Search result for sequence:
TACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCTGATACTGGCAAGCTTGAGTCTCGTAGAGGGGGGTAGAATTCCAGG
common ontology terms
term enrichment score
TermScore
feces0.640726
homo sapiens0.507134
united states of america0.369684
adult0.247469
china0.224032
research facility0.197011
mus musculus0.117506
child0.115556
infant0.112010
farm0.108959
mouse0.104395
caecum0.085481
LOWER IN control0.072685
city0.072196
female0.064570
rural community0.062827
canis lupus familiaris0.062069
soil0.062053
kingdom of spain0.059406
obsolete_juvenile stage0.059406
state of california0.058632
gallus gallus0.057629
chicken0.057629
zoological garden0.054475
control0.051873
skin0.051306
sus scrofa0.049706
pig0.049706
dog0.049501
water0.048426
india0.047518
australia0.046095
united kingdom0.042296
monkey0.042254
state of michigan0.042194
river0.041667
colon0.040323
diarrhea0.039814
bird0.039788
canada0.039164
fresh water0.038536
french republic0.037194
crohn's disease0.037135
rectum0.037135
wild0.036649
nepal0.034414
israel0.034238
jiangsu province0.034121
hospital0.031983
larval stage0.031767
rat0.031722
kingdom of norway0.031579
kingdom of denmark0.031579
age0.031524
digestive system0.030908
beetle0.029236
duodenum0.029193
air0.029094
colombia0.026720
hunter gatherer0.026690
broiler chicken0.026631
africa0.026455
texas0.025773
mexico0.024088
depth 0-20cm0.024064
balb/c0.024064
age < 3 years0.024016
biopsy0.023968
ulcerative colitis0.023944
ileum0.023873
bulgaria0.023873
detritivorous beetle0.023873
himalayas0.023873
ocean0.023684
japan0.023661
diet0.023626
whole body0.023316
costa rica0.021390
tonsil0.021390
finland0.021333
woodland0.021333
rattus norvegicus0.021333
balkan mountains0.021277
free range chicken0.021277
italy0.021053
rhizosphere0.020864
intestine0.020779
age < 1 year0.018798
amerindian0.018754
venezuela0.018754
wheat0.018754
LOWER IN united states of america0.018737
nasal cavity0.018702
adula0.018667
snake farm0.018667
ovis aries0.018667
stomach0.018597
LOWER IN adult0.018592
snake0.018494
c57bl/60.018494
Fraction of dbbact annotations with this term covered by the query
TermScore
diarrhea0.857143
rural community0.857143
bird0.833333
india0.833333
french republic0.833333
hospital0.833333
gallus gallus0.800000
chicken0.800000
age < 1 year0.800000
mexico0.800000
colombia0.800000
united kingdom0.777778
crohn's disease0.777778
rectum0.777778
child0.764706
hunter gatherer0.750000
monkey0.750000
small village0.750000
depth 0-20cm0.750000
state of arizona0.750000
balb/c0.750000
feces0.728205
state of michigan0.714286
city0.705882
sus scrofa0.666667
pig0.666667
felis catus0.666667
giraffa camelopardalis0.666667
infant0.666667
age 2 months0.666667
broiler chicken0.666667
age 2 weeks0.666667
jejunum0.666667
costa rica0.666667
dust0.666667
amerindian0.666667
venezuela0.666667
beetle0.666667
filtered 0.2um0.666667
nepal0.666667
tanzania0.666667
tonsil0.666667
obesity0.666667
sinusoidal space0.666667
paranasal sinus0.666667
sinusitis0.666667
cebus capucinus0.666667
white-faced capuchin0.666667
horse0.666667
uropygial gland0.666667
nigeria0.666667
anser cygnoides0.666667
acinonyx jubatus0.666667
age < 3 years0.666667
atlanta0.666667
LOWER IN hindgut0.666667
human contact0.666667
graz city district0.666667
tibet autonomous region0.666667
state of oklahoma0.666667
fish feed0.666667
heterosexual0.666667
msw0.666667
homosexual0.666667
gay0.666667
msm0.666667
metabolic syndrome0.666667
hot spring0.666667
geothermal field0.666667
LOWER IN rumen0.666667
arm0.666667
seed0.666667
state of texas0.666667
province of quebec0.666667
rex rabbit0.666667
wheat0.666667
homo sapiens0.653333
canis lupus familiaris0.642857
duodenum0.625000
LOWER IN united states of america0.625000
larval stage0.615385
dog0.600000
flower0.600000
zoological garden0.600000
age 4 weeks0.600000
kingdom of spain0.600000
free floating0.600000
clostridium difficile intestinal infectious disease0.600000
biopsy0.600000
obsolete_juvenile stage0.600000
egg0.600000
colitis0.600000
adult0.594595
rat0.583333
caecum0.571429
ulcerative colitis0.571429
finland0.571429
woodland0.571429
rattus norvegicus0.571429
sprague dawley0.571429
Fraction of annotations for the query sequences containing the term
TermScore
feces0.572011
homo sapiens0.414402
united states of america0.285326
adult0.156250
china0.145380
research facility0.123641
mus musculus0.066576
child0.062500
infant0.061141
farm0.061141
mouse0.058424
caecum0.046196
LOWER IN control0.042120
city0.038043
soil0.035326
female0.035326
canis lupus familiaris0.032609
rural community0.032609
control0.031250
state of california0.031250
kingdom of spain0.031250
obsolete_juvenile stage0.031250
gallus gallus0.029891
chicken0.029891
zoological garden0.028533
skin0.027174
water0.027174
sus scrofa0.025815
pig0.025815
dog0.025815
india0.024457
australia0.024457
united kingdom0.021739
colon0.021739
state of michigan0.021739
river0.021739
monkey0.021739
diarrhea0.020380
bird0.020380
fresh water0.020380
canada0.020380
crohn's disease0.019022
french republic0.019022
wild0.019022
rectum0.019022
israel0.017663
nepal0.017663
jiangsu province0.017663
larval stage0.016304
age0.016304
kingdom of norway0.016304
hospital0.016304
kingdom of denmark0.016304
digestive system0.016304
rat0.016304
duodenum0.014946
air0.014946
beetle0.014946
texas0.013587
broiler chicken0.013587
hunter gatherer0.013587
colombia0.013587
africa0.013587
ileum0.012228
japan0.012228
ocean0.012228
diet0.012228
bulgaria0.012228
detritivorous beetle0.012228
whole body0.012228
mexico0.012228
himalayas0.012228
biopsy0.012228
ulcerative colitis0.012228
depth 0-20cm0.012228
age < 3 years0.012228
balb/c0.012228
intestine0.010870
costa rica0.010870
balkan mountains0.010870
tonsil0.010870
italy0.010870
finland0.010870
free range chicken0.010870
woodland0.010870
rattus norvegicus0.010870
rhizosphere0.010870
age < 1 year0.009511
stomach0.009511
hunan province0.009511
adula0.009511
snake farm0.009511
snake0.009511
amerindian0.009511
venezuela0.009511
c57bl/60.009511
ovis aries0.009511
nasal cavity0.009511
south africa0.009511
LOWER IN adult0.009511
Exp. ID User ID Description Date Region Flag Sequences
117amnonlower in sox10 mutant fish with high neutrophil count ( high in low neutrophils control compared to high neutrophils neutrophil hirschprung disease in zebra fish danio rerio research facility larval stage united states of america intestine )2017-04-10v4No1 / 1
207amnonhigher in people hospitalized with diarrhea compared to healthy controls ( high in diarrhea compared to control in pathogen homo sapiens israel feces )2017-10-05v4No1 / 1
256amnonhigher in illeum compared to other gi tract locations in pigs ( high in ileum compared to duodenum jejunum caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 1
234amnoncandidate contaminant (high in blank) (contamination)2017-11-07v4No1 / 2
16amnon high in diarrhea compared to control in felis catus state of california feces 2016-11-08v4No1 / 3
127amnonhigh in young (0-3 days) compared to old (28 day) chickens ( high in age young age compared to old age in gallus gallus chicken united states of america caecum )2017-04-14v4No1 / 3
399amnon high in crohn's disease compared to ulcerative colitis in feces united states of america homo sapiens 2018-11-16v4No1 / 3
456amnonreagent contaminant (high in blanks) in mouse nasopharynx study (contamination)2019-01-10v4No1 / 3
320amnonlower in CD patients with remission ( high in crohn's disease compared to remission in homo sapiens feces adult )2018-04-19v4No1 / 4
440amnoncommon galapagos islands, feces, bird, finch, geospiza fortis, medium ground finch2019-01-06v4No1 / 4
301amnon high in duodenum ileum compared to colon rectum in canis lupus familiaris dog united states of america 2018-03-05v4No1 / 5
49amnonincreases during sample storage in giraffe feces (other giraffa camelopardalis, feces)2017-01-19v4No1 / 6
108amnonhighfreq research facility, texas, united states of america, colon, quail, coturnix coturnix2017-04-07v4No1 / 6
347amnonhighfreq kingdom of norway, svalbard archipelago, permafrost, soil, depth 100-150cm2018-07-15v4No1 / 6
207amnoncommon in people hospitalized with diarrhea (common homo sapiens, israel, feces, diarrhea)2017-10-05v4No1 / 7
56amnonhighfreq nicotiana glauca, israel, flower, nectar2017-01-30v4No1 / 8
262amnonhighfreq tick, ixodes scapularis, larval stage, body proper, research facility2017-12-10v4No1 / 8
332amnoncommon homo sapiens, infant, india, vellore district, city, age 2 months2018-05-14v4No1 / 8
406amnonhighfreq feces, equus przewalskii, przewalski horse, zoological garden, united states of america2018-11-21v4No1 / 8
406amnonhighfreq feces, zoological garden, french republic, connochaetes taurinus, blue wildebeest2018-11-21v4No1 / 8
