuniculus caecum research facility 2022-07-04v4No1 / 226
42amnoncommon in tcr-b deficient balb/c mice (common mus musculus, research facility, feces, balb/c, japan)2016-12-10v4No1 / 227
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 227
25amnon high in antibiotic compared to control in oryctolagus cuniculus caecum rex rabbit sichuan province research facility 2016-12-01v4No1 / 231
214amnonlower in mice from jackson laboratories compared to taconic farms ( high in taconic farms compared to jackson laboratories in mouse mus musculus feces united states of america research facility strain 129s )2017-10-23v4No1 / 232
78amnoncommon nanger granti, kenya, feces, tropical grassland biome, gazelle2017-03-01v4No1 / 234
349amnoncommon rattus, rat, feces, research facility, sprague dawley, male, china2018-07-29v4No1 / 235
495amnoncommon gallus gallus, chicken, caecum, kingdom of spain, farm, free range chicken, age 3 weeks2019-03-03v4No1 / 236
53amnon high in shantytown lima compared to el salado small village in homo sapiens feces city 2017-01-21v4No1 / 236
286amnoncommon in feces of individuals with kidney stones (common sixth decade human stage, homo sapiens, feces, adult, nanning city prefecture, nephrolithiasis, china)2018-01-27v4No1 / 239
406amnoncommon feces, zoological garden, french republic, gorilla gorilla, monkey, gorilla2018-11-21v4No1 / 239
108amnoncommon state of texas, research facility, united states of america, caecum, mus musculus, mouse2017-04-07v4No1 / 241
220amnoncommon feces, united states of america, female, research facility, mus musculus, balb/c, high fat diet, mouse, diet2017-10-24v4No1 / 241
945amnon high in smoker cigarette smoking compared to non-smoker in homo sapiens oral cavity oral wash adult united states of america 2022-11-29v4No1 / 242
483amnoncommon hawaii, pearl harbor, research facility, hydroides elegans, tubeworm, united states of america, shelled egg2019-02-13v4No1 / 243
622amnoncommon caecum, age 42 days, research facility, liverpool, great britain, chicken, gallus gallus2020-05-08v4No1 / 244
161amnoncommon in barn swallows in colorado (common state of colorado, hirundo rustica, feces, united states of america, barn swallow)2017-07-12v4No1 / 245
425amnon high in antananarivo madagascar compared to bangui central african republic in homo sapiens feces africa child 2018-12-08v4No1 / 248
781amnoncommon kirk's dik-dik, madoqua kirkii, masai mara national park, kenya, wild, feces2021-04-28v4No1 / 248
351amnoncommon sea urchin, lytechinus variegatus, coelomic fluid, research facility, eagle harbor, state of florida, united states of america2018-07-30v4No1 / 249
429amnoncommon rat, rattus norvegicus, dahl salt-sensitive, feces, israel, research facility, salt rich diet, salt2018-12-13v4No1 / 249
219amnoncommon in mother mice feces (common mus musculus, mouse, feces, c57bl/6, research facility, female, south korea)2017-10-24v4No1 / 250
837sheryoHigher at 100-300cm depth compared 0-40cm to in soil after 10 years reforestation with Black locust trees, shaanxi, China ( high in depth 100-300cm compared to depth 0-40cm in robinia pseudoacacia 10 years reforestation silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 250
375amnonhigher in oil contaminated soil planted with plants compared to control oil contaminated soil ( high in rhizosphere planted soil compared to control in soil kuwait desert oil contaminated soil )2018-09-09v4No1 / 251
937amnoncommon white cheese, canakkale district, ezine cheese, turkey, cheese food product2022-10-04v3No1 / 251
419amnoncommon rat, rattus norvegicus, sprague dawley, research facility, feces, china2018-12-02v4No1 / 254
214amnon high in diet high fat diet compared to nih 31m chow mouse chow in mouse mus musculus feces united states of america research facility 2017-10-23v4No1 / 255
503amnoncommon mouse, mus musculus, research facility, feces, balb/c, japan2019-03-12v4No1 / 257
220amnoncommon mus musculus, mouse, feces, research facility, united states of america, female, balb/c, diet, mouse chow, low fat diet2017-10-24v4No1 / 262
276amnoncommon feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 263
304amnoncommon united states of america, state of california, beach, pacific ocean, air, aerosol, monterey bay2018-03-12v4No1 / 263
915amnon high in medicine bow - routt national forest arapaho national forest state of wyoming state of colorado compared to glacier peak wilderness state of washington in depth (snow) 0-5cm snow united states of america 2022-07-02v4No1 / 263
49amnoncommon giraffa camelopardalis, feces2017-01-19v4No1 / 264
253amnoncommon in clouds in puy de dome mountain in france (common cloud, french republic, air, autumn)2017-11-22v4No1 / 267
759amnon high in state of alabama wild wild boar compared to state of vermont farm pig in united states of america feces sus scrofa 2021-04-04v4No1 / 268
78amnonhigher in older gazelles ( high in age old age compared to young age in nanger granti kenya feces tropical grassland biome gazelle )2017-03-01v4No1 / 273
406amnonhigher in captive white rhinoceros compared to wild ( high in zoological garden french republic compared to wild south africa in feces bovidae ceratotherium simum white rhinoceros )2018-11-21v4No1 / 277
