Search result for sequence:
TACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCTGATACTGGCAAGCTTGAGTCTCGTAGAGGGGGGTAGAATTCCAGG
common ontology terms
term enrichment score
TermScore
feces0.633042
homo sapiens0.504448
united states of america0.374514
adult0.251872
china0.222725
research facility0.193451
mus musculus0.115159
child0.114614
infant0.109689
farm0.106246
mouse0.102285
caecum0.083401
LOWER IN control0.075013
city0.070648
female0.063069
rural community0.061460
soil0.060819
canis lupus familiaris0.060530
kingdom of spain0.058130
obsolete_juvenile stage0.058130
state of california0.057388
gallus gallus0.055980
chicken0.055980
control0.054576
bird0.054019
zoological garden0.051916
skin0.050097
sus scrofa0.048624
pig0.048624
dog0.048234
water0.047337
india0.046476
australia0.045113
colon0.044444
united kingdom0.041367
monkey0.041326
state of michigan0.041269
river0.040764
canada0.039615
diarrhea0.038936
fresh water0.037594
crohn's disease0.036316
rectum0.036316
french republic0.036241
wild0.035851
nepal0.033657
israel0.033488
jiangsu province0.033376
hospital0.031274
duodenum0.031128
larval stage0.031068
rat0.031025
kingdom of norway0.030888
kingdom of denmark0.030888
age0.030835
digestive system0.030246
beetle0.028590
air0.028454
male0.026443
colombia0.026127
hunter gatherer0.026098
broiler chicken0.025873
africa0.025873
texas0.025221
mexico0.023553
depth 0-20cm0.023529
balb/c0.023529
age < 3 years0.023483
biopsy0.023438
ulcerative colitis0.023415
ileum0.023346
detritivorous beetle0.023346
bulgaria0.023346
himalayas0.023346
ocean0.023166
japan0.023144
diet0.023077
whole body0.022814
sea water0.022777
costa rica0.020915
tonsil0.020915
finland0.020860
rattus norvegicus0.020860
nasopharynx0.020806
balkan mountains0.020806
free range chicken0.020806
italy0.020522
rhizosphere0.020412
intestine0.020330
age < 1 year0.018379
amerindian0.018337
venezuela0.018337
wheat0.018337
LOWER IN united states of america0.018320
nasal cavity0.018286
pair of nares0.018253
snake farm0.018253
adula0.018253
ovis aries0.018253
belgium0.018198
Fraction of dbbact annotations with this term covered by the query
TermScore
canada3.500000
male3.000000
diarrhea0.857143
bird0.857143
rural community0.857143
india0.833333
hospital0.833333
age < 1 year0.800000
mexico0.800000
colombia0.800000
united kingdom0.777778
crohn's disease0.777778
rectum0.777778
sinusitis0.750000
hunter gatherer0.750000
monkey0.750000
homosexual0.750000
msm0.750000
small village0.750000
depth 0-20cm0.750000
state of arizona0.750000
balb/c0.750000
feces0.714286
french republic0.714286
state of michigan0.714286
city0.705882
child0.700000
sus scrofa0.666667
pig0.666667
gallus gallus0.666667
chicken0.666667
duodenum0.666667
infant0.666667
age 2 months0.666667
age 2 weeks0.666667
jejunum0.666667
costa rica0.666667
dust0.666667
amerindian0.666667
venezuela0.666667
beetle0.666667
nepal0.666667
filtered 0.2um0.666667
tanzania0.666667
tonsil0.666667
obesity0.666667
sinusoidal space0.666667
paranasal sinus0.666667
cebus capucinus0.666667
white-faced capuchin0.666667
uropygial gland0.666667
nigeria0.666667
anser cygnoides0.666667
age < 3 years0.666667
atlanta0.666667
LOWER IN hindgut0.666667
human contact0.666667
graz city district0.666667
tibet autonomous region0.666667
state of oklahoma0.666667
fish feed0.666667
heterosexual0.666667
msw0.666667
age 5-13 years0.666667
gay0.666667
metabolic syndrome0.666667
hot spring0.666667
geothermal field0.666667
LOWER IN rumen0.666667
arm0.666667
seed0.666667
state of texas0.666667
province of quebec0.666667
rex rabbit0.666667
wheat0.666667
homo sapiens0.635220
LOWER IN united states of america0.625000
larval stage0.615385
canis lupus familiaris0.600000
flower0.600000
age 4 weeks0.600000
kingdom of spain0.600000
free floating0.600000
clostridium difficile intestinal infectious disease0.600000
biopsy0.600000
obsolete_juvenile stage0.600000
shelled egg0.600000
colitis0.600000
rat0.583333
adult0.582278
felis catus0.571429
ulcerative colitis0.571429
finland0.571429
woodland area0.571429
rattus norvegicus0.571429
sprague dawley0.571429
state of colorado0.571429
israel0.555556
nasal cavity0.555556
caecum0.545455
Fraction of annotations for the query sequences containing the term
TermScore
feces0.568393
homo sapiens0.418327
united states of america0.292165
adult0.160691
china0.144754
research facility0.120850
mus musculus0.065073
child0.062417
infant0.059761
farm0.059761
mouse0.057105
caecum0.045153
LOWER IN control0.043825
city0.037185
soil0.034529
female0.034529
control0.033201
canis lupus familiaris0.031873
rural community0.031873
state of california0.030544
kingdom of spain0.030544
obsolete_juvenile stage0.030544
gallus gallus0.029216
chicken0.029216
bird0.027888
zoological garden0.027888
skin0.026560
water0.026560
sus scrofa0.025232
pig0.025232
dog0.025232
colon0.023904
india0.023904
australia0.023904
united kingdom0.021248
state of michigan0.021248
river0.021248
monkey0.021248
diarrhea0.019920
fresh water0.019920
canada0.019920
crohn's disease0.018592
french republic0.018592
wild0.018592
rectum0.018592
israel0.017264
nepal0.017264
jiangsu province0.017264
larval stage0.015936
age0.015936
duodenum0.015936
kingdom of norway0.015936
hospital0.015936
kingdom of denmark0.015936
digestive system0.015936
rat0.015936
air0.014608
beetle0.014608
texas0.013280
broiler chicken0.013280
hunter gatherer0.013280
colombia0.013280
africa0.013280
male0.013280
ileum0.011952
japan0.011952
ocean0.011952
diet0.011952
whole body0.011952
detritivorous beetle0.011952
bulgaria0.011952
mexico0.011952
himalayas0.011952
biopsy0.011952
ulcerative colitis0.011952
depth 0-20cm0.011952
age < 3 years0.011952
sea water0.011952
balb/c0.011952
intestine0.010624
nasopharynx0.010624
costa rica0.010624
balkan mountains0.010624
tonsil0.010624
italy0.010624
finland0.010624
free range chicken0.010624
rattus norvegicus0.010624
rhizosphere0.010624
pair of nares0.009296
belgium0.009296
age < 1 year0.009296
stomach0.009296
snake0.009296
snake farm0.009296
adula0.009296
hunan province0.009296
amerindian0.009296
venezuela0.009296
c57bl/60.009296
Exp. ID User ID Description Date Region Flag Sequences
117amnonlower in sox10 mutant fish with high neutrophil count ( high in low neutrophils control compared to high neutrophils neutrophil hirschprung disease in zebra fish danio rerio research facility larval stage united states of america intestine )2017-04-10v4No1 / 1
207amnonhigher in people hospitalized with diarrhea compared to healthy controls ( high in diarrhea compared to control in pathogen homo sapiens israel feces )2017-10-05v4No1 / 1
256amnonhigher in illeum compared to other gi tract locations in pigs ( high in ileum compared to duodenum jejunum caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 1
234amnoncandidate contaminant (high in blank) (contamination)2017-11-07v4No1 / 2
16amnon high in diarrhea compared to control in felis catus state of california feces 2016-11-08v4No1 / 3
127amnonhigh in young (0-3 days) compared to old (28 day) chickens ( high in age young age compared to old age in gallus gallus chicken united states of america caecum )2017-04-14v4No1 / 3
399amnon high in crohn's disease compared to ulcerative colitis in feces united states of america homo sapiens 2018-11-16v4No1 / 3
456amnonreagent contaminant (high in blanks) in mouse nasopharynx study (contamination)2019-01-10v4No1 / 3
567amnon high in sinusitis chronic rhinosinusitis compared to control in pair of nares anterior naris belgium adult homo sapiens 2019-12-05v4No1 / 3
320amnonlower in CD patients with remission ( high in crohn's disease compared to remission in homo sapiens feces adult )2018-04-19v4No1 / 4
440amnoncommon galapagos islands, feces, bird, finch, geospiza fortis, medium ground finch2019-01-06v4No1 / 4
301amnon high in duodenum ileum compared to colon rectum in canis lupus familiaris dog united states of america 2018-03-05v4No1 / 5
49amnonincreases during sample storage in giraffe feces (other giraffa camelopardalis, feces)2017-01-19v4No1 / 6
108amnonhighfreq research facility, texas, united states of america, colon, quail, coturnix coturnix2017-04-07v4No1 / 6
347amnonhighfreq kingdom of norway, svalbard archipelago, permafrost, soil, depth 100-150cm2018-07-15v4No1 / 6
207amnoncommon in people hospitalized with diarrhea (common homo sapiens, israel, feces, diarrhea)2017-10-05v4No1 / 7
56amnonhighfreq nicotiana glauca, israel, flower, nectar2017-01-30v4No1 / 8
262amnonhighfreq tick, ixodes scapularis, larval stage, body proper, research facility2017-12-10v4No1 / 8
332amnoncommon homo sapiens, infant, vellore district, city, age 2 months, india2018-05-14v4No1 / 8
406amnonhighfreq feces, equus przewalskii, przewalski horse, zoological garden, united states of america2018-11-21v4No1 / 8
406amnonhighfreq feces, zoological garden, french republic, connochaetes taurinus, blue wildebeest2018-11-21v4No1 / 8
406amnonhighfreq feces, zoological garden, united states of america, myrmecophaga tridactyla, giant anteater2018-11-21v4No1 / 8
440amnoncommon galapagos islands, feces, bird, finch, geospiza difficilis, sharp-beaked ground finch2019-01-06v4No1 / 8
454amnonhighfreq feces, elaphurus davidianus, pere deer, deer, wild, china2019-01-10v4No1 / 8
516amnoncommon homo sapiens, united states of america, state of ohio, adult, urine2019-05-29v4No1 / 8
92amnoncommon air, japan2017-03-09v4No1 / 9
301amnonhighfreq canis lupus familiaris, dog, united states of america, duodenum2018-03-05v4No1 / 9
332amnonhighfreq homo sapiens, infant, vellore district, city, age 2 months, india2018-05-14v4No1 / 9
391amnoncommon feces, infant, age < 1 year, hospital, china, diarrhea2018-11-04v4No1 / 9
399amnonhighfreq feces, united states of america, mustela putorius furo, ferret2018-11-16v4No1 / 9
423amnonhighfreq bank vole, myodes glareolus, ukraine, skin2018-12-05v4No1 / 9
497amnonhighfreq chicken, gallus gallus, broiler chicken, austria, farm, feces, age 2 weeks2019-03-04v4No1 / 9
10amnon high in female compared to male in homo sapiens feces toronto 2016-10-27v4No1 / 10
71amnonhighfreq liolaemus ruibali, small intestine, argentina, research facility2017-02-25v4No1 / 10
78amnonhighfreq nanger granti, kenya, feces, tropical grassland biome, gazelle2017-03-01v4No1 / 10
117amnonhighfreq zebra fish, danio rerio, research facility, larval stage, united states of america, intestine2017-04-10v4No1 / 10
152amnonhigh in blanks compares to dust/nose samples (contamination)2017-05-04v4No1 / 10
177amnonblooming bacteria (grows in storage at room temp.) (contamination)2017-07-30v4No1 / 10
234amnoncommon homo sapiens, lung, united states of america2017-11-07v4No1 / 10
256amnonhighfreq sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 10
408amnoncommon ant, costa rica, united states of america, pseudomyrmex elongatus, stomach2018-11-22v4No1 / 10
497amnonhighfreq chicken, gallus gallus, broiler chicken, austria, farm, feces, age 4 weeks2019-03-04v4No1 / 10
530amnonhighfreq snake, feces, snake farm, farm, adula, hunan province, elaphe carinata, king ratsnake, china2019-07-21v4No1 / 10
544amnonhighfreq vaccinium macrocarpon, american cranberry, united states of america, commonwealth of massachusetts, botanical fruit food product2019-08-04v4No1 / 10
206amnonhigh freq. in air from israel particles <10um size (highfreq air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 11
371amnonhighfreq feces, homo sapiens, hunter gatherer, amerindian, venezuela2018-09-06v4No1 / 11
391amnonhighfreq feces, infant, age < 1 year, hospital, china, diarrhea2018-11-04v4No1 / 11
406amnonhighfreq feces, zoological garden, french republic, antidorcas marsupialis, springbok2018-11-21v4No1 / 11
418amnonhighfreq coral, ocean, pocillopora damicornis, mucus2018-12-02v4No1 / 11
513amnonhighfreq waste water, hospital, city, xinxiang city prefecture, china2019-03-25v4No1 / 11
558amnonhighfreq bird, centrocercus urophasianus, greater sage-grouse, united states of america, state of wyoming, crop2019-09-20v4No1 / 11
71amnonhighfreq liolaemus ruibali, argentina, research facility, stomach2017-02-25v4No1 / 12
89amnonhighfreq junco hyemalis, commonwealth of virginia, songbird, cloaca2017-03-08v4No1 / 12