406amnonhighfreq feces, zoological garden, united states of america, myrmecophaga tridactyla, giant anteater2018-11-21v4No1 / 8
440amnoncommon galapagos islands, feces, bird, finch, geospiza difficilis, sharp-beaked ground finch2019-01-06v4No1 / 8
454amnonhighfreq feces, china, elaphurus davidianus, pere deer, deer, wild2019-01-10v4No1 / 8
516amnoncommon urine, adult, state of ohio, united states of america, homo sapiens2019-05-29v4No1 / 8
92amnoncommon air, japan2017-03-09v4No1 / 9
301amnonhighfreq canis lupus familiaris, dog, united states of america, duodenum2018-03-05v4No1 / 9
332amnonhighfreq homo sapiens, infant, india, vellore district, city, age 2 months2018-05-14v4No1 / 9
391amnoncommon feces, infant, age < 1 year, diarrhea, china, hospital2018-11-04v4No1 / 9
399amnonhighfreq feces, united states of america, mustela putorius furo, ferret2018-11-16v4No1 / 9
423amnonhighfreq bank vole, myodes glareolus, ukraine, skin2018-12-05v4No1 / 9
497amnonhighfreq chicken, gallus gallus, broiler chicken, austria, farm, feces, age 2 weeks2019-03-04v4No1 / 9
10amnon high in female compared to male in homo sapiens feces toronto 2016-10-27v4No1 / 10
71amnonhighfreq liolaemus ruibali, small intestine, argentina, research facility2017-02-25v4No1 / 10
78amnonhighfreq nanger granti, kenya, feces, tropical grassland biome, gazelle2017-03-01v4No1 / 10
117amnonhighfreq zebra fish, danio rerio, research facility, larval stage, united states of america, intestine2017-04-10v4No1 / 10
152amnonhigh in blanks compares to dust/nose samples (contamination)2017-05-04v4No1 / 10
177amnonblooming bacteria (grows in storage at room temp.) (contamination)2017-07-30v4No1 / 10
234amnoncommon homo sapiens, lung, united states of america2017-11-07v4No1 / 10
256amnonhighfreq sus scrofa, pig, united kingdom, duodenum, jejunum, ileum2017-11-26v4No1 / 10
408amnoncommon ant, costa rica, united states of america, pseudomyrmex elongatus, stomach2018-11-22v4No1 / 10
497amnonhighfreq chicken, gallus gallus, broiler chicken, austria, farm, feces, age 4 weeks2019-03-04v4No1 / 10
530amnonhighfreq king ratsnake, elaphe carinata, hunan province, adula, china, farm, snake farm, feces, snake2019-07-21v4No1 / 10
544amnonhighfreq fruit, commonwealth of massachusetts, united states of america, american cranberry, vaccinium macrocarpon2019-08-04v4No1 / 10
206amnonhigh freq. in air from israel particles <10um size (highfreq air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 11
371amnonhighfreq feces, homo sapiens, hunter gatherer, amerindian, venezuela2018-09-06v4No1 / 11
391amnonhighfreq feces, infant, age < 1 year, diarrhea, china, hospital2018-11-04v4No1 / 11
406amnonhighfreq feces, zoological garden, french republic, antidorcas marsupialis, springbok2018-11-21v4No1 / 11
418amnonhighfreq coral, ocean, pocillopora damicornis, mucus2018-12-02v4No1 / 11
513amnonhighfreq china, waste water, hospital, city, xinxiang city prefecture2019-03-25v4No1 / 11
71amnonhighfreq liolaemus ruibali, argentina, research facility, stomach2017-02-25v4No1 / 12
89amnonhighfreq junco hyemalis, commonwealth of virginia, songbird, cloaca2017-03-08v4No1 / 12
161amnonhigh freq. in barn swallows in colorado (highfreq hirundo rustica, feces, united states of america, colorado, barn swallow)2017-07-12v4No1 / 12
206amnonhigh freq. in dust storm air from israel particles <10um size (highfreq israel, air, size < 10um, dust, dust storm)2017-10-04v4No1 / 12
231amnonhigh freq. in dog genitalia (highfreq dog, canis lupus familiaris, united states of america, reproductive system, reproductive organ, genitalia)2017-11-02v4No1 / 12
301amnonhighfreq canis lupus familiaris, dog, united states of america, ileum2018-03-05v4No1 / 12
381amnoncommon bird, isla de salvora, kingdom of spain, age 8 days, feces, larus michahellis, gull2018-10-22v4No1 / 12
408amnonhighfreq ant, cephalotes, costa rica, united states of america, larval stage2018-11-22v4No1 / 12
440amnonhighfreq galapagos islands, feces, bird, finch, geospiza difficilis, sharp-beaked ground finch2019-01-06v4No1 / 12
495amnonhighfreq gallus gallus, chicken, caecum, broiler chicken, age 3 days, kingdom of spain, farm2019-03-03v4No1 / 12
48amnonhighfreq homo sapiens, kingdom of denmark, infant, hypopharynx2017-01-19v4No1 / 13
210amnonhigher in bangladeshi diet compared to american diet in mice with american human FMT ( high in bangladesh diet diet compared to american diet in feces research facility mus musculus mouse humanized mouse )2017-10-21v4No1 / 13
241amnonhigher in babies age <1 year compared to age 1-3 years ( high in age < 1 year age compared to age 1-3 years in homo sapiens feces infant )2017-11-13v4No1 / 13
243amnonhighfreq beetle, anoplophora glabripennis, digestive system, united states of america2017-11-15v4No1 / 13
389amnonhighfreq pig, sus scrofa, vagina, united states of america, state of michigan, farm2018-11-04v4No1 / 13
405amnonhighfreq mouse, mus musculus, research facility, feces, united states of america, swiss webster, ketogenic diet2018-11-20v4No1 / 13
515amnonhighfreq onthophagus similis, balkan mountains, bulgaria, feces, detritivorous beetle, beetle, whole body2019-04-18v4No1 / 13
516amnonhighfreq urine, adult, state of ohio, united states of america, homo sapiens2019-05-29v4No1 / 13
530amnonhighfreq chinese cobra, naja atra, hunan province, adula, china, farm, snake farm, feces, snake2019-07-21v4No1 / 13
534amnonhighfreq filtered 0.2um, free floating, nepal, tributary, koshi river, depth 10 cm, fresh water, water, river2019-07-22v4No1 / 13
129amnonfound INSIDE leaves of cactus (common mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, leaf, leaf interior)2017-04-15v4No1 / 14
185amnoncommon in patients with c. diff infection before treatment (common homo sapiens, feces, united states of america, state of minnesota, clostridium difficile intestinal infectious disease)2017-08-20v4No1 / 14
190amnonhighfreq homo sapiens, tanzania, hadza, hunter gatherer, feces2017-09-04v4No1 / 14
232amnoncommon in foot ulcer of diabetic patients (common homo sapiens, skin, australia, foot, diabetes mellitus, wound, ulcer)2017-11-05v4No1 / 14
290amnon high in city compared to rural community small village in homo sapiens feces china adult 2018-02-01v4No1 / 14
302amnonhigh freq. in feces of Cockatiel pet birds (highfreq bird, mexico, feces, pet, nymphicus hollandicus, cockatiel)2018-03-05v4No1 / 14
389amnonhighfreq pig, sus scrofa, united states of america, state of michigan, farm, tonsil, age 8 hours2018-11-04v4No1 / 14
400amnonhigh freq. in karen (burma) females from thailand (highfreq homo sapiens, feces, adult, female, thailand, karen, myanmar)2018-11-18v4No1 / 14
404amnon high in high bmi obesity compared to lean body mass low bmi in homo sapiens feces adult colombia city 2018-11-20v4No1 / 14
406amnonhighfreq feces, zoological garden, united states of america, giraffa camelopardalis, giraffe2018-11-21v4No1 / 14
438amnonhighfreq feces, homo sapiens, china, age >94, adult, jiangsu province2018-12-30v4No1 / 14
477amnonhighfreq homo sapiens, feces, adult, nepal, himalayas, rural community, tharu, agrarian2019-01-28v4No1 / 14
499amnonhighfreq ranatra, water stick-insect, brazil, pond, digestive system, intestine2019-03-05v4No1 / 14
515amnonhighfreq onthophagus ruficapillus, balkan mountains, bulgaria, feces, detritivorous beetle, beetle, whole body2019-04-18v4No1 / 14
530amnonhighfreq oriental ratsnake, ptyas mucosa, hunan province, adula, china, farm, snake farm, feces, snake2019-07-21v4No1 / 14
42amnonhigher on stressed mice compared to control in c57bl tcr-b deficient mice ( high in stress compared to control in c57bl/6 mus musculus research facility japan feces )2016-12-10v4No1 / 15
48amnoncommon homo sapiens, kingdom of denmark, infant, hypopharynx2017-01-19v4No1 / 15
51amnonhighfreq feces, homo sapiens, united states of america2017-01-19v4No1 / 15
159amnonhighfreq siganidae, rabbitfish, hindgut, australia2017-07-06v4No1 / 15
228amnonhigh freq. in sinus brush of sinusitis patients (highfreq homo sapiens, mucosa, sinusoidal space, paranasal sinus, united states of america, sinusitis)2017-10-31v4No1 / 15
339amnonhighfreq homo sapiens, feces, india, infant, age < 1 year2018-05-24v4No1 / 15
405amnonhighfreq mouse, mus musculus, research facility, feces, united states of america, swiss webster, control diet2018-11-20v4No1 / 15
409amnonhighfreq homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 15
425amnonhighfreq homo sapiens, feces, africa, child, central african republic, bangui2018-12-08v4No1 / 15
425amnonhighfreq homo sapiens, feces, africa, child, madagascar, antananarivo2018-12-08v4No1 / 15