160amnoncommon in river water upstream of WTP effluent in spring in china (common spring, river, water, china)2017-07-12v4No1 / 278
688amnoncommon nanchang city prefecture, feces, age 140 days, research facility, duroc pig, china, pig, sus scrofa2028-03-09v4No1 / 278
770amnoncommon age < 1 year, infant, rectal swab, feces, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v4No1 / 280
225amnoncommon in polgA mutants (accelerated aging) (common mouse, mus musculus, feces, research facility, polga mutant, united kingdom)2017-10-29v4No1 / 281
286amnoncommon in feces of individuals without kidney stones (common sixth decade human stage, homo sapiens, feces, adult, nanning city prefecture, control, china)2018-01-27v4No1 / 281
384amnon high in barn hay compared to pasture in equus caballus horse canada farm saliva mouth 2018-10-22v4No1 / 283
586amnoncommon rattus norvegicus, rat, sprague dawley, research facility, male, israel, feces, fructose diet, fructose2020-02-09v4No1 / 287
495amnoncommon gallus gallus, chicken, caecum, kingdom of spain, farm, free range chicken, age 6 weeks2019-03-03v4No1 / 290
423amnoncommon bank vole, myodes glareolus, ukraine, skin2018-12-05v4No1 / 291
411amnoncommon feces, monkey, united states of america, zoological garden, papio anubis, olive baboon2018-11-23v4No1 / 292
237amnonlower in burrow soil compared to bird ( high in oceanodroma leucorhoa bird seabird compared to soil burrow in canada bon portage island )2017-11-07v4No1 / 298
419amnoncommon in rats with induced constipation (common rat, rattus norvegicus, sprague dawley, research facility, feces, constipation, china)2018-12-02v4No1 / 300
78amnon high in male compared to female in nanger granti kenya feces tropical grassland biome gazelle 2017-03-01v4No1 / 301
363amnoncommon ovis aries, age 30 days, obsolete_juvenile stage, italy, dairy, rumen, ruminant reticulum, omasum2018-08-29v4No1 / 302
615amnon high in soil compared to rhizosphere in saccharum sugarcane campinas brazil greenhouse 2020-04-27v4No1 / 306
80amnoncommon feces, central america, alouatta palliata, mantled howler monkey, state of florida2017-03-03v4No1 / 309
358amnoncommon rattus, rat, research facility, wistar rat, czech republic, feces2018-08-19v4No1 / 309
816amnoncommon early pregnancy, commonwealth of pennsylvania, pregnancy, feces, adult organism, research facility, united states of america, female organism, sus scrofa, pig2021-07-04v4No1 / 313
80amnon high in dry forest compared to tropical moist broadleaf forest biome in feces central america alouatta palliata mantled howler monkey state of florida 2017-03-03v4No1 / 314
208amnoncommon mus musculus, mouse, feces, united states of america, state of texas, balb/c2017-10-06v4No1 / 316
510amnoncommon kingdom of spain, water, estuary, estuary water, fresh water, salinity <5 ppt, bilbao2019-03-20v4No1 / 317
650amnon high in asian compared to caucasian european in feces adult homo sapiens united states of america state of new york 2020-09-12v4No1 / 317
299amnon high in mouth neoplasm cancer compared to control in saliva adult homo sapiens china 2018-02-27v4No1 / 319
879amnoncommon canis lupus, wolf, adult organism, chest, captive, austria, skin, research facility2022-03-12v4No1 / 320
756amnoncommon caecum, lethbridge, age 35 days, canada, broiler chicken, research facility, gallus gallus, chicken2021-03-22v4No1 / 321
801sheryoHigher at depth 60-90cm compared to depth 0-15cm in corn and soybean agriculture fields, Iowa USA ( high in depth (soil) 60-90cm compared to depth (soil) 0-15cm in subsurface drainage glycine max kelley nicollet soil series des moines united states agricultural field iowa zea mays soil )2021-06-16v4No1 / 321
515amnoncommon whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, onthophagus ovatus2019-04-18v4No1 / 322
518amnonhigher in beginning of experiment ( high in days 1-2 compared to days 14-28 in bos taurus cow feces united states of america state of georgia post-weaning angus steer )2019-06-11v4No1 / 325
429amnoncommon rat, rattus norvegicus, dahl salt-sensitive, feces, israel, research facility, control diet2018-12-13v4No1 / 327
61amnoncommon canis lupus familiaris, skin, research facility, united states of america, inguinal region2017-02-05v4No1 / 327
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
400amnonlower in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in karen myanmar compared to hmong china in homo sapiens feces thailand rural community )2018-11-18v4No1 / 329
111amnoncommon caecum, mongolian sheep, ovis aries, rectum, ileum, colon, china2017-04-09v4No1 / 330
433amnoncommon sea water, ocean, depth (water) 4m, indian ocean2018-12-19v4No1 / 333
423amnon high in human contact compared to no human contact chernobyl exclusion zone in bank vole myodes glareolus ukraine skin 2018-12-05v4No1 / 334
351amnoncommon in artificial sea water where sea urchins were grown (common sea urchin, lytechinus variegatus, research facility, state of florida, united states of america, artificial seawater, sea water)2018-07-30v4No1 / 338
649amnon high in ileum compared to colon in lamb age 6 weeks research facility new zealand ovis aries sheep 2020-09-07v3No1 / 338
124amnoncommon mus musculus, mouse, caecum, feces, c57bl/6j, united states of america2017-04-14v4No1 / 339