161amnonhigh freq. in barn swallows in colorado (highfreq hirundo rustica, feces, united states of america, colorado, barn swallow)2017-07-12v4No1 / 12
206amnonhigh freq. in dust storm air from israel particles <10um size (highfreq israel, air, size < 10um, dust, dust storm)2017-10-04v4No1 / 12
231amnonhigh freq. in dog genitalia (highfreq dog, canis lupus familiaris, united states of america, reproductive system, reproductive organ, genitalia)2017-11-02v4No1 / 12
301amnonhighfreq canis lupus familiaris, dog, united states of america, ileum2018-03-05v4No1 / 12
381amnoncommon bird, isla de salvora, kingdom of spain, age 8 days, feces, larus michahellis, gull2018-10-22v4No1 / 12
408amnonhighfreq ant, cephalotes, costa rica, united states of america, larval stage2018-11-22v4No1 / 12
440amnonhighfreq galapagos islands, feces, bird, finch, geospiza difficilis, sharp-beaked ground finch2019-01-06v4No1 / 12
495amnonhighfreq gallus gallus, chicken, caecum, broiler chicken, age 3 days, kingdom of spain, farm2019-03-03v4No1 / 12
48amnonhighfreq homo sapiens, kingdom of denmark, infant, hypopharynx2017-01-19v4No1 / 13
210amnonhigher in bangladeshi diet compared to american diet in mice with american human FMT ( high in bangladesh diet diet compared to american diet in feces research facility mus musculus mouse humanized mouse )2017-10-21v4No1 / 13
241amnonhigher in babies age <1 year compared to age 1-3 years ( high in age < 1 year age compared to age 1-3 years in homo sapiens feces infant )2017-11-13v4No1 / 13
243amnonhighfreq beetle, anoplophora glabripennis, digestive system, united states of america2017-11-15v4No1 / 13
389amnonhighfreq pig, sus scrofa, vagina, united states of america, state of michigan, farm2018-11-04v4No1 / 13
405amnonhighfreq mouse, mus musculus, research facility, feces, united states of america, swiss webster, ketogenic diet2018-11-20v4No1 / 13
515amnonhighfreq whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, onthophagus similis2019-04-18v4No1 / 13
516amnonhighfreq homo sapiens, united states of america, state of ohio, adult, urine2019-05-29v4No1 / 13
530amnonhighfreq snake, feces, snake farm, farm, adula, hunan province, naja atra, chinese cobra, china2019-07-21v4No1 / 13
534amnonhighfreq river, water, fresh water, depth 10 cm, koshi river, tributary, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 13
129amnonfound INSIDE leaves of cactus (common mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, leaf, leaf interior)2017-04-15v4No1 / 14
185amnoncommon in patients with c. diff infection before treatment (common homo sapiens, feces, united states of america, state of minnesota, clostridium difficile intestinal infectious disease)2017-08-20v4No1 / 14
190amnonhighfreq homo sapiens, tanzania, hadza, hunter gatherer, feces2017-09-04v4No1 / 14
232amnoncommon in foot ulcer of diabetic patients (common homo sapiens, skin, australia, foot, wound, ulcer, diabetes mellitus)2017-11-05v4No1 / 14
290amnon high in city compared to rural community small village in homo sapiens feces adult china 2018-02-01v4No1 / 14
302amnonhigh freq. in feces of Cockatiel pet birds (highfreq bird, mexico, feces, pet, nymphicus hollandicus, cockatiel)2018-03-05v4No1 / 14
389amnonhighfreq pig, sus scrofa, united states of america, state of michigan, farm, tonsil, age 8 hours2018-11-04v4No1 / 14
400amnonhigh freq. in karen (burma) females from thailand (highfreq homo sapiens, feces, adult, female, thailand, karen, myanmar)2018-11-18v4No1 / 14
404amnon high in high bmi obesity compared to lean body mass low bmi in homo sapiens feces adult colombia city 2018-11-20v4No1 / 14
406amnonhighfreq feces, zoological garden, united states of america, giraffa camelopardalis, giraffe2018-11-21v4No1 / 14
438amnonhighfreq feces, homo sapiens, age >94, adult, jiangsu province, china2018-12-30v4No1 / 14
477amnonhighfreq homo sapiens, feces, adult, nepal, himalayas, rural community, tharu, agrarian2019-01-28v4No1 / 14
499amnonhighfreq ranatra, water stick-insect, brazil, pond, digestive system, intestine2019-03-05v4No1 / 14
515amnonhighfreq whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, onthophagus ruficapillus2019-04-18v4No1 / 14
530amnonhighfreq snake, feces, snake farm, farm, adula, hunan province, ptyas mucosa, oriental ratsnake, china2019-07-21v4No1 / 14
42amnonhigher on stressed mice compared to control in c57bl tcr-b deficient mice ( high in stress compared to control in c57bl/6 mus musculus research facility feces japan )2016-12-10v4No1 / 15
48amnoncommon homo sapiens, kingdom of denmark, infant, hypopharynx2017-01-19v4No1 / 15
51amnonhighfreq feces, homo sapiens, united states of america2017-01-19v4No1 / 15
159amnonhighfreq siganidae, rabbitfish, hindgut, australia2017-07-06v4No1 / 15
228amnonhigh freq. in sinus brush of sinusitis patients (highfreq homo sapiens, mucosa, sinusoidal space, paranasal sinus, united states of america, sinusitis)2017-10-31v4No1 / 15
339amnonhighfreq homo sapiens, feces, infant, age < 1 year, india2018-05-24v4No1 / 15
405amnonhighfreq mouse, mus musculus, research facility, feces, united states of america, swiss webster, control diet2018-11-20v4No1 / 15
409amnonhighfreq homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 15
425amnonhighfreq homo sapiens, feces, africa, child, central african republic, bangui2018-12-08v4No1 / 15
425amnonhighfreq homo sapiens, feces, africa, child, madagascar, antananarivo2018-12-08v4No1 / 15
502amnonhighfreq homo sapiens, feces, adult, united states of america, schizophrenia2019-03-12v4No1 / 15
15amnonhighfreq namibia, feces, canis mesomelas2016-11-08v4No1 / 16
19amnonhigh freq in biopsies of children (IBD study) (highfreq rectum, terminal ileum, sigmoid colon, caecum, colon, biopsy, children, homo sapiens, united states of america)2016-11-14v4No1 / 16
46amnonsmj: higher in female mice feces treated with antibiotics ( high in antibiotic pulsed antibiotic treatment, macrolide tylosin tartrate compared to control in feces mus musculoides united states of america nyulmc nod/shiltj (no. 001976, jackson labs) research facility female )2017-01-12v4No1 / 16
49amnonhighfreq giraffa camelopardalis, feces2017-01-19v4No1 / 16
94amnoncommon homo sapiens, clostridium difficile intestinal infectious disease, feces, state of michigan, diarrhea2017-03-12v4No1 / 16
150amnonlow in healthy dogs compared to EPI dogs recieving enzyme supplementation ( high in enzyme supplementation exocrine pancreatic insufficiency compared to control in canis lupus familiaris dog feces united states of america )2017-04-26v4No1 / 16
229amnonhigh freq. in sinuses from chronic rhinosinositis patients (highfreq homo sapiens, paranasal sinus, sinusoidal space, australia, sinusitis)2017-10-31v4No1 / 16
273amnoncommon feces, homo sapiens, kingdom of denmark, infant, age one month2018-01-14v4No1 / 16
310amnonhighfreq homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 16
352amnonhighfreq homo sapiens, feces, new delhi, india2018-07-30v4No1 / 16
363amnonhighfreq ovis aries, age 30 days, obsolete_juvenile stage, italy, dairy, caecum, colon, rectum2018-08-29v4No1 / 16
365amnonhighfreq homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 16
395amnonhigher in kids with ibd compared to healthy donors ( high in child ulcerative colitis inflammatory bowel disease crohn's disease compared to control in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 16
407amnonhighfreq costa rica, feces, monkey, cebus capucinus, white-faced capuchin, wild2018-11-21v4No1 / 16
440amnonhighfreq galapagos islands, feces, bird, finch, geospiza fortis, medium ground finch2019-01-06v4No1 / 16
448amnonhighfreq equus caballus, horse, feces, farm, equine grass sickness, disease, united kingdom2019-01-08v4No1 / 16
567amnonhighfreq nasopharynx, homo sapiens, adult, belgium2019-12-05v4No1 / 16
159amnonhighfreq siganidae, rabbitfish, australia, midgut2017-07-06v4No1 / 17
215amnonhigher in people with Roux-en-Y gastric bypass compared to controls ( high in gastric bypass compared to control in homo sapiens feces united states of america )2017-10-23v4No1 / 17
227amnonhigh freq. in baby nasopharynx age <= 1 day (highfreq homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, age <= 24 hours)2017-10-30v4No1 / 17
237amnonhighfreq bird, oceanodroma leucorhoa, seabird, canada, bon portage island, uropygial gland2017-11-07v4No1 / 17
337amnonhigh freq. in feces of house mice from new york city (highfreq mus musculus, house mice, mouse, new york city, united states of america, city)2018-05-18v4No1 / 17
352amnonhigh freq. in duodenal biopsies (highfreq homo sapiens, new delhi, duodenum, small intestine, india)2018-07-30v4No1 / 17
365amnonhighfreq homo sapiens, feces, child, obsolete_juvenile stage, nigeria2018-08-30v4No1 / 17
368amnonhighfreq feces, homo sapiens, commonwealth of virginia, united states of america, adult, systemic lupus erythematosus2018-09-03v4No1 / 17
381amnonhighfreq bird, isla de salvora, kingdom of spain, age 8 days, feces, larus michahellis, gull2018-10-22v4No1 / 17
389amnonhighfreq pig, sus scrofa, united states of america, state of michigan, farm, skin, nipple, adult2018-11-04v4No1 / 17
406amnonhighfreq feces, zoological garden, south africa, aardvark, orycteropus afer2018-11-21v4No1 / 17
428amnonhighfreq homo sapiens, adult, feces, nanchang city prefecture, pancreatitis, acute pancreatitis, china2018-12-09v4No1 / 17
36amnonhighfreq homo sapiens, feces, sichuan province2016-12-06v4No1 / 18
207amnonhigh freq. in people hospitalized with diarrhea (highfreq homo sapiens, israel, feces, diarrhea)2017-10-05v4No1 / 18
215amnonhighfreq homo sapiens, feces, united states of america2017-10-23v4No1 / 18
273amnonhighfreq feces, homo sapiens, kingdom of denmark, infant, age one month2018-01-14v4No1 / 18
284amnonhighfreq homo sapiens, female, feces, state of california, infant, age 6 months2018-01-27v4No1 / 18
339amnonhighfreq homo sapiens, feces, adult, india2018-05-24v4No1 / 18
387amnonhigh freq. in feces of wild brown bear (highfreq ursus arctos, brown bear, feces, sweden, wild)2018-11-03v4No1 / 18
440amnonhighfreq galapagos islands, feces, bird, finch, geospiza fuliginosa, small ground finch2019-01-06v4No1 / 18
477amnonhighfreq homo sapiens, feces, adult, nepal, himalayas, rural community, forager, chepang2019-01-28v4No1 / 18
488amnonhighfreq canis lupus familiaris, dog, feces, italy, lymphoma2019-02-25v4No1 / 18
563amnonhighfreq control, homosexual, msm, male, united states of america, rectal swab, feces, homo sapiens2019-11-18v4No1 / 18
567amnon high in sinusitis chronic rhinosinusitis compared to control in nasopharynx belgium adult homo sapiens 2019-12-05v4No1 / 18
59amnoncommon geniotrigona thoracica, digestive system2017-02-03v4No1 / 19
60amnonhighfreq anser cygnoides, feces, china2017-02-03v4No1 / 19
121amnonhighfreq homo sapiens, feces, bangladesh, adult2017-04-13v4No1 / 19
276amnonhighfreq feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 19
292amnonhighfreq homo sapiens, adult, feces, control, china2018-02-05v4No1 / 19
301amnonhighfreq canis lupus familiaris, dog, united states of america, colon2018-03-05v4No1 / 19
330amnon high in infant age 1 year compared to adult age 30-40 in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 19
339amnoncommon homo sapiens, feces, infant, age < 1 year, india2018-05-24v4No1 / 19
404amnonhighfreq homo sapiens, feces, colombia, city, adult2018-11-20v4No1 / 19
438amnonhighfreq homo sapiens, feces, age 19-24, china2018-12-30v4No1 / 19
438amnonhighfreq feces, homo sapiens, age 60-79, adult, jiangsu province, china2018-12-30v4No1 / 19
449amnonhighfreq homo sapiens, feces, colombia2019-01-09v4No1 / 19
455amnonhighfreq homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 19
477amnonhighfreq homo sapiens, feces, himalayas, nepal, rural community, raute2019-01-29v4No1 / 19
482amnonhighfreq homo sapiens, feces, colombia, medellin metropolitan area, child, daycare, age 1-5 years2019-02-12v4No1 / 19
489amnonhighfreq feces, anal swab, myotis myotis, bat, greater mouse eared bat, french republic2019-02-25v4No1 / 19
495amnonhighfreq gallus gallus, chicken, caecum, broiler chicken, kingdom of spain, farm, age 4 weeks2019-03-03v4No1 / 19