502amnonhighfreq homo sapiens, feces, adult, united states of america, schizophrenia2019-03-12v4No1 / 15
15amnonhighfreq namibia, feces, canis mesomelas2016-11-08v4No1 / 16
19amnonhigh freq in biopsies of children (IBD study) (highfreq rectum, terminal ileum, sigmoid colon, caecum, colon, biopsy, children, homo sapiens, united states of america)2016-11-14v4No1 / 16
46amnonsmj: higher in female mice feces treated with antibiotics ( high in antibiotic pulsed antibiotic treatment, macrolide tylosin tartrate compared to control in feces mus musculoides united states of america nyulmc nod/shiltj (no. 001976, jackson labs) research facility female )2017-01-12v4No1 / 16
49amnonhighfreq giraffa camelopardalis, feces2017-01-19v4No1 / 16
94amnoncommon homo sapiens, clostridium difficile intestinal infectious disease, feces, state of michigan, diarrhea2017-03-12v4No1 / 16
150amnonlow in healthy dogs compared to EPI dogs recieving enzyme supplementation ( high in exocrine pancreatic insufficiency enzyme supplementation compared to control in canis lupus familiaris dog feces united states of america )2017-04-26v4No1 / 16
229amnonhigh freq. in sinuses from chronic rhinosinositis patients (highfreq homo sapiens, paranasal sinus, sinusoidal space, sinusitis, australia)2017-10-31v4No1 / 16
273amnoncommon feces, homo sapiens, kingdom of denmark, infant, age one month2018-01-14v4No1 / 16
310amnonhighfreq homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 16
352amnonhighfreq homo sapiens, feces, india, new delhi2018-07-30v4No1 / 16
363amnonhighfreq ovis aries, age 30 days, obsolete_juvenile stage, italy, dairy, caecum, colon, rectum2018-08-29v4No1 / 16
365amnonhighfreq homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 16
395amnonhigher in kids with ibd compared to healthy donors ( high in child inflammatory bowel disease crohn's disease ulcerative colitis compared to control in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 16
407amnonhighfreq costa rica, feces, monkey, cebus capucinus, white-faced capuchin, wild2018-11-21v4No1 / 16
440amnonhighfreq galapagos islands, feces, bird, finch, geospiza fortis, medium ground finch2019-01-06v4No1 / 16
448amnonhighfreq equus caballus, horse, feces, united kingdom, farm, equine grass sickness, disease2019-01-08v4No1 / 16
159amnonhighfreq siganidae, rabbitfish, australia, midgut2017-07-06v4No1 / 17
215amnonhigher in people with Roux-en-Y gastric bypass compared to controls ( high in gastric bypass compared to control in homo sapiens feces united states of america )2017-10-23v4No1 / 17
227amnonhigh freq. in baby nasopharynx age <= 1 day (highfreq homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, age <= 24 hours)2017-10-30v4No1 / 17
237amnonhighfreq bird, oceanodroma leucorhoa, seabird, canada, bon portage island, uropygial gland2017-11-07v4No1 / 17
337amnonhigh freq. in feces of house mice from new york city (highfreq mus musculus, house mice, mouse, new york city, united states of america, city)2018-05-18v4No1 / 17
352amnonhigh freq. in duodenal biopsies (highfreq homo sapiens, india, new delhi, duodenum, small intestine)2018-07-30v4No1 / 17
365amnonhighfreq homo sapiens, feces, child, obsolete_juvenile stage, nigeria2018-08-30v4No1 / 17
368amnonhighfreq feces, homo sapiens, commonwealth of virginia, united states of america, adult, systemic lupus erythematosus2018-09-03v4No1 / 17
381amnonhighfreq bird, isla de salvora, kingdom of spain, age 8 days, feces, larus michahellis, gull2018-10-22v4No1 / 17
389amnonhighfreq pig, sus scrofa, united states of america, state of michigan, farm, skin, nipple, adult2018-11-04v4No1 / 17
406amnonhighfreq feces, zoological garden, south africa, aardvark, orycteropus afer2018-11-21v4No1 / 17
428amnonhighfreq homo sapiens, adult, feces, china, nanchang city prefecture, pancreatitis, acute pancreatitis2018-12-09v4No1 / 17
36amnonhighfreq homo sapiens, feces, sichuan province2016-12-06v4No1 / 18
207amnonhigh freq. in people hospitalized with diarrhea (highfreq homo sapiens, israel, feces, diarrhea)2017-10-05v4No1 / 18
215amnonhighfreq homo sapiens, feces, united states of america2017-10-23v4No1 / 18
273amnonhighfreq feces, homo sapiens, kingdom of denmark, infant, age one month2018-01-14v4No1 / 18
284amnonhighfreq homo sapiens, female, feces, state of california, infant, age 6 months2018-01-27v4No1 / 18
339amnonhighfreq homo sapiens, feces, india, adult2018-05-24v4No1 / 18
387amnonhigh freq. in feces of wild brown bear (highfreq ursus arctos, brown bear, feces, sweden, wild)2018-11-03v4No1 / 18
440amnonhighfreq galapagos islands, feces, bird, finch, geospiza fuliginosa, small ground finch2019-01-06v4No1 / 18
477amnonhighfreq homo sapiens, feces, adult, nepal, himalayas, rural community, forager, chepang2019-01-28v4No1 / 18
488amnonhighfreq canis lupus familiaris, dog, feces, italy, lymphoma2019-02-25v4No1 / 18
59amnoncommon geniotrigona thoracica, digestive system2017-02-03v4No1 / 19
60amnonhighfreq anser cygnoides, china, feces2017-02-03v4No1 / 19
121amnonhighfreq homo sapiens, feces, bangladesh, adult2017-04-13v4No1 / 19
276amnonhighfreq feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 19
292amnonhighfreq homo sapiens, china, adult, feces, control2018-02-05v4No1 / 19
301amnonhighfreq canis lupus familiaris, dog, united states of america, colon2018-03-05v4No1 / 19
330amnon high in infant age 1 year compared to adult age 30-40 in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 19
339amnoncommon homo sapiens, feces, india, infant, age < 1 year2018-05-24v4No1 / 19
404amnonhighfreq homo sapiens, feces, colombia, city, adult2018-11-20v4No1 / 19
438amnonhighfreq homo sapiens, feces, china, age 19-242018-12-30v4No1 / 19
438amnonhighfreq feces, homo sapiens, china, age 60-79, adult, jiangsu province2018-12-30v4No1 / 19
449amnonhighfreq homo sapiens, feces, colombia2019-01-09v4No1 / 19
455amnonhighfreq homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 19
477amnonhighfreq homo sapiens, feces, himalayas, nepal, rural community, raute2019-01-29v4No1 / 19
482amnonhighfreq homo sapiens, feces, colombia, medellin metropolitan area, child, daycare, age 1-5 years2019-02-12v4No1 / 19
489amnonhighfreq feces, anal swab, myotis myotis, bat, greater mouse eared bat, french republic2019-02-25v4No1 / 19
495amnonhighfreq gallus gallus, chicken, caecum, broiler chicken, kingdom of spain, farm, age 4 weeks2019-03-03v4No1 / 19
516amnonhighfreq adult, state of ohio, united states of america, feces, homo sapiens2019-05-29v4No1 / 19
45amnonhigh freq. in feces babies <2 years in india (highfreq homo sapiens, feces, india, infant)2016-12-19v4No1 / 20
59amnoncommon sundatrigona moorei, digestive system2017-02-03v4No1 / 20
197amnonhighfreq feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, finland2017-09-12v4No1 / 20
227amnoncommon in baby nasopharynx age <= 1 day (common homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, age <= 24 hours)2017-10-30v4No1 / 20
238amnonhighfreq homo sapiens, feces, colombia2017-11-07v4No1 / 20
271amnoncommon china, depth 0-20cm, glycine max, soybean, root, root nodule, root structure2018-01-09v4No1 / 20
273amnoncommon feces, homo sapiens, kingdom of denmark, infant, age one week2018-01-14v4No1 / 20
273amnonhighfreq feces, homo sapiens, kingdom of denmark, infant, age one week2018-01-14v4No1 / 20
273amnonhighfreq feces, homo sapiens, kingdom of denmark, infant, age one year2018-01-14v4No1 / 20
284amnoncommon homo sapiens, female, feces, state of california, infant, age 2 months2018-01-27v4No1 / 20
284amnonhighfreq homo sapiens, female, feces, state of california, infant, age 2 months2018-01-27v4No1 / 20
286amnonhigh freq. in feces of individuals with kidney stones (highfreq homo sapiens, feces, adult, age 50-60 years, china, nanning city prefecture, nephrolithiasis)2018-01-27v4No1 / 20
292amnonhighfreq homo sapiens, china, adult, feces, ulcerative colitis2018-02-05v4No1 / 20
292amnonhighfreq homo sapiens, china, adult, feces, crohn's disease2018-02-05v4No1 / 20
333amnonhigh freq. in healthy controls feces (highfreq homo sapiens, feces, china, guangzhou city prefecture, adult, control)2018-05-15v4No1 / 20
390amnonhighfreq homo sapiens, feces, diarrhea, australia, hospital, salmonella gastroenteritis2018-11-04v4No1 / 20
390amnonhighfreq homo sapiens, feces, diarrhea, australia, hospital2018-11-04v4No1 / 20
394amnonhighfreq homo sapiens, feces, adult, united states of america, state of california, ulcerative colitis2018-11-06v4No1 / 20
399amnoncommon feces, united states of america, mustela putorius furo, ferret2018-11-16v4No1 / 20
409amnonhighfreq homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v4No1 / 20
477amnonhighfreq homo sapiens, feces, himalayas, nepal, rural community, raji2019-01-29v4No1 / 20