816amnoncommon late pregnancy, commonwealth of pennsylvania, pregnancy, feces, adult organism, research facility, united states of america, female organism, sus scrofa, pig2021-07-04v4No1 / 340
190amnon high in wet season compared to dry season in homo sapiens tanzania hadza hunter gatherer feces 2017-09-04v4No1 / 341
93amnoncommon in seawater near the shore in hawaii (common hawaii, sea water, shore)2017-03-12v4No1 / 345
254amnoncommon river, water, fresh water, depth (soil) 50cm, jiulong river, fujian province, china2017-11-23v4No1 / 347
902amnoncommon control, adult organism, horse, equus caballus, united states of america, feces2022-05-02v4No1 / 350
620amnon high in gorilla gorilla compared to pan troglodytes troglodytes chimpanzee in nouabale-ndoki national park republic of congo wild feces 2020-05-06v4No1 / 351
792amnoncommon depth (soil) 20-60cm, nitraria tangutorum, rhizosphere, sand, ph 9, minqin county, depth (soil) 50cm, desert, china2021-06-07v4No1 / 352
254amnonhigher in river when close to populated region compared to downstream ( high in city populated place upstream compared to downstream in river water fresh water depth (soil) 50cm jiulong river fujian province china )2017-11-23v4No1 / 356
442amnoncommon in tnbs induced colitis in rat feces (common rattus norvegicus, rat, sprague dawley, male, research facility, feces, tnbs, colitis, china)2019-01-06v4No1 / 360
759amnoncommon state of alabama, united states of america, feces, wild, wild boar, sus scrofa2021-04-04v4No1 / 362
902amnon high in colitis colitis antibiotics induced colitis antibiotic compared to control in adult organism horse equus caballus united states of america feces 2022-05-02v4No1 / 364
341amnonhigher in fresh drinking water compared to week old water ( high in fresh water compared to stagnant water in water drinking water united states of america tap water state of illinois )2018-05-28v4No1 / 365
620amnon high in nouabale-ndoki national park wild republic of congo compared to zoological garden united states of america in gorilla gorilla gorilla feces 2020-05-06v4No1 / 368
801sheryoHigher at depth 60-90cm compared to depth 0-15cm in corn agriculture fields, Iowa USA ( high in depth (soil) 60-90cm compared to depth (soil) 0-15cm in kanawha nicollet soil series des moines united states agricultural field iowa zea mays soil )2021-06-15v4No1 / 369
225amnoncommon in wild type cotrols (common mouse, mus musculus, feces, research facility, wild type genotype, united kingdom)2017-10-29v4No1 / 370
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
160amnoncommon in river water upstream of WTP effluent in autumn in china (common river, water, autumn, china)2017-07-12v4No1 / 376
400amnonhigher in people from thailand compared to 2nd generation immigrants to usa ( high in thailand rural community compared to united states of america in homo sapiens feces )2018-11-18v4No1 / 378
29amnon high in seed compared to seedling in brassica oleracea french republic 2016-12-05v4No1 / 379
458amnonlower in A/J strain compared to BALB/c and C57BL/6 strains ( high in balb/c c57bl/6 compared to a/j in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 379
256amnoncommon sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 380
801sheryoHigher at depth 60-90cm compared to depth0-15cm in soybean and corn agriculture fields , Iowa USA ( high in depth (soil) 60-90cm compared to depth (soil) 0-15cm in united states nicollet soil series glycine max zea mays ames des moines iowa agricultural field soil )2021-06-15v4No1 / 386
912amnon high in alive compared to dead in zebra mussel dreissena polymorpha fresh water aquarium mussel whole body body proper research facility 2022-05-27v4No1 / 398
879amnoncommon dog, canis lupus familiaris, adult organism, chest, captive, austria, skin, research facility2022-03-12v4No1 / 399
582amnon high in perianal skin rectum compared to ear canal external acoustic meatus in wild united states of america santa catalina island urocyon littoralis santa catalina island fox urocyon littoralis catalinae 2020-01-22v4No1 / 400
781amnoncommon giraffe, giraffa tippelskirchi, masai mara national park, kenya, wild, feces2021-04-28v4No1 / 400
314amnoncommon caecum, cecal content, tibet autonomous region, farm, sus scrofa, pig, china2018-04-10v4No1 / 402
347amnoncommon depth (soil) 0-20cm, kingdom of norway, svalbard archipelago, permafrost, soil, permafrost active layer2018-07-15v4No1 / 405
558amnon high in gizzard compared to crop in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 408
625amnoncommon pongo abelii, sumatran orangutan, state of minnesota, como zoo, united states of america, zoological garden, feces2020-05-16v4No1 / 414
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
781amnoncommon elephant, loxodonta africana, masai mara national park, kenya, wild, feces2021-04-28v4No1 / 419
515amnoncommon whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, aphodius pusillus2019-04-18v4No1 / 421
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
781amnoncommon thomson's gazelle, eudorcas thomsonii, masai mara national park, kenya, wild, feces2021-04-28v4No1 / 425
792amnon high in soil compared to haloxylon ammodendron nitraria tangutorum rhizosphere in depth (soil) 20-60cm sand ph 9 minqin county depth (soil) 50cm desert china 2021-06-07v4No1 / 432