516amnonhighfreq homo sapiens, feces, united states of america, state of ohio, adult2019-05-29v4No1 / 19
558amnonhighfreq bird, centrocercus urophasianus, greater sage-grouse, united states of america, state of wyoming, colon2019-09-20v4No1 / 19
567amnonhighfreq ethmoid sinus, maxillary sinus, homo sapiens, adult, belgium2019-12-05v4No1 / 19
45amnonhigh freq. in feces babies <2 years in india (highfreq homo sapiens, feces, infant, india)2016-12-19v4No1 / 20
59amnoncommon sundatrigona moorei, digestive system2017-02-03v4No1 / 20
197amnonhighfreq feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, finland2017-09-12v4No1 / 20
227amnoncommon in baby nasopharynx age <= 1 day (common homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, age <= 24 hours)2017-10-30v4No1 / 20
238amnonhighfreq homo sapiens, feces, colombia2017-11-07v4No1 / 20
271amnoncommon depth 0-20cm, glycine max, soybean, root structure, root, root nodule, china2018-01-09v4No1 / 20
273amnoncommon feces, homo sapiens, kingdom of denmark, infant, age one week2018-01-14v4No1 / 20
273amnonhighfreq feces, homo sapiens, kingdom of denmark, infant, age one week2018-01-14v4No1 / 20
273amnonhighfreq feces, homo sapiens, kingdom of denmark, infant, age one year2018-01-14v4No1 / 20
284amnoncommon homo sapiens, female, feces, state of california, infant, age 2 months2018-01-27v4No1 / 20
284amnonhighfreq homo sapiens, female, feces, state of california, infant, age 2 months2018-01-27v4No1 / 20
286amnonhigh freq. in feces of individuals with kidney stones (highfreq homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, nephrolithiasis, china)2018-01-27v4No1 / 20
292amnonhighfreq homo sapiens, adult, feces, ulcerative colitis, china2018-02-05v4No1 / 20
292amnonhighfreq homo sapiens, adult, feces, crohn's disease, china2018-02-05v4No1 / 20
333amnonhigh freq. in healthy controls feces (highfreq homo sapiens, feces, guangzhou city prefecture, adult, control, china)2018-05-15v4No1 / 20
390amnonhighfreq homo sapiens, feces, australia, hospital, salmonella gastroenteritis, diarrhea2018-11-04v4No1 / 20
390amnonhighfreq homo sapiens, feces, australia, hospital, diarrhea2018-11-04v4No1 / 20
394amnonhighfreq homo sapiens, feces, adult, united states of america, state of california, ulcerative colitis2018-11-06v4No1 / 20
399amnoncommon feces, united states of america, mustela putorius furo, ferret2018-11-16v4No1 / 20
409amnonhighfreq homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v4No1 / 20
477amnonhighfreq homo sapiens, feces, himalayas, nepal, rural community, raji2019-01-29v4No1 / 20
495amnonhighfreq gallus gallus, chicken, caecum, kingdom of spain, farm, free range chicken, age 4 days2019-03-03v4No1 / 20
535amnonhigh freq. in adult vaginal samples with ICC (highfreq homo sapiens, vagina, female, adult, united states of america, phoenix, state of arizona, invasive carcinoma, invasive cervical carcinoma, cervical carcinoma)2019-07-25v4No1 / 20
563amnonhighfreq hiv infection, homosexual, msm, male, united states of america, rectal swab, feces, homo sapiens2019-11-18v4No1 / 20
15amnonhighfreq acinonyx jubatus, namibia, feces2016-11-08v4No1 / 21
24amnonappears on transition to cow milk ( high in mammalian milk beverage compared to breast milk in homo sapiens feces infant )2016-12-01v4No1 / 21
47amnonsmj: higher in bullied, non-immunized mouse ( high in stress: chronic subordinate colony housing compared to no stress: single housed control in feces united states of america mus musculus male mouse strain c57bc/6ncrl research facility no immunization: vehicle as control )2017-01-13v4No1 / 21
58amnoncommon homo sapiens, new york city, skin of face, skin under eyes2017-02-02v4No1 / 21
72amnonhighfreq canis lupus familiaris, feces, united states of america, iowa2017-02-25v4No1 / 21
108amnonhighfreq research facility, texas, united states of america, caecum, mus musculus, mouse2017-04-07v4No1 / 21
108amnonhighfreq research facility, texas, united states of america, caecum, coturnix coturnix, common quail2017-04-07v4No1 / 21
122amnonhighfreq homo sapiens, feces, united kingdom2017-04-13v4No1 / 21
240amnonhigh freq. in infants age <3 years (highfreq homo sapiens, feces, finland, infant, age < 3 years)2017-11-12v4No1 / 21
241amnonhigh freq. in babies age < 3 years in finland (highfreq homo sapiens, feces, infant, age < 3 years, finland)2017-11-13v4No1 / 21
249amnonhighfreq homo sapiens, feces, united states of america2017-11-22v4No1 / 21
320amnonhighfreq homo sapiens, feces, adult, crohn's disease2018-04-19v4No1 / 21
350amnonhigh freq. in feces of white faced capuchin from costa rica rain forest (highfreq monkey, cebus capucinus, feces, costa rica, white-faced capuchin, woodland area)2018-07-30v4No1 / 21
390amnonhighfreq homo sapiens, feces, clostridium difficile intestinal infectious disease, australia, hospital, diarrhea2018-11-04v4No1 / 21
429amnonhighfreq rat, rattus norvegicus, dahl salt-sensitive, feces, israel, research facility, salt rich diet, salt2018-12-13v4No1 / 21
497amnoncommon chicken, gallus gallus, broiler chicken, austria, farm, feces, age 4 weeks2019-03-04v4No1 / 21
69amnonhighfreq canis lupus familiaris, beagle dog, united states of america, research facility, feces2017-02-21v4No1 / 22
94amnonhighfreq homo sapiens, clostridium difficile intestinal infectious disease, feces, state of michigan, diarrhea2017-03-12v4No1 / 22
185amnonhigh freq. in patients with c. diff infection before treatment (highfreq homo sapiens, feces, united states of america, state of minnesota, clostridium difficile intestinal infectious disease)2017-08-20v4No1 / 22
284amnonhighfreq homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 22
297amnonhighfreq homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 22
333amnonhigh freq. in stroke patient feces (highfreq homo sapiens, feces, guangzhou city prefecture, adult, stroke, china)2018-05-15v4No1 / 22
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, tonsil, age 8 hours2018-11-04v4No1 / 22
395amnonhighfreq homo sapiens, feces, united states of america, commonwealth of pennsylvania, child, inflammatory bowel disease, crohn's disease, ulcerative colitis2018-11-14v4No1 / 22
399amnoncommon feces, united states of america, zoological garden, state of tennessee, ailurus fulgens, red panda2018-11-16v4No1 / 22
502amnonhighfreq homo sapiens, feces, adult, united states of america, control2019-03-12v4No1 / 22
509amnonhighfreq feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, control2019-03-18v4No1 / 22
53amnonhighfreq homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 23
58amnoncommon homo sapiens, new york city, contact lens2017-02-02v4No1 / 23
197amnonhighfreq feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 23
241amnonhigh freq. in babies age < 3 years in russia (highfreq homo sapiens, feces, infant, russia, age < 3 years)2017-11-13v4No1 / 23
241amnoncommon in babies age < 3 years in finland (common homo sapiens, feces, infant, age < 3 years, finland)2017-11-13v4No1 / 23
241amnonhigh freq. in babies age < 3 years in estonia (highfreq homo sapiens, feces, infant, age < 3 years, estonia)2017-11-13v4No1 / 23
284amnonhighfreq homo sapiens, female, feces, state of california, infant, age 1 year2018-01-27v4No1 / 23
312amnonhighfreq feces, homo sapiens, french republic, adult, spondyloarthritis, spondylitis2018-04-09v4No1 / 23
394amnonhighfreq homo sapiens, feces, adult, united states of america, state of california, control2018-11-06v4No1 / 23
399amnonhighfreq feces, united states of america, zoological garden, panthera leo, lion, state of tennessee2018-11-16v4No1 / 23
509amnonhighfreq feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, urinary schistosomiasis, schistosomiasis2019-03-18v4No1 / 23
542amnon high in child age 1-7 years compared to adult age 12-23 years in subgingival plaque dentition monkey macaca mulatta research facility puerto rico 2019-08-01v4No1 / 23
239amnonhighfreq homo sapiens, feces, united states of america2017-11-08v4No1 / 24
241amnoncommon in babies age < 3 years in estonia (common homo sapiens, feces, infant, age < 3 years, estonia)2017-11-13v4No1 / 24
330amnonhighfreq homo sapiens, feces, kingdom of norway, oslo, infant, age 1 year2018-05-13v4No1 / 24
365amnonhighfreq homo sapiens, feces, child, obsolete_juvenile stage, sudan2018-08-30v4No1 / 24
489amnoncommon feces, anal swab, myotis myotis, bat, greater mouse eared bat, french republic2019-02-25v4No1 / 24
566amnonhighfreq adult, homo sapiens, china, feces2019-11-24v4No1 / 24
35amnoncommon tanzania, dense settlement biome, hospital, breast milk, homo sapiens2016-12-06v4No1 / 25
53amnonhighfreq lima, homo sapiens, feces, city, shantytown2017-01-21v4No1 / 25
108amnonhighfreq research facility, texas, united states of america, colon, mus musculus, mouse2017-04-07v4No1 / 25
159amnon high in midgut compared to hindgut in siganidae rabbitfish australia 2017-07-06v4No1 / 25
284amnoncommon homo sapiens, female, feces, state of california, infant, age 6 months2018-01-27v4No1 / 25
290amnonhighfreq homo sapiens, feces, adult, city, china2018-02-01v4No1 / 25
379amnonhighfreq gallus gallus, chicken, feces, age 15 - 35 days, united kingdom2018-09-14v4No1 / 25
395amnoncommon homo sapiens, feces, united states of america, commonwealth of pennsylvania, child, ulcerative colitis, inflammatory bowel disease, crohn's disease2018-11-14v4No1 / 25
428amnoncommon homo sapiens, adult, feces, nanchang city prefecture, pancreatitis, acute pancreatitis, china2018-12-09v4No1 / 25
544amnoncommon flower, vaccinium macrocarpon, american cranberry, united states of america, commonwealth of massachusetts2019-08-04v4No1 / 25
301amnonhighfreq canis lupus familiaris, dog, united states of america, rectum2018-03-05v4No1 / 26
354amnoncommon homo sapiens, united states of america, adult, pair of nares, nasal cavity, nasal brush2018-07-30v4No1 / 26
438amnonhighfreq feces, homo sapiens, jiangsu province, age 30-50, adult, china2018-12-30v4No1 / 26
131amnonhighfreq homo sapiens, feces, south korea2017-04-16v4No1 / 27
228amnoncommon in sinus brush of sinusitis patients (common homo sapiens, mucosa, sinusoidal space, paranasal sinus, united states of america, sinusitis)2017-10-31v4No1 / 27
387amnoncommon in feces of wild brown bear (common ursus arctos, brown bear, feces, sweden, wild)2018-11-03v4No1 / 27
399amnon high in crohn's disease compared to control in feces united states of america homo sapiens 2018-11-16v4No1 / 27
404amnon high in hard stool compared to normal stool in homo sapiens feces columbia city adult 2018-11-20v4No1 / 27
438amnonhighfreq homo sapiens, feces, jiangsu province, child, age 8-12, china2018-12-30v4No1 / 27
495amnonhighfreq gallus gallus, chicken, caecum, kingdom of spain, farm, free range chicken, age 3 weeks2019-03-03v4No1 / 27
540amnonhighfreq dog, canis lupus familiaris, feces, united states of america, flagstaff, state of arizona2019-07-31v4No1 / 27
127amnonhighfreq gallus gallus, chicken, united states of america, caecum, age 14-28 days2017-04-14v4No1 / 28
365amnonhighfreq homo sapiens, feces, jordan, child, obsolete_juvenile stage2018-08-30v4No1 / 28
495amnonhighfreq gallus gallus, chicken, caecum, broiler chicken, kingdom of spain, farm, age 2 weeks2019-03-03v4No1 / 28
540amnoncommon dog, canis lupus familiaris, feces, united states of america, flagstaff, state of arizona2019-07-31v4No1 / 28
26amnoncommon in combined swab of inguinal region and axilla (common homo sapiens, united states of america, inguinal region, axilla, sebum)2016-12-05v4No1 / 29
165amnoncommon in house fly larva grown on moist wheat bran (common research facility, musca domestica, house fly, larval stage, digestive system, china)2017-07-16v4No1 / 29
438amnonhighfreq homo sapiens, feces, jiangsu province, age 13-14, china2018-12-30v4No1 / 29
36amnonhigher in centernarians ( high in centererians compared to adult in homo sapiens feces sichuan province )2016-12-06v4No1 / 30
211amnon high in female compared to male in feces united states of america research facility mus musculus mouse diet high fat diet 2017-10-22v4No1 / 30