495amnonhighfreq gallus gallus, chicken, caecum, kingdom of spain, farm, free range chicken, age 4 days2019-03-03v4No1 / 20
535amnonhigh freq. in adult vaginal samples with ICC (highfreq cervical carcinoma, invasive cervical carcinoma, invasive carcinoma, state of arizona, phoenix, united states of america, adult, female, vagina, homo sapiens)2019-07-25v4No1 / 20
15amnonhighfreq acinonyx jubatus, namibia, feces2016-11-08v4No1 / 21
24amnonappears on transition to cow milk ( high in milk compared to breast milk in homo sapiens feces infant )2016-12-01v4No1 / 21
47amnonsmj: higher in bullied, non-immunized mouse ( high in stress: chronic subordinate colony housing compared to no stress: single housed control in feces united states of america mus musculus male mouse strain c57bc/6ncrl research facility no immunization: vehicle as control )2017-01-13v4No1 / 21
58amnoncommon homo sapiens, new york city, skin of face, skin under eyes2017-02-02v4No1 / 21
72amnonhighfreq canis lupus familiaris, feces, united states of america, iowa2017-02-25v4No1 / 21
108amnonhighfreq research facility, texas, united states of america, caecum, mus musculus, mouse2017-04-07v4No1 / 21
108amnonhighfreq research facility, texas, united states of america, caecum, coturnix coturnix, common quail2017-04-07v4No1 / 21
122amnonhighfreq homo sapiens, feces, united kingdom2017-04-13v4No1 / 21
240amnonhigh freq. in infants age <3 years (highfreq homo sapiens, feces, finland, infant, age < 3 years)2017-11-12v4No1 / 21
241amnonhigh freq. in babies age < 3 years in finland (highfreq homo sapiens, feces, infant, age < 3 years, finland)2017-11-13v4No1 / 21
249amnonhighfreq homo sapiens, feces, united states of america2017-11-22v4No1 / 21
320amnonhighfreq homo sapiens, feces, adult, crohn's disease2018-04-19v4No1 / 21
350amnonhigh freq. in feces of white faced capuchin from costa rica rain forest (highfreq monkey, cebus capucinus, feces, costa rica, white-faced capuchin, woodland)2018-07-30v4No1 / 21
390amnonhighfreq homo sapiens, feces, diarrhea, clostridium difficile intestinal infectious disease, australia, hospital2018-11-04v4No1 / 21
429amnonhighfreq rat, rattus norvegicus, dahl salt-sensitive, feces, israel, research facility, salt rich diet, salt2018-12-13v4No1 / 21
497amnoncommon chicken, gallus gallus, broiler chicken, austria, farm, feces, age 4 weeks2019-03-04v4No1 / 21
69amnonhighfreq canis lupus familiaris, beagle dog, united states of america, research facility, feces2017-02-21v4No1 / 22
94amnonhighfreq homo sapiens, clostridium difficile intestinal infectious disease, feces, state of michigan, diarrhea2017-03-12v4No1 / 22
185amnonhigh freq. in patients with c. diff infection before treatment (highfreq homo sapiens, feces, united states of america, state of minnesota, clostridium difficile intestinal infectious disease)2017-08-20v4No1 / 22
284amnonhighfreq homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 22
297amnonhighfreq homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 22
333amnonhigh freq. in stroke patient feces (highfreq homo sapiens, feces, china, guangzhou city prefecture, adult, stroke)2018-05-15v4No1 / 22
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, tonsil, age 8 hours2018-11-04v4No1 / 22
395amnonhighfreq homo sapiens, feces, united states of america, commonwealth of pennsylvania, child, inflammatory bowel disease, crohn's disease, ulcerative colitis2018-11-14v4No1 / 22
399amnoncommon feces, united states of america, zoological garden, state of tennessee, ailurus fulgens, red panda2018-11-16v4No1 / 22
502amnonhighfreq homo sapiens, feces, adult, united states of america, control2019-03-12v4No1 / 22
509amnonhighfreq feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, control2019-03-18v4No1 / 22
53amnonhighfreq homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 23
58amnoncommon homo sapiens, new york city, contact lens2017-02-02v4No1 / 23
197amnonhighfreq feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 23
241amnonhigh freq. in babies age < 3 years in russia (highfreq homo sapiens, feces, infant, russia, age < 3 years)2017-11-13v4No1 / 23
241amnoncommon in babies age < 3 years in finland (common homo sapiens, feces, infant, age < 3 years, finland)2017-11-13v4No1 / 23
241amnonhigh freq. in babies age < 3 years in estonia (highfreq homo sapiens, feces, infant, age < 3 years, estonia)2017-11-13v4No1 / 23
284amnonhighfreq homo sapiens, female, feces, state of california, infant, age 1 year2018-01-27v4No1 / 23
312amnonhighfreq feces, homo sapiens, french republic, adult, spondylitis, spondyloarthritis2018-04-09v4No1 / 23
394amnonhighfreq homo sapiens, feces, adult, united states of america, state of california, control2018-11-06v4No1 / 23
399amnonhighfreq feces, united states of america, zoological garden, panthera leo, lion, state of tennessee2018-11-16v4No1 / 23
509amnonhighfreq feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, schistosomiasis, urinary schistosomiasis2019-03-18v4No1 / 23
542amnon high in age 1-7 years child compared to age 12-23 years adult in puerto rico research facility macaca mulatta monkey dentition subgingival plaque 2019-08-01v4No1 / 23
239amnonhighfreq homo sapiens, feces, united states of america2017-11-08v4No1 / 24
241amnoncommon in babies age < 3 years in estonia (common homo sapiens, feces, infant, age < 3 years, estonia)2017-11-13v4No1 / 24
330amnonhighfreq homo sapiens, feces, kingdom of norway, oslo, infant, age 1 year2018-05-13v4No1 / 24
365amnonhighfreq homo sapiens, feces, child, obsolete_juvenile stage, sudan2018-08-30v4No1 / 24
489amnoncommon feces, anal swab, myotis myotis, bat, greater mouse eared bat, french republic2019-02-25v4No1 / 24
35amnoncommon tanzania, dense settlement biome, hospital, breast milk, homo sapiens2016-12-06v4No1 / 25
53amnonhighfreq lima, homo sapiens, feces, city, shantytown2017-01-21v4No1 / 25
108amnonhighfreq research facility, texas, united states of america, colon, mus musculus, mouse2017-04-07v4No1 / 25
159amnon high in midgut compared to hindgut in siganidae rabbitfish australia 2017-07-06v4No1 / 25
284amnoncommon homo sapiens, female, feces, state of california, infant, age 6 months2018-01-27v4No1 / 25
290amnonhighfreq homo sapiens, feces, china, adult, city2018-02-01v4No1 / 25
379amnonhighfreq gallus gallus, chicken, feces, united kingdom, age 15 - 35 days2018-09-14v4No1 / 25
395amnoncommon homo sapiens, feces, united states of america, commonwealth of pennsylvania, child, inflammatory bowel disease, crohn's disease, ulcerative colitis2018-11-14v4No1 / 25
428amnoncommon homo sapiens, adult, feces, china, nanchang city prefecture, pancreatitis, acute pancreatitis2018-12-09v4No1 / 25
544amnoncommon commonwealth of massachusetts, united states of america, american cranberry, vaccinium macrocarpon, flower2019-08-04v4No1 / 25
301amnonhighfreq canis lupus familiaris, dog, united states of america, rectum2018-03-05v4No1 / 26
354amnoncommon homo sapiens, united states of america, adult, pair of nares, nasal cavity, nasal brush2018-07-30v4No1 / 26
438amnonhighfreq feces, homo sapiens, china, jiangsu province, age 30-50, adult2018-12-30v4No1 / 26
131amnonhighfreq homo sapiens, feces, south korea2017-04-16v4No1 / 27
228amnoncommon in sinus brush of sinusitis patients (common homo sapiens, mucosa, sinusoidal space, paranasal sinus, united states of america, sinusitis)2017-10-31v4No1 / 27
387amnoncommon in feces of wild brown bear (common ursus arctos, brown bear, feces, sweden, wild)2018-11-03v4No1 / 27
399amnon high in crohn's disease compared to control in feces united states of america homo sapiens 2018-11-16v4No1 / 27
404amnon high in hard stool compared to normal stool in homo sapiens feces columbia city adult 2018-11-20v4No1 / 27
438amnonhighfreq homo sapiens, feces, china, jiangsu province, child, age 8-122018-12-30v4No1 / 27
495amnonhighfreq gallus gallus, chicken, caecum, kingdom of spain, farm, free range chicken, age 3 weeks2019-03-03v4No1 / 27
540amnonhighfreq state of arizona, flagstaff, united states of america, feces, canis lupus familiaris, dog2019-07-31v4No1 / 27
127amnonhighfreq gallus gallus, chicken, united states of america, caecum, age 14-28 days2017-04-14v4No1 / 28
365amnonhighfreq homo sapiens, feces, jordan, child, obsolete_juvenile stage2018-08-30v4No1 / 28
495amnonhighfreq gallus gallus, chicken, caecum, broiler chicken, kingdom of spain, farm, age 2 weeks2019-03-03v4No1 / 28
540amnoncommon state of arizona, flagstaff, united states of america, feces, canis lupus familiaris, dog2019-07-31v4No1 / 28
26amnoncommon in combined swab of inguinal region and axilla (common homo sapiens, united states of america, inguinal region, axilla, sebum)2016-12-05v4No1 / 29