995amnoncommon bornean orangutan, pongo pygmaeus, houston, state of texas, united states of america, feces, monkey, zoological garden2022-12-27v4No1 / 432
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, grivet monkey2018-01-16v4No1 / 440
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
75amnoncommon homo sapiens, venezuela, feces, amerindian, hunter gatherer2017-02-27v4No1 / 442
371amnonhigher in amerindians compared to western visitors ( high in hunter gatherer amerindian venezuela compared to city united states of america in feces homo sapiens )2018-09-06v4No1 / 443
792amnoncommon depth (soil) 20-60cm, haloxylon ammodendron, rhizosphere, sand, ph 9, minqin county, depth (soil) 50cm, desert, china2021-06-07v4No1 / 443
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, vervet monkey2018-01-16v4No1 / 446
702amnoncommon state of north carolina, united states of america, feces, sheep, ovis aries2028-04-02v4No1 / 450
399amnoncommon feces, united states of america, zoological garden, state of tennessee, ovis aries, sheep2018-11-16v4No1 / 451
424amnoncommon sus scrofa, pig, jinhua city prefecture, jinhua pig, feces, farm, china2018-12-06v4No1 / 452
470amnoncommon sus scrofa, pig, canada, farm, province of quebec, feces, female, adult, pregnancy2019-01-14v4No1 / 457
111amnon high in rectum caecum ileum colon compared to rumen ruminant reticulum omasum in mongolian sheep ovis aries china 2017-04-09v4No1 / 464
406amnoncommon feces, zoological garden, french republic, connochaetes taurinus, blue wildebeest2018-11-21v4No1 / 467
160amnoncommon in wastewater treatment plant effluent in autumn in china (common autumn, wastewater treatment plant, effluent, china)2017-07-12v4No1 / 469
276amnon high in peru small village tunapuco rural community compared to united states of america city state of oklahoma in feces homo sapiens adult 2018-01-22v4No1 / 469
221amnoncommon rattus, sprague dawley, rat, feces, research facility, china2017-10-25v4No1 / 470
406amnoncommon feces, zoological garden, ceratotherium simum, white rhinoceros, french republic2018-11-21v4No1 / 474
406amnoncommon feces, zoological garden, french republic, antidorcas marsupialis, springbok2018-11-21v4No1 / 477
454amnoncommon feces, elaphurus davidianus, pere deer, deer, wild, china2019-01-10v4No1 / 480
236amnoncommon state of california, bodega bay, ocean, zostera marina, marine eelgrass, root2017-11-07v4No1 / 483
438amnon high in fifth decade human stage fourth decade human stage 65-79 year-old human stage adult compared to 6-12 year-old child stage 2-5 year-old child stage age 3-6 age 8-12 child in homo sapiens feces china 2018-12-30v4No1 / 486
274amnoncommon monkey, chlorocebus djamdjamensis, bale monkey, ethiopia, feces2018-01-16v4No1 / 489
256amnoncommon sus scrofa, pig, caecum, right colon, left colon, united kingdom2017-11-26v4No1 / 490
518amnoncommon bos taurus, cow, feces, united states of america, state of georgia, post-weaning, angus steer2019-06-11v4No1 / 498
781amnoncommon impala, aepyceros melampus, masai mara national park, kenya, wild, feces2021-04-28v4No1 / 510
748amnoncommon jersey cow, united states of america, state of mississippi, research facility, female organism, feces, bos taurus, cow2021-03-10v4No1 / 516
657amnoncommon research facility, china, qinghai province, rumen liquid, rumen, age < 1 year, lamb, sheep, ovis aries2020-09-13v4No1 / 517
304amnoncommon united states of america, state of california, beach, pacific ocean, air, aerosol, santa cruz province2018-03-12v4No1 / 518
27amnoncommon bos grunniens, rumen, china2016-12-05v4No1 / 532
209amnonlower in whale blow condensate compared to ocean water ( high in sea water ocean depth (water) 25cm compared to megaptera novaeangliae humpback whale respiratory airway whale blow exhaled air condensate in north america )2017-10-15v4No1 / 560
905amnon high in jejunum ileum compared to abomasum rumen in western australia sheep age 1 year australia ovis aries research facility 2022-05-18v3No1 / 563
254amnon high in summer wet season autumn compared to winter dry season in river water fresh water depth (soil) 50cm jiulong river fujian province china 2017-11-23v4No1 / 571
160amnoncommon in wastewater treatment plant effluent in spring in china (common spring, wastewater treatment plant, effluent, china)2017-07-12v4No1 / 573
254amnon high in summer wet season compared to winter dry season autumn in river water fresh water depth (soil) 50cm jiulong river fujian province china 2017-11-23v4No1 / 581
84amnoncommon soil, peatland, peat soil, sphagnum bog, temperate grassland biome, depth 20cm, wetland area2017-03-06v4No1 / 590
633amnoncommon feces, elephas maximus, asian elephant, captive, thailand2020-06-16v4No1 / 591
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in kingdom of spain water estuary estuary water bilbao 2019-03-20v4No1 / 592
792amnoncommon depth (soil) 20-60cm, sand, ph 9, minqin county, depth (soil) 50cm, soil, desert, china2021-06-07v4No1 / 595
318amnoncommon canada, vancouver, ocean, pacific ocean, red alga, mastocarpus2018-04-16v4No1 / 598
801sheryoCommon at depth 15-30cm in corn agriculture fields, Iowa USA (common kanawha, depth (soil) 15-30cm, nicollet soil series, ph 7.7, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 598