284amnoncommon homo sapiens, female, feces, state of california, infant, age 1 year2018-01-27v4No1 / 30
320amnoncommon homo sapiens, feces, adult, crohn's disease2018-04-19v4No1 / 30
438amnonhighfreq homo sapiens, feces, jiangsu province, child, age 3-6, china2018-12-30v4No1 / 30
45amnoncommon in feces babies age 0-2 in india (common homo sapiens, feces, infant, india)2016-12-19v4No1 / 31
108amnonincreases during fasting in mouse colon ( high in fasting late timepoints compared to early timepoints in research facility texas united states of america colon mus musculus mouse )2017-04-07v4No1 / 31
189amnonhigherin stems of grape vines with pierce disease compared to control ( high in xylella fastidiosa temecula1 pierce disease compared to control in united states of america state of california grape vitis vinifera stem endosphere )2017-08-30v4No1 / 31
262amnoncommon tick, ixodes scapularis, larval stage, body proper, research facility2017-12-10v4No1 / 31
390amnoncommon homo sapiens, feces, clostridium difficile intestinal infectious disease, australia, hospital, diarrhea2018-11-04v4No1 / 31
544amnoncommon vaccinium macrocarpon, american cranberry, united states of america, commonwealth of massachusetts, botanical fruit food product2019-08-04v4No1 / 31
165amnoncommon in moist wheat bran (common research facility, wheat bran, china)2017-07-16v4No1 / 32
292amnon high in crohn's disease ulcerative colitis compared to control in homo sapiens adult feces china 2018-02-05v4No1 / 32
411amnonhigher in wild baboons feeding on discarded human foods ( high in human contact compared to low human contact in zambia feces papio kindae wild monkey kinda baboon )2018-11-23v4No1 / 33
19amnonhigher in CD compared to control in biopsies ( high in crohn's disease compared to control in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 34
269amnondecreases during one month in refrigeration of yao meat ( high in fresh early timepoint compared to late timpoint food spoilage in china foodon product type )2018-01-09v4No1 / 34
407amnoncommon costa rica, feces, monkey, cebus capucinus, white-faced capuchin, wild2018-11-21v4No1 / 34
48amnonlower in 3 months compared to 1 week in infant hypopharynx ( high in age age 1 week compared to age 3 months in homo sapiens kingdom of denmark hypopharynx infant )2017-01-19v4No1 / 35
108amnoncommon research facility, texas, united states of america, colon, quail, coturnix coturnix2017-04-07v4No1 / 35
240amnonhigher in infants age<1 year compared to 1-3 years in baby feces ( high in age age < 1 year compared to age > 1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 35
262amnonhigher in tick larvae fed on PIXR immunized mice compared to non immunized ( high in pixr immunized compared to control in tick ixodes scapularis larval stage body proper research facility )2017-12-10v4No1 / 35
287amnoncommon snow field, mountain, depth 1-2m, japan2018-01-29v4No1 / 35
350amnoncommon in feces of white faced capuchin from costa rica rain forest (common monkey, cebus capucinus, feces, costa rica, white-faced capuchin, woodland area)2018-07-30v4No1 / 35
219amnonhigher in pre-weaning compared to post-weaning in mouse feces ( high in age age 21 days breast milk compared to age 28 days mouse chow in mus musculus mouse feces c57bl/6 male research facility south korea )2017-10-24v4No1 / 36
240amnoncommon in infants age <3 years (common homo sapiens, feces, finland, infant, age < 3 years)2017-11-12v4No1 / 36
50amnoncommon in mitten crab gills (common gill, eriocheir sinensis, china)2017-01-19v4No1 / 37
232amnoncommon in foot of diabetic patients (common homo sapiens, skin, australia, foot, diabetes mellitus)2017-11-05v4No1 / 37
345amnoncommon homo sapiens, nasal cavity, nasal cavity mucosa, austria, adult, graz city district2018-06-11v4No1 / 37
243amnoncommon beetle, anoplophora glabripennis, digestive system, united states of america2017-11-15v4No1 / 38
390amnoncommon homo sapiens, feces, australia, hospital, diarrhea2018-11-04v4No1 / 38
409amnonhigher in colon biopsies compared to stool and luminal content ( high in biopsy biopsy site compared to feces luminal content in homo sapiens united states of america )2018-11-22v4No1 / 38
503amnonincreases following malaria infection ( high in late time points experimental cerebral malaria malaria compared to control early time points in mouse mus musculus research facility c57bl/6 feces japan )2019-03-12v4No1 / 38
102amnonlower in saliva compared to teeth, cheek ( high in dentition cheek compared to saliva in homo sapiens atlanta united states of america mouth )2017-04-03v4No1 / 39
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, infant, age 1 year2018-05-13v4No1 / 39
360amnoncommon agave, leaf, leaf endosphere, desert, adave salmiana, guanajuato, mexico2018-08-21v4No1 / 39
497amnoncommon chicken, gallus gallus, broiler chicken, austria, farm, feces, age 2 weeks2019-03-04v4No1 / 39
19amnoncommon in biopsies of children (IBD study) (common rectum, terminal ileum, sigmoid colon, caecum, colon, biopsy, children, homo sapiens, united states of america)2016-11-14v4No1 / 40
79amnoncommon skin, united states of america, stenella attenuata2017-03-03v4No1 / 40
119amnonhigher in late timepoints (>4weeks) of worm infected mice ( high in parasitic helminthiasis infectious disease trichuris muris late timepoints compared to control in mus musculus mouse feces research facility sweden )2017-04-12v4No1 / 40
212amnonlower in obese mice fed quinoa diet compared to ain-93g rodent diet ( high in diet ain-93g rodent diet compared to quinoa food product in mouse mus musculus feces research facility united states of america obese body mass index status db/db mouse obesity )2017-10-22v4No1 / 40
102amnonhigher in cheeks compared to teeth, saliva ( high in cheek compared to saliva dentition in homo sapiens atlanta united states of america mouth )2017-04-03v4No1 / 41
117amnoncommon zebra fish, danio rerio, research facility, larval stage, united states of america, intestine2017-04-10v4No1 / 41
352amnoncommon homo sapiens, feces, new delhi, india2018-07-30v4No1 / 41
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, adult, tonsil2018-11-04v4No1 / 41
400amnonhigher in children of hmong migrands born in the usa compared to non-migrant usa people ( high in hmong 2nd generation hmong compared to united states of america in homo sapiens feces )2018-11-18v4No1 / 41
401amnonlower in endospore enriched (lysis resistant) replicates ( high in control compared to endospore enriched fraction lysis in homo sapiens feces united states of america adult )2018-11-18v4No1 / 41
542amnoncommon subgingival plaque, dentition, monkey, macaca mulatta, research facility, puerto rico, child, age 1-7 years2019-08-01v4No1 / 41
14amnon high in stomach duodenum jejunum ileum compared to caecum right colon transverse colon left colon feces in mus musculus united states of america gastrointestinal system 2016-11-08v4No1 / 42
51amnoncommon feces, homo sapiens, united states of america2017-01-19v4No1 / 42
60amnoncommon anser cygnoides, feces, china2017-02-03v4No1 / 42
79amnoncommon skin, united states of america, globicephala macrorhynchus, short finned pilot whale2017-03-03v4No1 / 42
95amnoncommon in root canal (common homo sapiens, brazil, tooth, root canal)2017-03-12v4No1 / 42
89amnoncommon junco hyemalis, uropygial gland, commonwealth of virginia, songbird2017-03-08v4No1 / 43
189amnoncommon united states of america, state of california, grape, vitis vinifera, stem, endosphere2017-08-30v4No1 / 43
389amnoncommon pig, sus scrofa, vagina, united states of america, state of michigan, farm2018-11-04v4No1 / 43
406amnoncommon feces, south africa, acinonyx jubatus, cheetah2018-11-21v4No1 / 43
36amnoncommon homo sapiens, feces, sichuan province2016-12-06v4No1 / 44
241amnoncommon in babies age < 3 years in russia (common homo sapiens, feces, infant, russia, age < 3 years)2017-11-13v4No1 / 44
268amnoncommon fish, gadus morhua, atlantic cod, digestive system, kingdom of norway2017-12-24v4No1 / 44
302amnoncommon in feces of parakeet pet birds (common bird, melopsittacus undulatus, parakeet, mexico, feces, pet)2018-03-05v4No1 / 44
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, sudan2018-08-30v4No1 / 44
406amnoncommon feces, zoological garden, united states of america, myrmecophaga tridactyla, giant anteater2018-11-21v4No1 / 44
244amnoncommon drosophila melanogaster, fruit fly, research facility, digestive system, united kingdom2017-11-15v4No1 / 45
327amnonlower in nasopharynx of antibiotics treated cows compared to cows without antibiotic injection ( high in control compared to antibiotic in bos taurus cow nasopharynx canada )2018-04-30v4No1 / 45
558amnoncommon bird, centrocercus urophasianus, greater sage-grouse, united states of america, state of wyoming, duodenum2019-09-20v4No1 / 45
273amnoncommon feces, homo sapiens, kingdom of denmark, infant, age one year2018-01-14v4No1 / 46
428amnon high in pancreatitis acute pancreatitis compared to control in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 46
287amnoncommon snow field, mountain, depth 6-7m, japan2018-01-29v4No1 / 47
301amnoncommon canis lupus familiaris, dog, united states of america, duodenum2018-03-05v4No1 / 47
302amnoncommon in feces of canary pet birds (common bird, mexico, feces, pet, serinus canaria, canary)2018-03-05v4No1 / 47
482amnoncommon homo sapiens, feces, colombia, medellin metropolitan area, child, daycare, age 1-5 years2019-02-12v4No1 / 47
89amnoncommon junco hyemalis, commonwealth of virginia, songbird, cloaca2017-03-08v4No1 / 48
495amnon high in typhlitis disease intestinal disease compared to control in gallus gallus chicken caecum kingdom of spain farm free range chicken 2019-03-03v4No1 / 48
258amnoncommon in lungs of hiv patients with pneumonia (common homo sapiens, hiv infection, uganda, bronchoalveolar lavage, bronchial epithelium, lung, pneumonia)2017-11-27v4No1 / 49
121amnoncommon homo sapiens, feces, bangladesh, adult2017-04-13v4No1 / 50
327amnoncommon bos taurus, cow, nasopharynx, canada2018-04-30v4No1 / 50
339amnon high in infant age < 1 year compared to adult in homo sapiens feces india 2018-05-24v4No1 / 50
406amnoncommon feces, equus przewalskii, przewalski horse, zoological garden, united states of america2018-11-21v4No1 / 50
321amnonhigher in mice treated with ampicillin compared to untreated mice ( high in ampicillin antibiotic compared to control in mus musculus mouse c57bl/6j feces united states of america research facility )2018-04-22v4No1 / 52
93amnon high in egg jelly shelled egg compared to shell gland in hawaii bobtail squid euprymna scolopes 2017-03-12v4No1 / 53
292amnoncommon homo sapiens, adult, feces, ulcerative colitis, china2018-02-05v4No1 / 53
333amnoncommon in stroke patient feces (common feces, homo sapiens, stroke, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 53
109amnoncommon usa, water, drinking water, site a2017-04-08v4No1 / 54
286amnonhigher in feces of individuals with kidney stones ( high in nephrolithiasis compared to control in homo sapiens feces adult age 50-60 years nanning city prefecture china )2018-01-27v4No1 / 54
15amnoncommon acinonyx jubatus, namibia, feces2016-11-08v4No1 / 55
292amnoncommon homo sapiens, adult, feces, crohn's disease, china2018-02-05v4No1 / 55
313amnonhigher in gut content of fish grown in 12C compared to 18C water ( high in temp 12c cold environment compared to warm temperature habitat temp 18c in sweden fish rainbow trout oncorhynchus mykiss research facility digestive system gut content )2018-04-10v4No1 / 55
390amnoncommon homo sapiens, feces, australia, hospital, salmonella gastroenteritis, diarrhea2018-11-04v4No1 / 55
45amnonhigher in younf babies compared to 2 year olds in india ( high in age age 0-1 compared to age 1-2 in homo sapiens feces infant india )2016-12-19v4No1 / 56
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, systemic lupus erythematosus2018-09-03v4No1 / 56
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, ulcerative colitis2018-11-06v4No1 / 56
488amnoncommon canis lupus familiaris, dog, feces, italy, lymphoma2019-02-25v4No1 / 56
56amnoncommon nicotiana galuca, flower, nectar, israel2017-01-30v4No1 / 57