165amnoncommon in house fly larva grown on moist wheat bran (common china, research facility, musca domestica, house fly, larval stage, digestive system)2017-07-16v4No1 / 29
438amnonhighfreq homo sapiens, feces, china, jiangsu province, age 13-142018-12-30v4No1 / 29
36amnonhigher in centernarians ( high in centererians compared to adult in homo sapiens feces sichuan province )2016-12-06v4No1 / 30
211amnon high in female compared to male in feces united states of america research facility mus musculus mouse diet high fat diet 2017-10-22v4No1 / 30
284amnoncommon homo sapiens, female, feces, state of california, infant, age 1 year2018-01-27v4No1 / 30
320amnoncommon homo sapiens, feces, adult, crohn's disease2018-04-19v4No1 / 30
438amnonhighfreq homo sapiens, feces, china, jiangsu province, child, age 3-62018-12-30v4No1 / 30
45amnoncommon in feces babies age 0-2 in india (common homo sapiens, feces, india, infant)2016-12-19v4No1 / 31
108amnonincreases during fasting in mouse colon ( high in fasting late timepoints compared to early timepoints in research facility texas united states of america colon mus musculus mouse )2017-04-07v4No1 / 31
189amnonhigherin stems of grape vines with pierce disease compared to control ( high in xylella fastidiosa temecula1 pierce disease compared to control in united states of america state of california grape vitis vinifera stem endosphere )2017-08-30v4No1 / 31
262amnoncommon tick, ixodes scapularis, larval stage, body proper, research facility2017-12-10v4No1 / 31
390amnoncommon homo sapiens, feces, diarrhea, clostridium difficile intestinal infectious disease, australia, hospital2018-11-04v4No1 / 31
544amnoncommon fruit, commonwealth of massachusetts, united states of america, american cranberry, vaccinium macrocarpon2019-08-04v4No1 / 31
165amnoncommon in moist wheat bran (common china, research facility, wheat bran)2017-07-16v4No1 / 32
292amnon high in crohn's disease ulcerative colitis compared to control in homo sapiens china adult feces 2018-02-05v4No1 / 32
411amnonhigher in wild baboons feeding on discarded human foods ( high in human contact compared to low human contact in zambia feces papio kindae wild monkey kinda baboon )2018-11-23v4No1 / 33
19amnonhigher in CD compared to control in biopsies ( high in crohn's disease compared to control in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 34
269amnondecreases during one month in refrigeration of yao meat ( high in fresh early timepoint compared to late timpoint food spoilage in china food product meat food product )2018-01-09v4No1 / 34
407amnoncommon costa rica, feces, monkey, cebus capucinus, white-faced capuchin, wild2018-11-21v4No1 / 34
48amnonlower in 3 months compared to 1 week in infant hypopharynx ( high in age age 1 week compared to age 3 months in homo sapiens kingdom of denmark hypopharynx infant )2017-01-19v4No1 / 35
108amnoncommon research facility, texas, united states of america, colon, quail, coturnix coturnix2017-04-07v4No1 / 35
240amnonhigher in infants age<1 year compared to 1-3 years in baby feces ( high in age age < 1 year compared to age > 1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 35
262amnonhigher in tick larvae fed on PIXR immunized mice compared to non immunized ( high in pixr immunized compared to control in tick ixodes scapularis larval stage body proper research facility )2017-12-10v4No1 / 35
287amnoncommon japan, snow field, mountain, depth 1-2m2018-01-29v4No1 / 35
350amnoncommon in feces of white faced capuchin from costa rica rain forest (common monkey, cebus capucinus, feces, costa rica, white-faced capuchin, woodland)2018-07-30v4No1 / 35
219amnonhigher in pre-weaning compared to post-weaning in mouse feces ( high in age age 21 days breast milk compared to age 28 days mouse chow in mus musculus mouse feces c57bl/6 male research facility south korea )2017-10-24v4No1 / 36
240amnoncommon in infants age <3 years (common homo sapiens, feces, finland, infant, age < 3 years)2017-11-12v4No1 / 36
50amnoncommon in mitten crab gills (common gill, eriocheir sinensis, china)2017-01-19v4No1 / 37
232amnoncommon in foot of diabetic patients (common homo sapiens, skin, australia, foot, diabetes mellitus)2017-11-05v4No1 / 37
345amnoncommon homo sapiens, nasal cavity, nasal cavity mucosa, austria, adult, graz city district2018-06-11v4No1 / 37
243amnoncommon beetle, anoplophora glabripennis, digestive system, united states of america2017-11-15v4No1 / 38
390amnoncommon homo sapiens, feces, diarrhea, australia, hospital2018-11-04v4No1 / 38
409amnonhigher in colon biopsies compared to stool and luminal content ( high in biopsy biopsy site compared to feces luminal content in homo sapiens united states of america )2018-11-22v4No1 / 38
503amnonincreases following malaria infection ( high in malaria late time points experimental cerebral malaria compared to control early time points in mouse mus musculus research facility c57bl/6 japan feces )2019-03-12v4No1 / 38
102amnonlower in saliva compared to teeth, cheek ( high in dentition cheek compared to saliva in homo sapiens mouth atlanta united states of america )2017-04-03v4No1 / 39
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, infant, age 1 year2018-05-13v4No1 / 39
360amnoncommon agave, leaf, leaf endosphere, desert, adave salmiana, guanajuato, mexico2018-08-21v4No1 / 39
497amnoncommon chicken, gallus gallus, broiler chicken, austria, farm, feces, age 2 weeks2019-03-04v4No1 / 39
19amnoncommon in biopsies of children (IBD study) (common rectum, terminal ileum, sigmoid colon, caecum, colon, biopsy, children, homo sapiens, united states of america)2016-11-14v4No1 / 40
79amnoncommon skin, united states of america, stenella attenuata2017-03-03v4No1 / 40
119amnonhigher in late timepoints (>4weeks) of worm infected mice ( high in parasitic helminthiasis infectious disease trichuris muris late timepoints compared to control in mus musculus mouse feces research facility sweden )2017-04-12v4No1 / 40
212amnonlower in obese mice fed quinoa diet compared to ain-93g rodent diet ( high in diet ain-93g rodent diet compared to quinoa product in mouse mus musculus feces research facility united states of america obesity obese body mass index status db/db mouse )2017-10-22v4No1 / 40
102amnonhigher in cheeks compared to teeth, saliva ( high in cheek compared to saliva dentition in homo sapiens mouth atlanta united states of america )2017-04-03v4No1 / 41
117amnoncommon zebra fish, danio rerio, research facility, larval stage, united states of america, intestine2017-04-10v4No1 / 41
352amnoncommon homo sapiens, feces, india, new delhi2018-07-30v4No1 / 41
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, adult, tonsil2018-11-04v4No1 / 41
400amnonhigher in children of hmong migrands born in the usa compared to non-migrant usa people ( high in hmong 2nd generation hmong compared to united states of america in homo sapiens feces )2018-11-18v4No1 / 41
401amnonlower in endospore enriched (lysis resistant) replicates ( high in control compared to endospore enriched fraction lysis in homo sapiens feces united states of america adult )2018-11-18v4No1 / 41
542amnoncommon age 1-7 years, child, puerto rico, research facility, macaca mulatta, monkey, dentition, subgingival plaque2019-08-01v4No1 / 41
14amnon high in stomach duodenum jejunum ileum compared to caecum right colon transverse colon left colon feces in mus musculus united states of america gastrointestinal system 2016-11-08v4No1 / 42
51amnoncommon feces, homo sapiens, united states of america2017-01-19v4No1 / 42
60amnoncommon anser cygnoides, feces, china2017-02-03v4No1 / 42
79amnoncommon skin, united states of america, globicephala macrorhynchus, short finned pilot whale2017-03-03v4No1 / 42
95amnoncommon in root canal (common homo sapiens, brazil, tooth, root canal)2017-03-12v4No1 / 42
89amnoncommon junco hyemalis, uropygial gland, commonwealth of virginia, songbird2017-03-08v4No1 / 43
189amnoncommon united states of america, state of california, grape, vitis vinifera, stem, endosphere2017-08-30v4No1 / 43
389amnoncommon pig, sus scrofa, vagina, united states of america, state of michigan, farm2018-11-04v4No1 / 43
406amnoncommon feces, south africa, acinonyx jubatus, cheetah2018-11-21v4No1 / 43
36amnoncommon homo sapiens, feces, sichuan province2016-12-06v4No1 / 44
241amnoncommon in babies age < 3 years in russia (common homo sapiens, feces, infant, russia, age < 3 years)2017-11-13v4No1 / 44
268amnoncommon fish, gadus morhua, atlantic cod, digestive system, kingdom of norway2017-12-24v4No1 / 44
302amnoncommon in feces of parakeet pet birds (common bird, melopsittacus undulatus, parakeet, mexico, feces, pet)2018-03-05v4No1 / 44