406amnoncommon feces, zoological garden, diceros bicornis, black rhinoceros, united states of america, switzerland2018-11-21v4No1 / 600
517amnon high in feces compared to skin arm forearm in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 606
265amnonhigher in tree leaves compared to soil and soilwater ( high in leaf tree compared to soil soilwater water in canada province of quebec )2017-12-11v4No1 / 610
995amnoncommon orangutan, pongo sp., columbus, state of ohio, united states of america, feces, monkey, zoological garden2022-12-27v4No1 / 613
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in tenth decade human stage ninth decade human stage fifth decade human stage fourth decade human stage 65-79 year-old human stage age >94 compared to young adult stage soldiers in homo sapiens feces china )2018-12-30v4No1 / 617
264amnoncommon oryctolagus cuniculus, rex rabbit, caecum, research facility, jiangsu province, china2017-12-11v4No1 / 622
781amnoncommon tsessebe, damaliscus lunatus, masai mara national park, kenya, wild, feces2021-04-28v4No1 / 622
458amnonhigher in mice from hsd compared to jackson laboratories ( high in harlan sprague dawley compared to jackson laboratories in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 644
800amnonhigher at 100-250 days compared to 7-28 days following heavy metal contamination ( high in autumn summer compared to spring in reservoir sediment depth 0-10cm heavy metal china xiannv lake lake fresh water sediment )2021-06-15v4No1 / 644
801sheryoCommon in soybean and corn agriculture fields at depth 60-90cm, Iowa USA (common ph 7.7, depth (soil) 60-90cm, united states, nicollet soil series, glycine max, zea mays, ames, des moines, iowa, agricultural field, soil)2021-06-15v4No1 / 650
443amnonhigher in lower mississippi river (downstream) compared to upper mississippi river ( high in downstream lower mississippi river compared to upstream higher mississippi river in mississippi river water river fresh water depth (water) 1m united states of america free floating filtered 0.2um )2019-01-07v4No1 / 652
103amnonlower in particle bound fraction compared to free floating bacteria in mississippi river ( high in free floating compared to particles in river united states of america mississippi river fresh water aquatic biome )2017-04-05v4No1 / 653
781amnoncommon eland, tragelaphus oryx, masai mara national park, kenya, wild, feces2021-04-28v4No1 / 666
801sheryoCommon at depth 60-90cm in corn and soybean agriculture fields, Iowa USA (common depth (soil) 60-90cm, ph 7.9, subsurface drainage, glycine max, kelley, nicollet soil series, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-16v4No1 / 667
25amnoncommon oryctolagus cuniculus, caecum, rex rabbit, sichuan province, research facility2016-12-01v4No1 / 669
406amnoncommon feces, south africa, antidorcas marsupialis, springbok2018-11-21v4No1 / 678
347amnoncommon kingdom of norway, svalbard archipelago, permafrost, soil, depth (soil) 20-30cm2018-07-15v4No1 / 698
801sheryoCommon at depth 30-60cm in corn agriculture fields, Iowa USA (common ph 8.1, depth (soil) 30-60cm, kanawha, nicollet soil series, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 703
809amnoncommon lu'an city prefecture, flowerpot, research facility, greenhouse, dendrobium officinale, rhizosphere, china2021-06-20v4No1 / 715
821sheryoComoon in soil of miscanthus field at 50-100cm depth, Michigan USA (common depth 50-100m, miscanthus, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-08-02v4No1 / 726
821sheryoCommon in soil of restored prairie at 50-100cm depth, Michigan USA (common depth 50-100m, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-07-28v4No1 / 744
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 752
801sheryoCommon at depth 30-60cm in corn and soybean agriculture fields, Iowa USA (common ph 6.7, depth (soil) 30-60cm, subsurface drainage, glycine max, kelley, nicollet soil series, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 760
801sheryoCommon at depth 60-90cm in corn agriculture fields, Iowa USA (common depth (soil) 60-90cm, ph 8.3, kanawha, nicollet soil series, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 764
206amnoncommon in air from israel particles <10um size (common air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 765
157amnoncommon in naers of weened calves (common nasal cavity, bos taurus, calve, united states of america, juvenile organism, pair of nares)2017-07-04v4No1 / 766
821sheryoCommon in soil of continuous corn field at 50-100cm depth, Michigan USA (common depth 50-100m, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, continuous corn, corn, soil)2021-07-28v4No1 / 769
454amnon high in summer compared to winter in elaphurus davidianus pere deer deer feces china 2019-01-10v4No1 / 791
824sheryoHigher at 0-10cm depth compared to 10-20cm depth in soil after grazing exclusion at 0-10cm depth, Ningxia china ( high in depth (soil) 0-10cm compared to depth 10-20cm in yunwushan national natural grassland protection zone ningxia province calci-orthic aridisol haplic calcisol grazing exclusion china soil )2021-08-08v4No1 / 807
801sheryoCommon in soybean and corn agriculture fields at depth 30-60cm, Iowa USA (common depth (soil) 30-60cm, ph 7.4, united states, nicollet soil series, glycine max, zea mays, ames, des moines, iowa, agricultural field, soil)2021-06-15v4No1 / 839