308amnoncommon in neonatal intensive care unit floor (common united states of america, state of california, hospital, floor, dust)2018-03-31v4No1 / 57
237amnoncommon bird, oceanodroma leucorhoa, seabird, canada, bon portage island, uropygial gland2017-11-07v4No1 / 58
281amnoncommon shinisaurus crocodilurus, crocodile lizard, cloaca, china2018-01-25v4No1 / 59
9amnonhigher in sea water with coral ( high in porites astreoides compared to control in bermuda sea water )2016-10-27v4No1 / 61
333amnoncommon in healthy controls feces (common homo sapiens, feces, guangzhou city prefecture, adult, control, china)2018-05-15v4No1 / 61
302amnoncommon in feces of Cockatiel pet birds (common bird, mexico, feces, pet, nymphicus hollandicus, cockatiel)2018-03-05v4No1 / 63
380amnoncommon tibet autonomous region, feces, homo sapiens, tibetan plateau, adult2018-10-03v4No1 / 63
442amnonhigher in tnbs induced colitis compared to controls ( high in tnbs colitis compared to control in rattus norvegicus rat sprague dawley male research facility feces china )2019-01-06v4No1 / 63
502amnoncommon homo sapiens, feces, adult, united states of america, schizophrenia2019-03-12v4No1 / 63
530amnoncommon snake, feces, snake farm, farm, adula, hunan province, elaphe carinata, king ratsnake, china2019-07-21v4No1 / 63
242amnoncommon in native-americans (common homo sapiens, feces, united states of america, state of oklahoma, native american, arapaho, cheyenne)2017-11-14v4No1 / 65
448amnoncommon equus caballus, horse, feces, farm, equine grass sickness, disease, united kingdom2019-01-08v4No1 / 65
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, nigeria2018-08-30v4No1 / 66
558amnoncommon bird, centrocercus urophasianus, greater sage-grouse, united states of america, state of wyoming, colon2019-09-20v4No1 / 66
71amnon high in small intestine stomach compared to feces hindgut colon in liolaemus ruibali argentina research facility 2017-02-25v4No1 / 67
114amnon high in adult compared to tadpole in rana pipiens northern leopard frog research facility digesta intestine state of wisconsin united states of america 2017-04-10v4No1 / 67
365amnoncommon homo sapiens, feces, jordan, child, obsolete_juvenile stage2018-08-30v4No1 / 67
398amnon high in crohn's disease compared to control in homo sapiens feces belgium 2018-11-15v4No1 / 68
72amnoncommon canis lupus familiaris, feces, united states of america, iowa2017-02-25v4No1 / 69
301amnoncommon canis lupus familiaris, dog, united states of america, ileum2018-03-05v4No1 / 69
495amnoncommon gallus gallus, chicken, caecum, kingdom of spain, farm, free range chicken, age 4 days2019-03-03v4No1 / 69
417amnoncommon anser cygnoides, swan goose, bird, feces, winter, china2018-12-01v4No1 / 70
313amnoncommon in fishfeed (common sweden, fish feed)2018-04-10v4No1 / 71
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, tonsil, age 4 weeks2018-11-04v4No1 / 71
404amnon high in barranquilla bucaramanga municipality of santiago de cali compared to bogota medellin metropolitan area in homo sapiens feces adult colombia city 2018-11-20v4No1 / 71
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, skin, nipple, adult2018-11-04v4No1 / 72
441amnonhigher in mice treated with indomethacin NSAID compared to non-treated controls ( high in indomethacin non-steroidal anti-inflammatory drug compared to control in mus musculus mouse c57bl/6j feces research facility united states of america )2019-01-06v4No1 / 72
448amnon high in equine grass sickness disease compared to control in equus caballus horse feces farm united kingdom 2019-01-08v4No1 / 72
541amnoncommon phascolarctos cinereus, koala, feces, australia, wild, cape otway, eucalyptus viminalis diet2019-08-01v4No1 / 72
26amnoncommon united states of america, homo sapiens, pair of nares, mucus2016-12-05v4No1 / 73
425amnoncommon homo sapiens, feces, africa, child, madagascar, antananarivo2018-12-08v4No1 / 73
477amnoncommon homo sapiens, feces, adult, nepal, himalayas, rural community, tharu, agrarian2019-01-28v4No1 / 74
395amnoncommon homo sapiens, feces, united states of america, commonwealth of pennsylvania, control2018-11-14v4No1 / 75
74amnoncommon united states of america, feces, homo sapiens2017-02-27v4No1 / 76
477amnoncommon homo sapiens, feces, himalayas, nepal, rural community, raute2019-01-29v4No1 / 76
484amnoncommon feces, united states of america, adult, state of michigan, age 17-29, homo sapiens2019-02-13v4No1 / 76
431amnonhigher in midgut of hibernating bumble bees compared to non-hibernating ( high in hibernation compared to non hibernating in bombus terrestris bumble bee midgut research facility queen belgium )2018-12-16v4No1 / 77
516amnoncommon homo sapiens, feces, united states of america, state of ohio, adult2019-05-29v4No1 / 77
541amnoncommon phascolarctos cinereus, koala, feces, australia, wild, cape otway, eucalyptus obliqua diet2019-08-01v4No1 / 77
360amnoncommon agave, leaf, leaf endosphere, desert, guanajuato, mexico, agave tequiliana, cultivated environment2018-08-21v4No1 / 78
399amnoncommon feces, united states of america, zoological garden, panthera leo, lion, state of tennessee2018-11-16v4No1 / 79
401amnoncommon homo sapiens, feces, united states of america, adult2018-11-18v4No1 / 79
404amnoncommon homo sapiens, feces, colombia, city, adult2018-11-20v4No1 / 79
407amnon high in wet season compared to dry season in costa rica feces monkey cebus capucinus white-faced capuchin wild 2018-11-21v4No1 / 79
425amnoncommon homo sapiens, feces, africa, child, central african republic, bangui2018-12-08v4No1 / 79
26amnoncommon united states of america, felis catus, mucus, pair of nares2016-12-05v4No1 / 80
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, tonsil, age 1-3 weeks2018-11-04v4No1 / 80
483amnoncommon hawaii, pearl harbor, research facility, hydroides elegans, tubeworm, united states of america, adult2019-02-13v4No1 / 80
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, tributary, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 80
292amnoncommon homo sapiens, adult, feces, control, china2018-02-05v4No1 / 81
339amnoncommon homo sapiens, feces, adult, india2018-05-24v4No1 / 81
344amnoncommon in feces of heterosexuals (common homo sapiens, feces, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 82
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, control2018-09-03v4No1 / 82
562amnoncommon age 5-13 years, child, ecuador, quito, feces2019-11-05v4No1 / 82
334amnonhigher in dss induced colitis compared to controls ( high in dss induced colitis colitis compared to control in mus musculus mouse feces israel research facility c57bl/6 )2018-05-15v4No1 / 83
502amnoncommon homo sapiens, feces, adult, united states of america, control2019-03-12v4No1 / 83
231amnoncommon in dog rectum (common dog, canis lupus familiaris, united states of america, rectum, feces)2017-11-02v4No1 / 84
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msw, heterosexual2018-11-06v4No1 / 84
227amnonhiger in first 24hrs compared to later timepoints in baby nasopharynx ( high in age age <=24 hours compared to age >= 7 days in homo sapiens nasopharynx nasal cavity infant kingdom of the netherlands )2017-10-30v4No1 / 85
247amnoncommon homo sapiens, italy, feces, high bmi, obesity2017-11-21v4No1 / 85
405amnon high in ketogenic diet compared to control diet in mouse mus musculus research facility feces united states of america swiss webster 2018-11-20v4No1 / 85
26amnon high in pair of nares mucus compared to saliva mouth in united states of america felis catus 2016-12-05v4No1 / 86
109amnoncommon usa, water, drinking water, site c2017-04-08v4No1 / 86
249amnoncommon homo sapiens, feces, united states of america2017-11-22v4No1 / 86
318amnoncommon canada, vancouver, ocean, pacific ocean, kelp, nereocystis2018-04-16v4No1 / 86
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, control2018-11-06v4No1 / 86
513amnoncommon waste water, hospital, city, xinxiang city prefecture, china2019-03-25v4No1 / 86
530amnoncommon snake, feces, snake farm, farm, adula, hunan province, ptyas mucosa, oriental ratsnake, china2019-07-21v4No1 / 86
340amnoncommon feces, felis catus, cat, city of melbourne, australia2018-05-27v4No1 / 87
344amnoncommon in feces of homosexual males (common homo sapiens, feces, united states of america, state of colorado, denver, homosexual, gay, msm)2018-05-31v4No1 / 87
360amnoncommon agave, desert, root endosphere, agave salmiana, mexico, guanajuato, root2018-08-21v4No1 / 87
430amnoncommon homo sapiens, adult, united states of america, state of arizona, city, age 20, feces2018-12-15v4No1 / 87
71amnoncommon liolaemus ruibali, argentina, research facility, stomach2017-02-25v4No1 / 88
477amnoncommon homo sapiens, feces, himalayas, nepal, rural community, raji2019-01-29v4No1 / 88
487amnoncommon homo sapiens, feces, united states of america, metabolic syndrome, metabolic syndrome x2019-02-24v4No1 / 88
293amnoncommon homo sapiens, feces, adult, united states of america, american diet2018-02-07v4No1 / 89
382amnoncommon water, hot spring, geothermal field, ganzi tibetan autonomous prefecture, china, high temperature environment2018-10-22v4No1 / 89
530amnoncommon snake, feces, snake farm, farm, adula, hunan province, naja atra, chinese cobra, china2019-07-21v4No1 / 90
199amnonhigher in bathroom shower compared to kitchen sink ( high in bathroom shower tile building wall compared to kitchen sink in building urban biome united states of america )2017-10-01v4No1 / 91
503amnon high in balb/c compared to c57bl/6 in mouse mus musculus research facility feces japan 2019-03-12v4No1 / 91
428amnoncommon homo sapiens, adult, feces, nanchang city prefecture, control, china2018-12-09v4No1 / 93
363amnoncommon ovis aries, age 30 days, obsolete_juvenile stage, italy, dairy, caecum, colon, rectum2018-08-29v4No1 / 94
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msm, gay, homosexual2018-11-06v4No1 / 94
488amnoncommon canis lupus familiaris, dog, feces, italy, control2019-02-25v4No1 / 94
400amnoncommon in feces of european american females (common homo sapiens, feces, united states of america, adult, female)2018-11-18v4No1 / 95
400amnoncommon in hmong (chinese) females from thailand (common homo sapiens, feces, adult, female, thailand, hmong, china)2018-11-18v4No1 / 95
238amnoncommon homo sapiens, feces, colombia2017-11-07v4No1 / 96
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 97
409amnoncommon homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v4No1 / 97
477amnoncommon homo sapiens, feces, adult, nepal, himalayas, rural community, forager, chepang2019-01-28v4No1 / 97
558amnoncommon bird, centrocercus urophasianus, greater sage-grouse, united states of america, state of wyoming, gizzard2019-09-20v4No1 / 97
455amnoncommon homo sapiens, adult, canada, saliva, atherosclerosis2019-01-10v4No1 / 100
363amnon high in caecum colon rectum compared to rumen ruminant reticulum omasum in ovis aries age 30 days obsolete_juvenile stage italy dairy 2018-08-29v4No1 / 101
438amnoncommon homo sapiens, feces, age 19-24, china2018-12-30v4No1 / 101
499amnoncommon brazil, pond, digestive system, intestine, dendropsophus minutus, frog, tadpole2019-03-05v4No1 / 102
198amnoncommon yellowstone national park, united states of america, geothermal field, water, hot spring, high temperature environment2017-09-13v4No1 / 103
213amnoncommon homo sapiens, south africa, vagina2017-10-22v4No1 / 103
425amnon high in antananarivo madagascar compared to central african republic bangui in homo sapiens africa child duodenum 2018-12-08v4No1 / 103
477amnoncommon homo sapiens, feces, adult, united states of america2019-01-28v4No1 / 103
563amnoncommon control, homosexual, msm, male, united states of america, rectal swab, feces, homo sapiens2019-11-18v4No1 / 103
499amnoncommon digestive system, pond, intestine, brazil, remartinia, aeshnidae, dragonfly, larval stage2019-03-05v4No1 / 104
515amnoncommon whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, onthophagus similis2019-04-18v4No1 / 104
284amnoncommon homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 105
301amnoncommon canis lupus familiaris, dog, united states of america, colon2018-03-05v4No1 / 105