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, sudan2018-08-30v4No1 / 44
406amnoncommon feces, zoological garden, united states of america, myrmecophaga tridactyla, giant anteater2018-11-21v4No1 / 44
244amnoncommon drosophila melanogaster, fruit fly, research facility, united kingdom, digestive system2017-11-15v4No1 / 45
327amnonlower in nasopharynx of antibiotics treated cows compared to cows without antibiotic injection ( high in control compared to antibiotic in bos taurus cow nasopharynx canada )2018-04-30v4No1 / 45
273amnoncommon feces, homo sapiens, kingdom of denmark, infant, age one year2018-01-14v4No1 / 46
428amnon high in acute pancreatitis pancreatitis compared to control in homo sapiens adult feces china nanchang city prefecture 2018-12-09v4No1 / 46
287amnoncommon japan, snow field, mountain, depth 6-7m2018-01-29v4No1 / 47
301amnoncommon canis lupus familiaris, dog, united states of america, duodenum2018-03-05v4No1 / 47
302amnoncommon in feces of canary pet birds (common bird, mexico, feces, pet, serinus canaria, canary)2018-03-05v4No1 / 47
482amnoncommon homo sapiens, feces, colombia, medellin metropolitan area, child, daycare, age 1-5 years2019-02-12v4No1 / 47
89amnoncommon junco hyemalis, commonwealth of virginia, songbird, cloaca2017-03-08v4No1 / 48
495amnon high in typhlitis disease intestinal disease compared to control in gallus gallus chicken caecum kingdom of spain farm free range chicken 2019-03-03v4No1 / 48
258amnoncommon in lungs of hiv patients with pneumonia (common homo sapiens, hiv infection, pneumonia, uganda, bronchoalveolar lavage, bronchial epithelium, lung)2017-11-27v4No1 / 49
121amnoncommon homo sapiens, feces, bangladesh, adult2017-04-13v4No1 / 50
327amnoncommon bos taurus, cow, nasopharynx, canada2018-04-30v4No1 / 50
339amnon high in infant age < 1 year compared to adult in homo sapiens feces india 2018-05-24v4No1 / 50
406amnoncommon feces, equus przewalskii, przewalski horse, zoological garden, united states of america2018-11-21v4No1 / 50
321amnonhigher in mice treated with ampicillin compared to untreated mice ( high in ampicillin antibiotic compared to control in mus musculus mouse c57bl/6j feces united states of america research facility )2018-04-22v4No1 / 52
93amnon high in egg egg jelly compared to shell gland in hawaii bobtail squid euprymna scolopes 2017-03-12v4No1 / 53
292amnoncommon homo sapiens, china, adult, feces, ulcerative colitis2018-02-05v4No1 / 53
333amnoncommon in stroke patient feces (common feces, homo sapiens, china, stroke, adult, guangzhou city prefecture)2018-05-15v4No1 / 53
109amnoncommon usa, water, drinking water, site a2017-04-08v4No1 / 54
286amnonhigher in feces of individuals with kidney stones ( high in nephrolithiasis compared to control in homo sapiens feces adult age 50-60 years china nanning city prefecture )2018-01-27v4No1 / 54
15amnoncommon acinonyx jubatus, namibia, feces2016-11-08v4No1 / 55
292amnoncommon homo sapiens, china, adult, feces, crohn's disease2018-02-05v4No1 / 55
313amnonhigher in gut content of fish grown in 12C compared to 18C water ( high in cold temperature habitat temp 12c compared to warm temperature habitat temp 18c in sweden fish rainbow trout oncorhynchus mykiss research facility digestive system gut content )2018-04-10v4No1 / 55
390amnoncommon homo sapiens, feces, diarrhea, australia, hospital, salmonella gastroenteritis2018-11-04v4No1 / 55
45amnonhigher in younf babies compared to 2 year olds in india ( high in age age 0-1 compared to age 1-2 in homo sapiens feces india infant )2016-12-19v4No1 / 56
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, systemic lupus erythematosus2018-09-03v4No1 / 56
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, ulcerative colitis2018-11-06v4No1 / 56
488amnoncommon canis lupus familiaris, dog, feces, italy, lymphoma2019-02-25v4No1 / 56
56amnoncommon nicotiana galuca, flower, nectar, israel2017-01-30v4No1 / 57
308amnoncommon in neonatal intensive care unit floor (common united states of america, state of california, hospital, floor, dust)2018-03-31v4No1 / 57
237amnoncommon bird, oceanodroma leucorhoa, seabird, canada, bon portage island, uropygial gland2017-11-07v4No1 / 58
281amnoncommon china, shinisaurus crocodilurus, crocodile lizard, cloaca2018-01-25v4No1 / 59
9amnonhigher in sea water with coral ( high in porites astreoides compared to control in ocean water bermuda )2016-10-27v4No1 / 61
333amnoncommon in healthy controls feces (common homo sapiens, feces, china, guangzhou city prefecture, adult, control)2018-05-15v4No1 / 61
302amnoncommon in feces of Cockatiel pet birds (common bird, mexico, feces, pet, nymphicus hollandicus, cockatiel)2018-03-05v4No1 / 63
380amnoncommon tibet autonomous region, feces, homo sapiens, tibetan plateau, adult2018-10-03v4No1 / 63
442amnonhigher in tnbs induced colitis compared to controls ( high in tnbs colitis compared to control in rattus norvegicus rat sprague dawley male research facility china feces )2019-01-06v4No1 / 63
502amnoncommon homo sapiens, feces, adult, united states of america, schizophrenia2019-03-12v4No1 / 63
530amnoncommon king ratsnake, elaphe carinata, hunan province, adula, china, farm, snake farm, feces, snake2019-07-21v4No1 / 63
242amnoncommon in native-americans (common homo sapiens, feces, united states of america, state of oklahoma, native american, arapaho, cheyenne)2017-11-14v4No1 / 65
448amnoncommon equus caballus, horse, feces, united kingdom, farm, equine grass sickness, disease2019-01-08v4No1 / 65
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, nigeria2018-08-30v4No1 / 66
71amnon high in small intestine stomach compared to feces hindgut colon in liolaemus ruibali argentina research facility 2017-02-25v4No1 / 67
114amnon high in adult compared to tadpole in rana pipiens northern leopard frog research facility digesta intestine state of wisconsin united states of america 2017-04-10v4No1 / 67
365amnoncommon homo sapiens, feces, jordan, child, obsolete_juvenile stage2018-08-30v4No1 / 67
398amnon high in crohn's disease compared to control in homo sapiens feces belgium 2018-11-15v4No1 / 68
72amnoncommon canis lupus familiaris, feces, united states of america, iowa2017-02-25v4No1 / 69
301amnoncommon canis lupus familiaris, dog, united states of america, ileum2018-03-05v4No1 / 69
495amnoncommon gallus gallus, chicken, caecum, kingdom of spain, farm, free range chicken, age 4 days2019-03-03v4No1 / 69
417amnoncommon anser cygnoides, swan goose, bird, china, feces, winter2018-12-01v4No1 / 70
313amnoncommon in fishfeed (common sweden, fish feed)2018-04-10v4No1 / 71
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, tonsil, age 4 weeks2018-11-04v4No1 / 71
404amnon high in barranquilla bucaramanga municipality of santiago de cali compared to bogota medellin metropolitan area in homo sapiens feces adult colombia city 2018-11-20v4No1 / 71
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, skin, nipple, adult2018-11-04v4No1 / 72
441amnonhigher in mice treated with indomethacin NSAID compared to non-treated controls ( high in indomethacin non-steroidal anti-inflammatory drug compared to control in mus musculus mouse c57bl/6j feces research facility united states of america )2019-01-06v4No1 / 72
448amnon high in equine grass sickness disease compared to control in equus caballus horse feces united kingdom farm 2019-01-08v4No1 / 72
541amnoncommon eucalyptus viminalis diet, cape otway, wild, australia, feces, koala, phascolarctos cinereus2019-08-01v4No1 / 72
26amnoncommon united states of america, homo sapiens, pair of nares, mucus2016-12-05v4No1 / 73
425amnoncommon homo sapiens, feces, africa, child, madagascar, antananarivo2018-12-08v4No1 / 73
477amnoncommon homo sapiens, feces, adult, nepal, himalayas, rural community, tharu, agrarian2019-01-28v4No1 / 74
395amnoncommon homo sapiens, feces, united states of america, commonwealth of pennsylvania, control2018-11-14v4No1 / 75
74amnoncommon united states of america, feces, homo sapiens2017-02-27v4No1 / 76
477amnoncommon homo sapiens, feces, himalayas, nepal, rural community, raute2019-01-29v4No1 / 76
484amnoncommon feces, united states of america, adult, state of michigan, age 17-29, homo sapiens2019-02-13v4No1 / 76
431amnonhigher in midgut of hibernating bumble bees compared to non-hibernating ( high in hibernation compared to non hibernating in bombus terrestris bumble bee midgut research facility queen belgium )2018-12-16v4No1 / 77
516amnoncommon adult, state of ohio, united states of america, feces, homo sapiens2019-05-29v4No1 / 77
541amnoncommon eucalyptus obliqua diet, cape otway, wild, australia, feces, koala, phascolarctos cinereus2019-08-01v4No1 / 77