801sheryoCommon at depth 15-30cm in corn and soybean agriculture fields, Iowa USA (common ph 6, depth (soil) 15-30cm, subsurface drainage, glycine max, kelley, nicollet soil series, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 841
632amnoncommon feces, adult, united states of america, state of texas, research facility, horse, equus caballus2020-06-10v4No1 / 848
371amnonhigher in skin of amerindians compared to western visitors ( high in venezuela hunter gatherer amerindian compared to city united states of america in homo sapiens skin )2018-09-06v4No1 / 854
801sheryoCommon at depth 0-15cm in corn agriculture fields, Iowa USA (common kanawha, ph 7.1, nicollet soil series, depth (soil) 0-15cm, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 862
767sheryoCommon in soil planted with Chrysanthemum, fertilized with bio-organic fertilizer in Nanjing China (common paenibacillus polymyxa, paenibacillus, compost, compost biofilter, pig manure, bio-organic fertilizer, soil, ph 6.9, chrysanthemum morifolium ramat., chrysanthemum, china, nanjing county)2021-04-14v4No1 / 866
821sheryoCommon in soil of switchgrass field at 50-100cm depth, Michigan USA (common depth 50-100m, panicum virgatum, kellogg biological station, mesic type hapludalf, kalamazoo loam, state of michigan, soil, united states of america)2021-08-03v4No1 / 872
767sheryoCommon in soil planted with Chrysanthemum, fertilized with bio-organic fertilizer and amended with soil fumigant 'Dazomet' in Nanjing China (common pig manure, compost soil, paenibacillus, paenibacillus polymyxa, compost biofilter, bio-organic fertilizer, nanjing county, china, chrysanthemum, chrysanthemum morifolium ramat., ph 6.9, soil, soil fumigation, dazomet)2021-04-14v4No1 / 875
479amnoncommon rhizosphere, united states of america, state of california, ph 6-7, ceanothus jepsonii2019-02-05v4No1 / 900
206amnoncommon in dust storm air from israel particles <10um size (common israel, air, size < 10um, dust, dust storm)2017-10-04v4No1 / 902
801sheryoCommon in soybean and corn agriculture fields at depth 15-30cm, Iowa USA (common ph 7.4, depth (soil) 15-30cm, united states, nicollet soil series, glycine max, zea mays, ames, des moines, iowa, agricultural field, soil)2021-06-15v4No1 / 905
103amnoncommon particles, river, united states of america, mississippi river, fresh water, aquatic biome2017-04-05v4No1 / 909
103amnoncommon river, united states of america, mississippi river, fresh water, aquatic biome, free floating2017-04-05v4No1 / 909
632amnoncommon caecum, cecal content, adult, united states of america, state of texas, research facility, horse, equus caballus2020-06-10v4No1 / 914
359amnoncommon soil, topsoil, depth (soil) 0-10cm, guangdong province, subtropical broadleaf forest biome, china, forest ecosystem, woodland area2018-08-19v4No1 / 935
767sheryoCommon in soil planted with Chrysanthemum, amended with soil fumigant 'Dazomet' in Nanjing China (common nanjing county, china, chrysanthemum, chrysanthemum morifolium ramat., ph 6.9, soil, soil fumigation, dazomet)2021-04-14v4No1 / 946
821sheryoCommon in soil of continuous corn field at 25-50cm depth, Michigan USA (common depth (soil) 25-50cm, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, continuous corn, corn, soil)2021-07-28v4No1 / 963
624sheryoCommon in ryegrass rhizosphere soil after 30-40 days (common days 30-40, rhizosphere, ryegrass, ph 7-8, 10 cm depth, soil, jiangsu province, china)2020-05-11v4No1 / 966
821sheryoCommon in soil of restored prairie at 25-50cm depth, Michigan USA (common depth (soil) 25-50cm, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-07-28v4No1 / 968
821sheryoCommon in soil of switchgrass field at 25-50cm depth, Michigan USA (common depth (soil) 25-50cm, kellogg biological station, mesic type hapludalf, kalamazoo loam, panicum virgatum, state of michigan, soil, united states of america)2021-08-03v4No1 / 974
821sheryoCommon in soil of switchgrass field at 25-50cm depth, Michigan USA (common panicum virgatum, depth (soil) 25-50cm, kellogg biological station, mesic type hapludalf, kalamazoo loam, state of michigan, soil, united states of america)2021-08-03v4No1 / 974
809amnoncommon dendrobium moniliforme, lu'an city prefecture, flowerpot, research facility, greenhouse, rhizosphere, china2021-06-20v4No1 / 1002
479amnoncommon rhizosphere, united states of america, state of california, heteromeles arbutifolia, ph 6-72019-02-05v4No1 / 1006
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014
624sheryocommon in ryegrass rhizosphere soil amended with biochar after 30-40 days (common china, jiangsu province, soil, 10 cm depth, ph 7-8, ryegrass, rhizosphere, days 30-40, biochar)2020-05-11v4No1 / 1017
83amnon high in diet control normal diet compared to restricted diet in bos taurus rumen holstein-friesian bull ireland 2017-03-05v4No1 / 1023
406amnoncommon feces, zoological garden, hippotragus niger, sable antelope, french republic2018-11-21v4No1 / 1075
252amnoncommon in river rock biofilm (common biofilm, kingdom of spain, biofilm, river, rock, epilithic)2017-11-22v4No1 / 1081
478amnoncommon farm, shrimp farm, sediment, china2019-02-19v4No1 / 1085