438amnoncommon homo sapiens, feces, jiangsu province, child, age 8-12, china2018-12-30v4No1 / 106
215amnoncommon homo sapiens, feces, united states of america2017-10-23v4No1 / 107
213amnonlower in patients with bacterial vaginosis compared to healthy controls ( high in control compared to bacterial vaginosis in homo sapiens vagina south africa )2017-10-31v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 107
406amnoncommon feces, zoological garden, south africa, aardvark, orycteropus afer2018-11-21v4No1 / 107
409amnoncommon homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 108
436amnoncommon felis catus, cat, feces, united states of america, state of colorado2018-12-25v4No1 / 108
289amnoncommon homo sapiens, feces, adult, united states of america, state of michigan2018-02-01v4No1 / 109
438amnoncommon homo sapiens, feces, jiangsu province, child, age 3-6, china2018-12-30v4No1 / 109
53amnoncommon homo sapiens, feces, lima, city, shantytown2017-01-21v4No1 / 110
271amnon high in root structure root compared to soil rhizosphere in depth 0-20cm glycine max soybean china 2018-01-09v4No1 / 110
276amnoncommon feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v4No1 / 110
425amnoncommon homo sapiens, africa, child, stunted growth, stomach2018-12-08v4No1 / 111
438amnoncommon feces, homo sapiens, age 60-79, adult, jiangsu province, china2018-12-30v4No1 / 111
477amnon high in nepal rural community himalayas compared to united states of america in homo sapiens feces adult 2019-01-28v4No1 / 111
563amnoncommon hiv infection, homosexual, msm, male, united states of america, rectal swab, feces, homo sapiens2019-11-18v4No1 / 111
388amnoncommon pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 6-10 weeks2018-11-03v4No1 / 112
79amnoncommon skin, united states of america, delphinus delphis2017-03-03v4No1 / 113
198amnoncommon sediment, yellowstone national park, united states of america, thermophilic sediment, geothermal field, high temperature environment2017-09-13v4No1 / 113
269amnoncommon in fresh yao meat food (common china, foodon product type)2018-01-09v4No1 / 113
517amnoncommon feces, homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department2019-05-29v4No1 / 113
388amnoncommon pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 12-19 weeks2018-11-03v4No1 / 114
438amnoncommon feces, homo sapiens, jiangsu province, age 30-50, adult, china2018-12-30v4No1 / 115
195amnoncommon in boston subway surfaces (common city, urban biome, train, boston)2017-09-07v4No1 / 116
301amnoncommon canis lupus familiaris, dog, united states of america, rectum2018-03-05v4No1 / 116
48amnonhigher in 3 months compared to 1 week in infant hypopharynx ( high in age age 3 months compared to age 1 week in homo sapiens kingdom of denmark hypopharynx infant )2017-01-19v4No1 / 117
149amnonhigher in larvae transferred to stream compared to pond ( high in stream compared to pond in salamandra salamandra fire salamander germany larval stage amphibian larval stage skin mucus )2017-04-24v4No1 / 117
239amnoncommon homo sapiens, feces, united states of america2017-11-08v4No1 / 117
343amnoncommon in apple flowers (common apple, malus x domestica, flower structure, flower, united states of america, state of connecticut)2018-05-28v4No1 / 118
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 118
410amnonlower in feces compared to rectal biopsies in children with treatment naive uc ( high in rectum biopsy biopsy site compared to feces in homo sapiens child united states of america ulcerative colitis )2018-11-22v4No1 / 118
212amnoncommon mouse, mus musculus, feces, research facility, united states of america, lean body mass, control2017-10-22v4No1 / 120
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
352amnoncommon in duodenal biopsies (common homo sapiens, new delhi, duodenum, small intestine, india)2018-07-30v4No1 / 121
371amnoncommon feces, homo sapiens, hunter gatherer, amerindian, venezuela2018-09-06v4No1 / 121
438amnoncommon feces, homo sapiens, age >94, jiangsu province, adult, china2018-12-30v4No1 / 121
515amnoncommon whole body, beetle, aphodius depressus, detritivorous beetle, feces, bulgaria, balkan mountains2019-04-18v4No1 / 121
517amnoncommon homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department, skin, arm, forearm2019-05-29v4No1 / 121
425amnoncommon homo sapiens, africa, child, duodenum, antananarivo, madagascar2018-12-08v4No1 / 123
449amnoncommon homo sapiens, feces, colombia2019-01-09v4No1 / 124
10amnonnegatively correlated with age (6-35) ( high in child compared to adult in homo sapiens feces toronto )2016-10-27v4No1 / 125
425amnoncommon homo sapiens, africa, child, duodenum, stunted growth, central african republic, bangui2018-12-08v4No1 / 125
67amnoncommon in dry processing of coffee beans (common coffea arabica, dry processing, ecuador)2017-02-19v4No1 / 126
69amnoncommon canis lupus familiaris, beagle dog, united states of america, research facility, feces2017-02-21v4No1 / 126
347amnoncommon kingdom of norway, svalbard archipelago, permafrost, soil, depth 150-200cm2018-07-15v4No1 / 126
113amnon high in larval stage compared to adult in danio rerio zebra fish research facility united states of america intestine 2017-04-10v4No1 / 128
131amnoncommon homo sapiens, feces, south korea2017-04-16v4No1 / 128
280amnoncommon atlantic ocean, depth 20m, portuguese republic, eunicella labiata, gorgonian coral, coral, coral reef2018-01-25v4No1 / 128
173amnoncommon homo sapiens, saliva, austria, graz city district2017-07-26v4No1 / 129
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-13v4No1 / 130
39amnoncommon in obese lepr-db mice (common mus musculus, research facility, feces, obesity)2016-12-09v4No1 / 132
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
176amnoncommon in skin of hairless mice (common mouse, mus musculus, skin, female, skh-1 hairless mouse, dorsum, research facility, united states of america)2017-07-29v4No1 / 133
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
438amnoncommon homo sapiens, feces, jiangsu province, age 13-14, china2018-12-30v4No1 / 134
495amnoncommon gallus gallus, chicken, caecum, broiler chicken, kingdom of spain, farm, age 2 weeks2019-03-03v4No1 / 134
511amnoncommon snow, depth 0-5cm, united states of america, state of colorado2019-03-20v4No1 / 134
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, finland2017-09-12v4No1 / 136
212amnoncommon mouse, mus musculus, feces, research facility, united states of america, obese body mass index status, db/db mouse, obesity2017-10-22v4No1 / 137
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 137
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 138
255amnoncommon in fish feed (common united states of america, state of minnesota, research facility, fish feed)2017-11-24v4No1 / 141
62amnon high in egypt compared to united states of america in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 144
291amnoncommon canis lupus familiaris, dog, pair of nares, nasal cavity, germany2018-02-01v4No1 / 144
132amnoncommon homo sapiens, feces, united states of america2017-04-16v4No1 / 145
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, urinary schistosomiasis, schistosomiasis2019-03-18v4No1 / 146
15amnoncommon namibia, feces, canis mesomelas2016-11-08v4No1 / 147
85amnoncommon litopenaeus vannamei, pacific white shrimp, shenzhen city prefecture, digestive system, china, sea water2017-03-06v4No1 / 147
406amnoncommon feces, south africa, lycaon pictus, african wild dog2018-11-21v4No1 / 147
458amnonhigher in BALB/c strain compared to A/J and C57BL/6 strains ( high in balb/c compared to a/j c57bl/6 in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 147
475amnoncommon in air next to subway stations in hong kong (common air, hong kong, city)2019-01-20v4No1 / 147
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, control2019-03-18v4No1 / 147
515amnoncommon whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, aphodius haemorrhoidalis2019-04-18v4No1 / 147
74amnonHigher in animal product diet compared to plant diet ( high in diet animal product diet compared to plant diet in homo sapiens feces united states of america )2017-02-27v4No1 / 149
73amnoncommon homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 150
362amnoncommon hydrothermal vent, greece, marine sediment, mediterranean sea, marine hydrothermal vent, volcanic rock, volcanic crater, water, sea water, active vent2018-08-29v4No1 / 150
358amnonhigher in dnbs induced colitis compared to controls in rat feces ( high in dnbs induced colitis colitis compared to control in rattus rat research facility wistar rat czech republic feces )2018-08-19v4No1 / 154
53amnoncommon homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 155
273amnon high in age age one month compared to age one year in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 155
108amnon high in colon compared to caecum in research facility texas united states of america coturnix coturnix common quail 2017-04-07v4No1 / 157
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 157
108amnoncommon research facility, texas, united states of america, colon, mus musculus, mouse2017-04-07v4No1 / 158
180amnoncommon dermanyssus gallinae, red poulty mite, czech republic, poulty farm, larval stage, shelled egg2017-08-14v4No1 / 158
379amnoncommon gallus gallus, chicken, feces, age 15 - 35 days, united kingdom2018-09-14v4No1 / 160
192amnoncommon seed, seed structure, brassica napus2017-09-05v4No1 / 161
475amnoncommon in air in subway train in hong kong (common air, hong kong, city, subway)2019-01-20v4No1 / 161
121amnonhigh in diarrhea compared to recovery period ( high in diarrhea compared to control in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 162
290amnoncommon homo sapiens, feces, adult, city, china2018-02-01v4No1 / 162
297amnoncommon homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 162
337amnoncommon in feces of house mice from new york city (common mus musculus, house mice, mouse, new york city, united states of america, city)2018-05-18v4No1 / 165
209amnon high in cape cod canal atlantic ocean compared to vancouver pacific ocean in sea water ocean north america depth 25cm 2017-10-15v4No1 / 166
232amnoncoomon in foot of healthy controls (common homo sapiens, skin, australia, foot)2017-11-05v4No1 / 166
159amnoncommon siganidae, rabbitfish, australia, midgut2017-07-06v4No1 / 169
190amnoncommon homo sapiens, tanzania, hadza, hunter gatherer, feces2017-09-04v4No1 / 169
241amnonlower in babies from russia compared to estonia ( high in estonia compared to russia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 169
123amnon high in high fat diet diet compared to normal diet mouse chow in mus musculus mouse feces research facility united states of america c57bl/6j 2017-04-13v4No1 / 170
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 170
374amnoncommon skin, costa rica, amphibia, craugastor bransfordii, bransford’s litter frog, frog2018-09-09v4No1 / 171
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 172
347amnoncommon kingdom of norway, svalbard archipelago, permafrost, soil, depth 100-150cm2018-07-15v4No1 / 173
403amnon high in winter compared to summer in air kingdom of spain pyrenees autumn 2018-11-18v4No1 / 176
405amnoncommon mouse, mus musculus, research facility, feces, united states of america, swiss webster, ketogenic diet2018-11-20v4No1 / 177
515amnoncommon whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, onthophagus ruficapillus2019-04-18v4No1 / 178
530amnoncommon snake, deinagkistrodon acutus, pit viper, feces, snake farm, farm, adula, hunan province, china2019-07-21v4No1 / 178
179amnoncommon mus musculus, mouse, oral cavity, research facility, united states of america, balb/c, mouth2017-08-13v4No1 / 183
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 183
399amnoncommon feces, united states of america, research facility, rat, rattus norvegicus2018-11-16v4No1 / 184
495amnoncommon gallus gallus, chicken, caecum, broiler chicken, kingdom of spain, farm, age 4 weeks2019-03-03v4No1 / 185
299amnoncommon saliva, adult, homo sapiens, mouth neoplasm, cancer, china2018-02-27v4No1 / 188