360amnoncommon agave, leaf, leaf endosphere, desert, guanajuato, mexico, agave tequiliana, cultivated habitat2018-08-21v4No1 / 78
399amnoncommon feces, united states of america, zoological garden, panthera leo, lion, state of tennessee2018-11-16v4No1 / 79
401amnoncommon homo sapiens, feces, united states of america, adult2018-11-18v4No1 / 79
404amnoncommon homo sapiens, feces, colombia, city, adult2018-11-20v4No1 / 79
407amnon high in wet season compared to dry season in costa rica feces monkey cebus capucinus white-faced capuchin wild 2018-11-21v4No1 / 79
425amnoncommon homo sapiens, feces, africa, child, central african republic, bangui2018-12-08v4No1 / 79
26amnoncommon united states of america, felis catus, mucus, pair of nares2016-12-05v4No1 / 80
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, tonsil, age 1-3 weeks2018-11-04v4No1 / 80
483amnoncommon hawaii, pearl harbor, research facility, hydroides elegans, tubeworm, united states of america, adult2019-02-13v4No1 / 80
534amnoncommon filtered 0.2um, free floating, nepal, tributary, koshi river, depth 10 cm, fresh water, water, river2019-07-22v4No1 / 80
292amnoncommon homo sapiens, china, adult, feces, control2018-02-05v4No1 / 81
339amnoncommon homo sapiens, feces, india, adult2018-05-24v4No1 / 81
344amnoncommon in feces of heterosexuals (common homo sapiens, feces, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 82
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, control2018-09-03v4No1 / 82
334amnonhigher in dss induced colitis compared to controls ( high in colitis dss induced colitis compared to control in mus musculus mouse feces israel research facility c57bl/6 )2018-05-15v4No1 / 83
502amnoncommon homo sapiens, feces, adult, united states of america, control2019-03-12v4No1 / 83
231amnoncommon in dog rectum (common dog, canis lupus familiaris, united states of america, rectum, feces)2017-11-02v4No1 / 84
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msw, heterosexual2018-11-06v4No1 / 84
227amnonhiger in first 24hrs compared to later timepoints in baby nasopharynx ( high in age age <=24 hours compared to age >= 7 days in homo sapiens nasopharynx nasal cavity infant kingdom of the netherlands )2017-10-30v4No1 / 85
247amnoncommon homo sapiens, italy, feces, obesity, high bmi2017-11-21v4No1 / 85
405amnon high in ketogenic diet compared to control diet in mouse mus musculus research facility feces united states of america swiss webster 2018-11-20v4No1 / 85
26amnon high in pair of nares mucus compared to mouth saliva in united states of america felis catus 2016-12-05v4No1 / 86
109amnoncommon usa, water, drinking water, site c2017-04-08v4No1 / 86
249amnoncommon homo sapiens, feces, united states of america2017-11-22v4No1 / 86
318amnoncommon canada, vancouver, ocean, pacific ocean, kelp, nereocystis2018-04-16v4No1 / 86
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, control2018-11-06v4No1 / 86
513amnoncommon china, waste water, hospital, city, xinxiang city prefecture2019-03-25v4No1 / 86
530amnoncommon oriental ratsnake, ptyas mucosa, hunan province, adula, china, farm, snake farm, feces, snake2019-07-21v4No1 / 86
340amnoncommon feces, felis catus, cat, city of melbourne, australia2018-05-27v4No1 / 87
344amnoncommon in feces of homosexual males (common homo sapiens, feces, united states of america, state of colorado, denver, homosexual, gay, msm)2018-05-31v4No1 / 87
360amnoncommon agave, desert, root, root endosphere, agave salmiana, mexico, guanajuato2018-08-21v4No1 / 87
430amnoncommon homo sapiens, adult, united states of america, state of arizona, city, age 20, feces2018-12-15v4No1 / 87
71amnoncommon liolaemus ruibali, argentina, research facility, stomach2017-02-25v4No1 / 88
477amnoncommon homo sapiens, feces, himalayas, nepal, rural community, raji2019-01-29v4No1 / 88
487amnoncommon homo sapiens, feces, united states of america, metabolic syndrome, metabolic syndrome x2019-02-24v4No1 / 88
293amnoncommon homo sapiens, feces, adult, united states of america, american diet2018-02-07v4No1 / 89
382amnoncommon china, water, hot spring, high temperature habitat, geothermal field, ganzi tibetan autonomous prefecture2018-10-22v4No1 / 89
530amnoncommon chinese cobra, naja atra, hunan province, adula, china, farm, snake farm, feces, snake2019-07-21v4No1 / 90
199amnonhigher in bathroom shower compared to kitchen sink ( high in bathroom shower tile wall compared to kitchen sink in building urban biome united states of america )2017-10-01v4No1 / 91
503amnon high in balb/c compared to c57bl/6 in mouse mus musculus research facility japan feces 2019-03-12v4No1 / 91
428amnoncommon homo sapiens, adult, feces, china, nanchang city prefecture, control2018-12-09v4No1 / 93
363amnoncommon ovis aries, age 30 days, obsolete_juvenile stage, italy, dairy, caecum, colon, rectum2018-08-29v4No1 / 94
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msm, gay, homosexual2018-11-06v4No1 / 94
488amnoncommon canis lupus familiaris, dog, feces, italy, control2019-02-25v4No1 / 94
400amnoncommon in feces of european american females (common homo sapiens, feces, united states of america, adult, female)2018-11-18v4No1 / 95
400amnoncommon in hmong (chinese) females from thailand (common homo sapiens, feces, adult, female, thailand, hmong, china)2018-11-18v4No1 / 95
238amnoncommon homo sapiens, feces, colombia2017-11-07v4No1 / 96
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 97
409amnoncommon homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v4No1 / 97
477amnoncommon homo sapiens, feces, adult, nepal, himalayas, rural community, forager, chepang2019-01-28v4No1 / 97
455amnoncommon homo sapiens, adult, canada, atherosclerosis, saliva2019-01-10v4No1 / 100
363amnon high in caecum colon rectum compared to rumen ruminant reticulum omasum in ovis aries age 30 days obsolete_juvenile stage italy dairy 2018-08-29v4No1 / 101
438amnoncommon homo sapiens, feces, china, age 19-242018-12-30v4No1 / 101
499amnoncommon brazil, pond, digestive system, intestine, dendropsophus minutus, frog, tadpole2019-03-05v4No1 / 102
198amnoncommon yellowstone national park, united states of america, geothermal field, high temperature habitat, water, hot spring2017-09-13v4No1 / 103
213amnoncommon homo sapiens, south africa, vagina2017-10-22v4No1 / 103
425amnon high in antananarivo madagascar compared to central african republic bangui in homo sapiens africa child duodenum 2018-12-08v4No1 / 103
477amnoncommon homo sapiens, feces, adult, united states of america2019-01-28v4No1 / 103
499amnoncommon digestive system, pond, intestine, brazil, remartinia, aeshnidae, dragonfly, larval stage2019-03-05v4No1 / 104
515amnoncommon onthophagus similis, balkan mountains, bulgaria, feces, detritivorous beetle, beetle, whole body2019-04-18v4No1 / 104
284amnoncommon homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 105
301amnoncommon canis lupus familiaris, dog, united states of america, colon2018-03-05v4No1 / 105
438amnoncommon homo sapiens, feces, china, jiangsu province, child, age 8-122018-12-30v4No1 / 106
215amnoncommon homo sapiens, feces, united states of america2017-10-23v4No1 / 107
213amnonlower in patients with bacterial vaginosis compared to healthy controls ( high in control compared to bacterial vaginosis in homo sapiens vagina south africa )2017-10-31v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 107
406amnoncommon feces, zoological garden, south africa, aardvark, orycteropus afer2018-11-21v4No1 / 107
409amnoncommon homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 108
436amnoncommon felis catus, cat, feces, united states of america, state of colorado2018-12-25v4No1 / 108
289amnoncommon homo sapiens, feces, adult, united states of america, state of michigan2018-02-01v4No1 / 109
438amnoncommon homo sapiens, feces, china, jiangsu province, child, age 3-62018-12-30v4No1 / 109
53amnoncommon homo sapiens, feces, lima, city, shantytown2017-01-21v4No1 / 110
271amnon high in root root structure compared to soil rhizosphere in china depth 0-20cm glycine max soybean 2018-01-09v4No1 / 110
276amnoncommon feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v4No1 / 110
425amnoncommon homo sapiens, africa, child, stunted growth, stomach2018-12-08v4No1 / 111
438amnoncommon feces, homo sapiens, china, age 60-79, adult, jiangsu province2018-12-30v4No1 / 111
477amnon high in nepal rural community himalayas compared to united states of america in homo sapiens feces adult 2019-01-28v4No1 / 111
388amnoncommon pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 6-10 weeks2018-11-03v4No1 / 112
79amnoncommon skin, united states of america, delphinus delphis2017-03-03v4No1 / 113