905amnon high in ileum jejunum compared to feces colon caecum in western australia sheep age 1 year australia ovis aries research facility 2022-05-18v3No1 / 1092
454amnon high in wild compared to captive in elaphurus davidianus pere deer deer feces china 2019-01-10v4No1 / 1094
767sheryocommon in soil planted with Chrysanthemum, fertilized with bio-organic fertilizer, amended with soil fumigant 'Dazomet' and deep plough in Nanjing China (common dazomet, soil fumigation, soil, ph 6.9, chrysanthemum morifolium ramat., chrysanthemum, china, nanjing county, bio-organic fertilizer, compost biofilter, paenibacillus polymyxa, paenibacillus, compost soil, pig manure, conventional tillage, deep plough)2021-04-18v4No1 / 1109
93amnoncommon in marine sediment near the shore in hawaii (common hawaii, shore, marine sediment)2017-03-12v4No1 / 1151
571amnoncommon depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, spartina alterniflora, hainan autonomous prefecture, danzhou xinyinggang nature reserve2019-12-16v4No1 / 1169
266amnon high in leaf compared to root in brassicaceae boechera stricta plant united states of america state of idaho 2017-12-19v4No1 / 1175
252amnoncommon in river sand biofilm (common biofilm, river, biofilm, kingdom of spain, sand)2017-11-22v4No1 / 1181
801sheryoCommon at depth 0-15cm in corn and soybean agriculture fields, Iowa USA (common subsurface drainage, ph 6.2, depth (soil) 0-15cm, glycine max, kelley, nicollet soil series, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 1202
571amnoncommon depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, hainan autonomous prefecture, danzhou xinyinggang nature reserve, mangrove, rhizophora stylosa2019-12-16v4No1 / 1210
801sheryoCommon in soybean and corn agriculture fields at depth 0-15cm, Iowa USA (common united states, ph 7.5, nicollet soil series, depth (soil) 0-15cm, glycine max, zea mays, ames, des moines, iowa, agricultural field, soil)2021-06-15v4No1 / 1226
821sheryoCommon in soil of restored prairie at 10-25cm depth, Michigan USA (common depth (soil) 10-25cm, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-07-28v4No1 / 1241
649amnon high in colon compared to jejunum duodenum in lamb age 6 weeks research facility new zealand ovis aries sheep 2020-09-07v3No1 / 1261
821sheryoCommon in soil of restored prairie at 0-10cm depth, Michigan USA (common ph 6.5, depth (soil) 0-10cm, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-07-28v4No1 / 1291
223amnoncommon ocean, sediment, east china sea, marine sediment, china2017-10-26v4No1 / 1311
863amnon high in yuzhong county xinglong mountain national nature reserve moschus chrysogaster alpine musk deer compared to moschus berezovskii qilian county forest musk deer in china deer captive farm feces 2022-01-28v4No1 / 1311
783sheryocommon in desert soil in mongolia without water addition treatment (common no water addition, ambient precipitation, ph 7.85, luvic gypsisols, cambic arenosols, china, mongolia, dengkou county, ulan buh desert, bajada, sandy desert, soil)2021-05-11v4No1 / 1324
571amnoncommon depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, mangrove, kandelia candel, hainan autonomous prefecture, dongzhaigang national nature reserve2019-12-16v4No1 / 1351
809amnoncommon dendrobium huoshanense, lu'an city prefecture, flowerpot, research facility, greenhouse, rhizosphere, china2021-06-20v4No1 / 1356
821sheryoCommon in soil of miscanthus field at 10-25cm depth, Michigan USA (common depth (soil) 10-25cm, miscanthus, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-08-02v4No1 / 1377
821sheryoCommon in soil of switchgrass field at 10-25cm depth, Michigan USA (common depth (soil) 10-25cm, kellogg biological station, mesic type hapludalf, kalamazoo loam, panicum virgatum, state of michigan, soil, united states of america)2021-08-02v4No1 / 1387
40amnoncommon soil, field soil, nicotiana tabacum, rhizosphere, china2016-12-09v4No1 / 1420
571amnoncommon depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, hainan autonomous prefecture, dongzhaigang national nature reserve, mudflat2019-12-16v4No1 / 1422
916amnon high in farm1 compared to farm2 in rabbit age 2 months kingdom of spain oryctolagus cuniculus caecum research facility 2022-07-04v4No1 / 1423
571amnoncommon depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, zhejiang province, futian national nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 1435
571amnoncommon depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, guangdong province, leizhou nature reserve, spartina alterniflora2019-12-16v4No1 / 1437
76amnoncommon in seleniferous soil (common soil, rhizosphere, united states of america, selenium, seleniferous, woodland area)2017-02-28v4No1 / 1438
271amnoncommon depth (soil) 0-20cm, rhizosphere, glycine max, soybean, china2018-01-09v4No1 / 1459
571amnoncommon depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, guangdong province, leizhou nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 1523
515amnon high in detritivorous beetle bulgaria compared to herbivorous beetle poland in whole body beetle 2019-04-19v4No1 / 1543
571amnoncommon depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, zhejiang province, futian national nature reserve, mudflat2019-12-16v4No1 / 1587