73amnonhigh in children with Crohn's disease compared to healthy adult controls ( high in obsolete_juvenile stage child crohn's disease compared to control adult in homo sapiens feces glasgow )2017-02-26v4No1 / 189
197amnon high in india compared to finland in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 189
386amnoncommon mouse, mus musculus, caecum, wild, brazil2018-10-28v4No1 / 189
402amnon high in zone 1 compared to zone 2,3 in sediment soil mine tailing alkaline mine tailing guangxi zhuang autonomous region china 2018-11-18v4No1 / 189
495amnoncommon gallus gallus, chicken, caecum, kingdom of spain, farm, free range chicken, age 8 weeks2019-03-03v4No1 / 189
352amnon high in feces compared to small intestine duodenum in homo sapiens new delhi india 2018-07-30v4No1 / 190
75amnoncommon homo sapiens, skin, arm, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 191
80amnon high in dry forest compared to tropical moist broadleaf forest biome in feces alouatta pigra howler monkey central america state of florida 2017-03-03v4No1 / 193
109amnon high in water treatment plant compared to distribution system in usa water drinking water site c 2017-04-08v4No1 / 193
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, tributary, nepal, particle bound, filtered 2.7um2019-07-22v4No1 / 193
371amnoncommon homo sapiens, skin, amerindian, hunter gatherer, venezuela2018-09-06v4No1 / 195
312amnoncommon feces, homo sapiens, french republic, adult, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
80amnoncommon feces, alouatta pigra, howler monkey, tropical broadleaf forest biome, central america, woodland area2017-03-03v4No1 / 198
411amnoncommon zambia, feces, monkey, papio kindae, kinda baboon, wild2018-11-23v4No1 / 200
42amnoncommon in tcr-b deficient c57bl6 mice (common feces, research facility, mus musculus, c57bl/6, japan)2016-12-10v4No1 / 201
248amnoncommon mouse, mus musculus, research facility, fvb/n mice, germany, feces2017-11-22v4No1 / 203
405amnoncommon mouse, mus musculus, research facility, feces, united states of america, swiss webster, control diet2018-11-20v4No1 / 203
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
150amnoncommon canis lupus familiaris, dog, feces, united states of america2017-04-26v4No1 / 208
159amnoncommon siganidae, rabbitfish, hindgut, australia2017-07-06v4No1 / 208
542amnoncommon subgingival plaque, dentition, monkey, macaca mulatta, research facility, puerto rico, age 12-23 years, adult2019-08-01v4No1 / 208
388amnon high in age 6-10 weeks compared to age 12-19 weeks in pig sus scrofa tonsil farm united states of america state of michigan 2018-11-03v4No1 / 210
495amnoncommon gallus gallus, chicken, caecum, broiler chicken, kingdom of spain, farm, age 6 weeks2019-03-03v4No1 / 210
511amnoncommon snow, depth 0-5cm, lapland, finland, sweden, kingdom of norway2019-03-20v4No1 / 213
495amnoncommon gallus gallus, chicken, caecum, kingdom of spain, farm, free range chicken, age 12 weeks2019-03-03v4No1 / 214
520amnonhigher in gastric cancer compared to paired normal tissue ( high in gastric carcinoma stomach neoplasm compared to control in homo sapiens zhejiang province stomach adult china )2019-06-26v3No1 / 214
201amnonhigher in cactus fly compared to decaying cactus ( high in drosophila fly drosophila nigrospiracula compared to cactus decaying in mexico desert )2017-10-01v4No1 / 215
433amnoncommon sea water, ocean, depth 4m, south china sea, coast2018-12-19v4No1 / 215
108amnoncommon research facility, texas, united states of america, caecum, coturnix coturnix, common quail2017-04-07v4No1 / 216
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon homo sapiens, feces, adult, small village, rural community, china2018-02-01v4No1 / 218
347amnon high in depth 100-150cm depth 150-200cm compared to depth 20-30cm in kingdom of norway svalbard archipelago permafrost soil 2018-07-15v4No1 / 221
566amnoncommon adult, homo sapiens, china, feces2019-11-24v4No1 / 221
411amnoncommon zambia, feces, monkey, wild, papio ursinus, grayfoot chacma baboon2018-11-23v4No1 / 224
265amnoncommon in tree leaves (common canada, province of quebec, tree, leaf)2017-12-11v4No1 / 226
42amnoncommon in tcr-b deficient balb/c mice (common mus musculus, research facility, feces, balb/c, japan)2016-12-10v4No1 / 227
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 227
25amnon high in antibiotic compared to control in oryctolagus cuniculus caecum rex rabbit sichuan province research facility 2016-12-01v4No1 / 231
214amnonlower in mice from jackson laboratories compared to taconic farms ( high in taconic farms compared to jackson laboratories in mouse mus musculus feces united states of america research facility strain 129s )2017-10-23v4No1 / 232
349amnoncommon rattus, rat, feces, research facility, sprague dawley, male, china2018-07-29v4No1 / 235
78amnoncommon nanger granti, kenya, feces, tropical grassland biome, gazelle2017-03-01v4No1 / 236
495amnoncommon gallus gallus, chicken, caecum, kingdom of spain, farm, free range chicken, age 3 weeks2019-03-03v4No1 / 236
53amnon high in shantytown lima compared to el salado small village in homo sapiens feces city 2017-01-21v4No1 / 237
286amnoncommon in feces of individuals with kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, nephrolithiasis, china)2018-01-27v4No1 / 239
406amnoncommon feces, zoological garden, french republic, gorilla gorilla, monkey, gorilla2018-11-21v4No1 / 239
108amnoncommon research facility, texas, united states of america, caecum, mus musculus, mouse2017-04-07v4No1 / 241
220amnoncommon feces, united states of america, female, research facility, mus musculus, balb/c, high fat diet, mouse, diet2017-10-24v4No1 / 241
483amnoncommon hawaii, pearl harbor, research facility, hydroides elegans, tubeworm, united states of america, shelled egg2019-02-13v4No1 / 243
161amnoncommon in barn swallows in colorado (common hirundo rustica, feces, united states of america, colorado, barn swallow)2017-07-12v4No1 / 245
425amnon high in antananarivo madagascar compared to bangui central african republic in homo sapiens feces africa child 2018-12-08v4No1 / 248
351amnoncommon sea urchin, lytechinus variegatus, coelomic fluid, research facility, eagle harbor, state of florida, united states of america2018-07-30v4No1 / 249
429amnoncommon rat, rattus norvegicus, dahl salt-sensitive, feces, israel, research facility, salt rich diet, salt2018-12-13v4No1 / 249
219amnoncommon in mother mice feces (common mus musculus, mouse, feces, c57bl/6, research facility, female, south korea)2017-10-24v4No1 / 250
375amnonhigher in oil contaminated soil planted with plants compared to control oil contaminated soil ( high in rhizosphere planted soil compared to control in soil kuwait desert oil contaminated soil )2018-09-09v4No1 / 251
419amnoncommon rat, rattus norvegicus, sprague dawley, research facility, feces, china2018-12-02v4No1 / 254
214amnon high in diet high fat diet compared to nih-31m chow mouse chow in mouse mus musculus feces united states of america research facility 2017-10-23v4No1 / 255
503amnoncommon mouse, mus musculus, research facility, feces, balb/c, japan2019-03-12v4No1 / 257
220amnoncommon mus musculus, mouse, feces, research facility, united states of america, female, balb/c, diet, mouse chow, low fat diet2017-10-24v4No1 / 262
276amnoncommon feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 263
304amnoncommon united states of america, state of california, beach, pacific ocean, air, aerosol, monterey bay2018-03-12v4No1 / 263
253amnoncommon in clouds in puy de dome mountain in france (common cloud, french republic, air, autumn)2017-11-22v4No1 / 267
49amnoncommon giraffa camelopardalis, feces2017-01-19v4No1 / 268
78amnonhigher in older gazelles ( high in age old age compared to young age in nanger granti kenya feces tropical grassland biome gazelle )2017-03-01v4No1 / 273
406amnonhigher in captive white rhinoceros compared to wild ( high in zoological garden french republic compared to wild south africa in feces bovidae ceratotherium simum white rhinoceros )2018-11-21v4No1 / 277
160amnoncommon in river water upstream of WTP effluent in spring in china (common river, water, spring, china)2017-07-12v4No1 / 278
225amnoncommon in polgA mutants (accelerated aging) (common mouse, mus musculus, feces, research facility, polga mutant, united kingdom)2017-10-29v4No1 / 281
286amnoncommon in feces of individuals without kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, control, china)2018-01-27v4No1 / 281
384amnon high in barn hay compared to pasture in equus caballus horse canada farm saliva mouth 2018-10-22v4No1 / 283
495amnoncommon gallus gallus, chicken, caecum, kingdom of spain, farm, free range chicken, age 6 weeks2019-03-03v4No1 / 290
423amnoncommon bank vole, myodes glareolus, ukraine, skin2018-12-05v4No1 / 291
411amnoncommon feces, monkey, united states of america, zoological garden, papio anubis, olive baboon2018-11-23v4No1 / 292
237amnonlower in burrow soil compared to bird ( high in oceanodroma leucorhoa bird seabird compared to soil burrow in canada bon portage island )2017-11-07v4No1 / 298
419amnoncommon in rats with induced constipation (common rat, rattus norvegicus, sprague dawley, research facility, feces, constipation, china)2018-12-02v4No1 / 300
363amnoncommon ovis aries, age 30 days, obsolete_juvenile stage, italy, dairy, rumen, ruminant reticulum, omasum2018-08-29v4No1 / 302
78amnon high in male compared to female in nanger granti kenya feces tropical grassland biome gazelle 2017-03-01v4No1 / 304
80amnoncommon feces, central america, alouatta palliata, mantled howler monkey, state of florida2017-03-03v4No1 / 309
358amnoncommon rattus, rat, research facility, wistar rat, czech republic, feces2018-08-19v4No1 / 309
80amnon high in dry forest compared to tropical moist broadleaf forest biome in feces central america alouatta palliata mantled howler monkey state of florida 2017-03-03v4No1 / 314
208amnoncommon mus musculus, mouse, feces, united states of america, state of texas, balb/c2017-10-06v4No1 / 316
510amnoncommon kingdom of spain, water, estuary, estuary water, fresh water, salinity <5 ppt, bilbao2019-03-20v4No1 / 317
299amnon high in mouth neoplasm cancer compared to control in saliva adult homo sapiens china 2018-02-27v4No1 / 319
515amnoncommon whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, onthophagus ovatus2019-04-18v4No1 / 322
518amnonhigher in beginning of experiment ( high in days 1-2 compared to days 14-28 in bos taurus cow feces united states of america state of georgia post-weaning angus steer )2019-06-11v4No1 / 325
429amnoncommon rat, rattus norvegicus, dahl salt-sensitive, feces, israel, research facility, control diet2018-12-13v4No1 / 327
61amnoncommon canis lupus familiaris, skin, research facility, united states of america, inguinal region2017-02-05v4No1 / 328
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
400amnonlower in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in karen myanmar compared to hmong china in homo sapiens feces thailand rural community )2018-11-18v4No1 / 329
111amnoncommon mongolian sheep, ovis aries, rectum, ileum, cecum, colon, china2017-04-09v4No1 / 330
433amnoncommon sea water, ocean, depth 4m, indian ocean2018-12-19v4No1 / 333
423amnon high in human contact compared to no human contact chernobyl exclusion zone in bank vole myodes glareolus ukraine skin 2018-12-05v4No1 / 334
351amnoncommon in artificial sea water where sea urchins were grown (common sea urchin, lytechinus variegatus, research facility, state of florida, united states of america, artificial seawater, sea water)2018-07-30v4No1 / 338
124amnoncommon mus musculus, mouse, caecum, feces, c57bl/6j, united states of america2017-04-14v4No1 / 339
190amnon high in wet season compared to dry season in homo sapiens tanzania hadza hunter gatherer feces 2017-09-04v4No1 / 341
93amnoncommon in seawater near the shore in hawaii (common hawaii, sea water, shore)2017-03-12v4No1 / 345
254amnoncommon river, water, fresh water, depth 0.5m, jiulong river, fujian province, china2017-11-23v4No1 / 347