571amnoncommon depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, guangdong province, shenzhen futian national nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 1593
571amnoncommon depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, mangrove, kandelia candel, ximendao national marine reserve, zhejiang province2019-12-16v4No1 / 1636
571amnoncommon depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, mudflat, guangdong province, shenzhen futian national nature reserve2019-12-16v4No1 / 1649
821sheryoCommon in soil of continuous corn field at 10-25cm depth, Michigan USA (common depth (soil) 10-25cm, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, continuous corn, corn, soil)2021-07-28v4No1 / 1649
824sheryoCommon in soil after 27-35 years of grazing exclusion at 0-10cm depth, Ningxia china (common yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, 27-35 years of grazing exclusion, grazing exclusion, china, depth (soil) 0-10cm, soil)2021-08-08v4No1 / 1659
571amnoncommon depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, ximendao national marine reserve, zhejiang province, spartina alterniflora2019-12-16v4No1 / 1668
571amnoncommon depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, zhejiang province, spartina alterniflora, futian national nature reserve2019-12-16v4No1 / 1747
304amnoncommon united states of america, state of california, beach, pacific ocean, sand, santa cruz province2018-03-12v4No1 / 1838
155amnoncommon in soil tightly bound to wheat root (common triticum aestivum, wheat, soil, root, china)2017-07-02v4No1 / 1977
821sheryoCommon in soil of switchgrass field at 0-10cm depth, Michigan USA (common kellogg biological station, mesic type hapludalf, kalamazoo loam, panicum virgatum, depth (soil) 0-10cm, state of michigan, soil, united states of america)2021-08-02v4No1 / 2067
175amnoncommon in heavy metal contaminated soils in china (common soil, heavy metal, ph 7-9, china)2017-07-29v4No1 / 2133
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>6, ph<7, china2018-02-11v4No1 / 2223
296amnoncommon in wheat field soil (common soil, north china plain, depth 5cm, agricultural feature, wheat, winter, china)2018-02-11v4No1 / 2341
155amnoncommon in soil loosely bound to wheat root (common triticum aestivum, wheat, soil, rhizosphere, china)2017-07-02v4No1 / 2425
748amnon high in feces compared to ruminal fluid rumen in united states of america state of mississippi research facility female organism bos taurus cow 2021-03-10v4No1 / 2467
155amnoncommon in bulk soil in wheat field (common triticum aestivum, wheat, soil, bulk soil, china)2017-07-02v4No1 / 2594
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>8, china2018-02-11v4No1 / 2646
265amnon high in soil compared to soilwater water in canada province of quebec 2017-12-11v4No1 / 2715
271amnoncommon depth (soil) 0-20cm, soil, china2018-01-09v4No1 / 2856
84amnoncommon depth 20cm, soil, temperate grassland biome, fen, peat soil, flooded grassland biome, united kingdom2017-03-06v4No1 / 2866
84amnoncommon depth 5cm, soil, temperate grassland biome, fen, peat soil, flooded grassland biome, united kingdom2017-03-07v4No1 / 3434
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>5, ph<6, china2018-02-11v4No1 / 3508
837sheryoHigher in soil after 10 years compared to 20 years of reforestation with Black locust trees, shaanxi, China ( high in 10 years compared to 20 years in robinia pseudoacacia reforestation silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 3585
837sheryoHigher in soil after 10 years reforestation with Black locust trees compared to agricultural feild, shaanxi, China ( high in robinia pseudoacacia reforestation 10 years compared to agricultural field wheat zea mays in silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 3932
837sheryoHigher in soil after 30 years compared to 20 years of reforestation with Black locust trees, shaanxi, China ( high in 30 years compared to 20 years in robinia pseudoacacia reforestation silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 3936
271amnon high in soil compared to rhizosphere glycine max soybean in depth (soil) 0-20cm china 2018-01-09v4No1 / 4853
837sheryoHigher in soil after 30 years compared to 10 years of reforestation with Black locust trees, shaanxi, China ( high in 30 years compared to 10 years in robinia pseudoacacia reforestation silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 5245
837sheryoHigher in soil after 30 years reforestation with Black locust trees compared to agricultural feild, shaanxi, China ( high in robinia pseudoacacia reforestation 30 years compared to zea mays triticum aestivum agricultural field in silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 5596
837sheryoHigher in soil after 20 years reforestation with Black locust trees compared agricultural feild, shaanxi, China ( high in robinia pseudoacacia reforestation 20 years compared to triticum aestivum zea mays agricultural field in silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 5661
171amnonlower in roots compared to rhizosphere soil in rice ( high in rhizosphere soil compared to root in united states of america state of california oryza sativa rice )2017-07-25v4No1 / 7628

Problems / suggestions? Please email info AT dbbact DOT org