254amnonhigher in river when close to populated region compared to downstream ( high in city populated place upstream compared to downstream in river water fresh water depth 0.5m jiulong river fujian province china )2017-11-23v4No1 / 356
442amnoncommon in tnbs induced colitis in rat feces (common rattus norvegicus, rat, sprague dawley, male, research facility, feces, tnbs, colitis, china)2019-01-06v4No1 / 360
341amnonhigher in fresh drinking water compared to week old water ( high in fresh water compared to stagnant water in water drinking water united states of america tap water state of illinois )2018-05-28v4No1 / 365
225amnoncommon in wild type cotrols (common mouse, mus musculus, feces, research facility, wild type genotype, united kingdom)2017-10-29v4No1 / 370
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
160amnoncommon in river water upstream of WTP effluent in autumn in china (common river, water, autumn, china)2017-07-12v4No1 / 376
400amnonhigher in people from thailand compared to 2nd generation immigrants to usa ( high in thailand rural community compared to united states of america in homo sapiens feces )2018-11-18v4No1 / 378
29amnon high in seed compared to seedling in brassica oleracea french republic 2016-12-05v4No1 / 379
458amnonlower in A/J strain compared to BALB/c and C57BL/6 strains ( high in balb/c c57bl/6 compared to a/j in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 379
256amnoncommon sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 380
314amnoncommon caecum, cecal content, tibet autonomous region, farm, sus scrofa, pig, china2018-04-10v4No1 / 402
347amnoncommon kingdom of norway, svalbard archipelago, permafrost, soil, depth 0-20cm, permafrost active layer2018-07-15v4No1 / 405
558amnon high in gizzard compared to crop in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 408
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
515amnoncommon whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, aphodius pusillus2019-04-18v4No1 / 421
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, grivet monkey2018-01-16v4No1 / 440
75amnoncommon homo sapiens, venezuela, feces, amerindian, hunter gatherer2017-02-27v4No1 / 442
371amnonhigher in amerindians compared to western visitors ( high in hunter gatherer amerindian venezuela compared to city united states of america in feces homo sapiens )2018-09-06v4No1 / 443
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, vervet monkey2018-01-16v4No1 / 446
399amnoncommon feces, united states of america, zoological garden, state of tennessee, ovis aries, sheep2018-11-16v4No1 / 451
424amnoncommon sus scrofa, pig, jinhua city prefecture, jinhua pig, feces, farm, china2018-12-06v4No1 / 452
470amnoncommon sus scrofa, pig, canada, farm, province of quebec, feces, female, adult, pregnancy2019-01-14v4No1 / 457
111amnon high in rectum caecum ileum colon compared to rumen ruminant reticulum omasum in mongolian sheep ovis aries china 2017-04-09v4No1 / 464
406amnoncommon feces, zoological garden, french republic, connochaetes taurinus, blue wildebeest2018-11-21v4No1 / 467
160amnoncommon in wastewater treatment plant effluent in autumn in china (common autumn, wastewater treatment plant, effluent, china)2017-07-12v4No1 / 469
276amnon high in peru small village tunapuco rural community compared to united states of america city state of oklahoma in feces homo sapiens adult 2018-01-22v4No1 / 469
221amnoncommon rattus, sprague dawley, rat, feces, research facility, china2017-10-25v4No1 / 470
406amnoncommon feces, zoological garden, ceratotherium simum, white rhinoceros, french republic2018-11-21v4No1 / 474
406amnoncommon feces, zoological garden, french republic, antidorcas marsupialis, springbok2018-11-21v4No1 / 477
454amnoncommon feces, elaphurus davidianus, pere deer, deer, wild, china2019-01-10v4No1 / 480
236amnoncommon state of california, bodega bay, ocean, zostera marina, marine eelgrass, root2017-11-07v4No1 / 483
438amnon high in age 30-50 age 60-79 adult compared to age 3-6 age 8-12 child in homo sapiens feces china 2018-12-30v4No1 / 486
274amnoncommon monkey, chlorocebus djamdjamensis, bale monkey, ethiopia, feces2018-01-16v4No1 / 489
256amnoncommon sus scrofa, pig, caecum, right colon, left colon, united kingdom2017-11-26v4No1 / 490
518amnoncommon bos taurus, cow, feces, united states of america, state of georgia, post-weaning, angus steer2019-06-11v4No1 / 498
304amnoncommon united states of america, state of california, beach, pacific ocean, air, aerosol, santa cruz province2018-03-12v4No1 / 518
27amnoncommon bos grunniens, rumen, china2016-12-05v4No1 / 532
209amnonlower in whale blow condensate compared to ocean water ( high in sea water ocean depth 25cm compared to megaptera novaeangliae humpback whale respiratory airway whale blow exhaled air condensate in north america )2017-10-15v4No1 / 560
254amnon high in summer wet season autumn compared to winter dry season in river water fresh water depth 0.5m jiulong river fujian province china 2017-11-23v4No1 / 571
160amnoncommon in wastewater treatment plant effluent in spring in china (common wastewater treatment plant, effluent, spring, china)2017-07-12v4No1 / 573
254amnon high in summer wet season compared to winter dry season autumn in river water fresh water depth 0.5m jiulong river fujian province china 2017-11-23v4No1 / 581
84amnoncommon soil, peatland, peat soil, sphagnum bog, temperate grassland biome, depth 20cm, wetland area2017-03-06v4No1 / 590
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in kingdom of spain water estuary estuary water bilbao 2019-03-20v4No1 / 592
318amnoncommon canada, vancouver, ocean, pacific ocean, red alga, mastocarpus2018-04-16v4No1 / 598
406amnoncommon feces, zoological garden, diceros bicornis, black rhinoceros, united states of america, switzerland2018-11-21v4No1 / 600
517amnon high in feces compared to skin arm forearm in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 606
265amnonhigher in tree leaves compared to soil and soilwater ( high in leaf tree compared to soil soilwater water in canada province of quebec )2017-12-11v4No1 / 610
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in homo sapiens feces china )2018-12-30v4No1 / 617
264amnoncommon oryctolagus cuniculus, rex rabbit, caecum, research facility, jiangsu province, china2017-12-11v4No1 / 622
458amnonhigher in mice from hsd compared to jackson laboratories ( high in harlan sprague dawley compared to jackson laboratories in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 644
443amnonhigher in lower mississippi river (downstream) compared to upper mississippi river ( high in downstream lower mississippi river compared to upstream higher mississippi river in mississippi river water river fresh water depth 1m united states of america free floating filtered 0.2um )2019-01-07v4No1 / 652
103amnonlower in particle bound fraction compared to free floating bacteria in mississippi river ( high in free floating compared to particle in river united states of america mississippi river fresh water aquatic biome )2017-04-05v4No1 / 653
25amnoncommon oryctolagus cuniculus, caecum, rex rabbit, sichuan province, research facility2016-12-01v4No1 / 669
406amnoncommon feces, south africa, antidorcas marsupialis, springbok2018-11-21v4No1 / 678
347amnoncommon kingdom of norway, svalbard archipelago, permafrost, soil, depth 20-30cm2018-07-15v4No1 / 698
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 752
206amnoncommon in air from israel particles <10um size (common air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 765
157amnoncommon in naers of weened calves (common nasal cavity, bos taurus, calve, united states of america, juvenile organism, pair of nares)2017-07-04v4No1 / 766
454amnon high in summer compared to winter in elaphurus davidianus pere deer deer feces china 2019-01-10v4No1 / 791
371amnonhigher in skin of amerindians compared to western visitors ( high in venezuela hunter gatherer amerindian compared to city united states of america in homo sapiens skin )2018-09-06v4No1 / 854
479amnoncommon rhizosphere, united states of america, state of california, ph 6-7, ceanothus jepsonii2019-02-05v4No1 / 900
206amnoncommon in dust storm air from israel particles <10um size (common israel, air, size < 10um, dust, dust storm)2017-10-04v4No1 / 902
103amnoncommon river, united states of america, mississippi river, fresh water, aquatic biome, particle2017-04-05v4No1 / 909
103amnoncommon river, united states of america, mississippi river, fresh water, aquatic biome, free floating2017-04-05v4No1 / 909
359amnoncommon soil, topsoil, depth 0-10cm, guangdong province, subtropical broadleaf forest biome, china, forest ecosystem, woodland area2018-08-19v4No1 / 935
479amnoncommon rhizosphere, united states of america, state of california, heteromeles arbutifolia, ph 6-72019-02-05v4No1 / 1006
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014
83amnon high in diet control normal diet compared to restricted diet in bos taurus rumen holstein-friesian bull ireland 2017-03-05v4No1 / 1023
406amnoncommon feces, zoological garden, hippotragus niger, sable antelope, french republic2018-11-21v4No1 / 1075
252amnoncommon in river rock biofilm (common kingdom of spain, biofilm, river, rock, epilithic)2017-11-22v4No1 / 1081
478amnoncommon farm, shrimp farm, sediment, china2019-02-19v4No1 / 1085
454amnon high in wild compared to captive in elaphurus davidianus pere deer deer feces china 2019-01-10v4No1 / 1094
93amnoncommon in marine sediment near the shore in hawaii (common hawaii, shore, marine sediment)2017-03-12v4No1 / 1151
266amnon high in leaf compared to root in brassicaceae boechera stricta plant united states of america state of idaho 2017-12-19v4No1 / 1175
252amnoncommon in river sand biofilm (common river, biofilm, kingdom of spain, sand)2017-11-22v4No1 / 1181
223amnoncommon ocean, sediment, east china sea, marine sediment, china2017-10-26v4No1 / 1311
40amnoncommon soil, field soil, nicotiana tabacum, rhizosphere, china2016-12-09v4No1 / 1420
76amnoncommon in seleniferous soil (common soil, rhizosphere, united states of america, selenium, seleniferous, woodland area)2017-02-28v4No1 / 1438
271amnoncommon rhizosphere, glycine max, depth 0-20cm, soybean, china2018-01-09v4No1 / 1459
515amnon high in detritivorous beetle bulgaria compared to herbivorous beetle poland in whole body beetle 2019-04-19v4No1 / 1543
304amnoncommon united states of america, state of california, beach, pacific ocean, sand, santa cruz province2018-03-12v4No1 / 1838
155amnoncommon in soil tightly bound to wheat root (common triticum aestivum, wheat, soil, root, china)2017-07-02v4No1 / 1977
175amnoncommon in heavy metal contaminated soils in china (common soil, heavy metal, ph 7-9, china)2017-07-29v4No1 / 2133
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>6, ph<7, china2018-02-11v4No1 / 2223
296amnoncommon in wheat field soil (common soil, north china plain, depth 5cm, agricultural feature, wheat, winter, china)2018-02-11v4No1 / 2341
155amnoncommon in soil loosely bound to wheat root (common triticum aestivum, wheat, soil, rhizosphere, china)2017-07-02v4No1 / 2425
155amnoncommon in bulk soil in wheat field (common triticum aestivum, wheat, soil, bulk soil, china)2017-07-02v4No1 / 2594
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>8, china2018-02-11v4No1 / 2646
265amnon high in soil compared to soilwater water in canada province of quebec 2017-12-11v4No1 / 2715
271amnoncommon depth 0-20cm, soil, china2018-01-09v4No1 / 2856
84amnoncommon soil, temperate grassland biome, fen, peat soil, flooded grassland biome, depth 20 cm, united kingdom2017-03-06v4No1 / 2866
84amnoncommon soil, temperate grassland biome, fen, peat soil, flooded grassland biome, depth 5 cm, united kingdom2017-03-07v4No1 / 3434
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>5, ph<6, china2018-02-11v4No1 / 3508
271amnon high in soil compared to rhizosphere glycine max soybean in depth 0-20cm china 2018-01-09v4No1 / 4853
171amnonlower in roots compared to rhizosphere soil in rice ( high in rhizosphere soil compared to root in united states of america state of california oryza sativa rice )2017-07-25v4No1 / 7628

Problems / suggestions? Please email info AT dbbact DOT org