198amnoncommon sediment, yellowstone national park, united states of america, thermophilic sediment, geothermal field, high temperature habitat2017-09-13v4No1 / 113
269amnoncommon in fresh yao meat food (common china, food product, meat food product)2018-01-09v4No1 / 113
517amnoncommon chuquisaca department, rural community, bolivia, age 5-13 years, child, homo sapiens, feces2019-05-29v4No1 / 113
388amnoncommon pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 12-19 weeks2018-11-03v4No1 / 114
438amnoncommon feces, homo sapiens, china, jiangsu province, age 30-50, adult2018-12-30v4No1 / 115
195amnoncommon in boston subway surfaces (common city, urban biome, train, boston)2017-09-07v4No1 / 116
301amnoncommon canis lupus familiaris, dog, united states of america, rectum2018-03-05v4No1 / 116
48amnonhigher in 3 months compared to 1 week in infant hypopharynx ( high in age age 3 months compared to age 1 week in homo sapiens kingdom of denmark hypopharynx infant )2017-01-19v4No1 / 117
149amnonhigher in larvae transferred to stream compared to pond ( high in stream compared to pond in salamandra salamandra fire salamander germany larval stage amphibian larval stage skin mucus )2017-04-24v4No1 / 117
239amnoncommon homo sapiens, feces, united states of america2017-11-08v4No1 / 117
343amnoncommon in apple flowers (common apple, malus x domestica, flower structure, flower, united states of america, state of connecticut)2018-05-28v4No1 / 118
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 118
410amnonlower in feces compared to rectal biopsies in children with treatment naive uc ( high in rectum biopsy biopsy site compared to feces in homo sapiens child united states of america ulcerative colitis )2018-11-22v4No1 / 118
212amnoncommon mouse, mus musculus, feces, research facility, united states of america, lean body mass, control2017-10-22v4No1 / 120
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
352amnoncommon in duodenal biopsies (common homo sapiens, india, new delhi, duodenum, small intestine)2018-07-30v4No1 / 121
371amnoncommon feces, homo sapiens, hunter gatherer, amerindian, venezuela2018-09-06v4No1 / 121
438amnoncommon feces, homo sapiens, china, age >94, jiangsu province, adult2018-12-30v4No1 / 121
515amnoncommon balkan mountains, bulgaria, feces, detritivorous beetle, aphodius depressus, beetle, whole body2019-04-18v4No1 / 121
517amnoncommon forearm, arm, skin, chuquisaca department, rural community, bolivia, age 5-13 years, child, homo sapiens2019-05-29v4No1 / 121
425amnoncommon homo sapiens, africa, child, duodenum, antananarivo, madagascar2018-12-08v4No1 / 123
449amnoncommon homo sapiens, feces, colombia2019-01-09v4No1 / 124
10amnonnegatively correlated with age (6-35) ( high in child compared to adult in homo sapiens feces toronto )2016-10-27v4No1 / 125
425amnoncommon homo sapiens, africa, child, duodenum, stunted growth, central african republic, bangui2018-12-08v4No1 / 125
67amnoncommon in dry processing of coffee beans (common coffea arabica, dry processing, ecuador)2017-02-19v4No1 / 126
69amnoncommon canis lupus familiaris, beagle dog, united states of america, research facility, feces2017-02-21v4No1 / 126
347amnoncommon kingdom of norway, svalbard archipelago, permafrost, soil, depth 150-200cm2018-07-15v4No1 / 126
113amnon high in larval stage compared to adult in danio rerio zebra fish research facility united states of america intestine 2017-04-10v4No1 / 128
131amnoncommon homo sapiens, feces, south korea2017-04-16v4No1 / 128
280amnoncommon atlantic ocean, depth 20m, portuguese republic, eunicella labiata, gorgonian coral, coral, coral reef2018-01-25v4No1 / 128
173amnoncommon homo sapiens, saliva, austria, graz city district2017-07-26v4No1 / 129
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-13v4No1 / 130
39amnoncommon in obese lepr-db mice (common mus musculus, research facility, feces, obesity)2016-12-09v4No1 / 132
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
176amnoncommon in skin of hairless mice (common mouse, mus musculus, skin, female, skh-1 hairless mouse, dorsum, research facility, united states of america)2017-07-29v4No1 / 133
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
438amnoncommon homo sapiens, feces, china, jiangsu province, age 13-142018-12-30v4No1 / 134
495amnoncommon gallus gallus, chicken, caecum, broiler chicken, kingdom of spain, farm, age 2 weeks2019-03-03v4No1 / 134
511amnoncommon snow, depth 0-5cm, united states of america, state of colorado2019-03-20v4No1 / 134
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, finland2017-09-12v4No1 / 136
212amnoncommon mouse, mus musculus, feces, research facility, united states of america, obesity, obese body mass index status, db/db mouse2017-10-22v4No1 / 137
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 137
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 138
255amnoncommon in fish feed (common united states of america, state of minnesota, research facility, fish feed)2017-11-24v4No1 / 141
62amnon high in egypt compared to united states of america in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 144
291amnoncommon canis lupus familiaris, dog, pair of nares, nasal cavity, germany2018-02-01v4No1 / 144
132amnoncommon homo sapiens, feces, united states of america2017-04-16v4No1 / 145
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, schistosomiasis, urinary schistosomiasis2019-03-18v4No1 / 146
15amnoncommon namibia, feces, canis mesomelas2016-11-08v4No1 / 147
85amnoncommon china, litopenaeus vannamei, pacific white shrimp, shenzhen city prefecture, ocean water, digestive system2017-03-06v4No1 / 147
406amnoncommon feces, south africa, lycaon pictus, african wild dog2018-11-21v4No1 / 147
458amnonhigher in BALB/c strain compared to A/J and C57BL/6 strains ( high in balb/c compared to a/j c57bl/6 in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 147
475amnoncommon in air next to subway stations in hong kong (common air, hong kong, city)2019-01-20v4No1 / 147
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, control2019-03-18v4No1 / 147
515amnoncommon aphodius haemorrhoidalis, balkan mountains, bulgaria, feces, detritivorous beetle, beetle, whole body2019-04-18v4No1 / 147
74amnonHigher in animal product diet compared to plant diet ( high in diet animal product diet compared to plant diet in homo sapiens feces united states of america )2017-02-27v4No1 / 149
73amnoncommon homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 150
362amnoncommon hydrothermal vent, greece, marine sediment, mediterranean sea, marine hydrothermal vent, volcanic rock, volcanic crater, water, sea water, active vent2018-08-29v4No1 / 150
358amnonhigher in dnbs induced colitis compared to controls in rat feces ( high in colitis dnbs induced colitis compared to control in rattus rat research facility wistar rat czech republic feces )2018-08-19v4No1 / 154
53amnoncommon homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 155
273amnon high in age age one month compared to age one year in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 155
108amnon high in colon compared to caecum in research facility texas united states of america coturnix coturnix common quail 2017-04-07v4No1 / 157
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 157
108amnoncommon research facility, texas, united states of america, colon, mus musculus, mouse2017-04-07v4No1 / 158
180amnoncommon dermanyssus gallinae, red poulty mite, czech republic, poulty farm, egg, larval stage2017-08-14v4No1 / 158
379amnoncommon gallus gallus, chicken, feces, united kingdom, age 15 - 35 days2018-09-14v4No1 / 160
192amnoncommon seed, seed structure, brassica napus2017-09-05v4No1 / 161
475amnoncommon in air in subway train in hong kong (common air, hong kong, city, subway)2019-01-20v4No1 / 161
121amnonhigh in diarrhea compared to recovery period ( high in diarrhea compared to control in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 162
290amnoncommon homo sapiens, feces, china, adult, city2018-02-01v4No1 / 162
297amnoncommon homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 162
337amnoncommon in feces of house mice from new york city (common mus musculus, house mice, mouse, new york city, united states of america, city)2018-05-18v4No1 / 165
209amnon high in cape cod canal atlantic ocean compared to vancouver pacific ocean in sea water ocean north america depth 25cm 2017-10-15v4No1 / 166
232amnoncoomon in foot of healthy controls (common homo sapiens, skin, australia, foot)2017-11-05v4No1 / 166
159amnoncommon siganidae, rabbitfish, australia, midgut2017-07-06v4No1 / 169
190amnoncommon homo sapiens, tanzania, hadza, hunter gatherer, feces2017-09-04v4No1 / 169
241amnonlower in babies from russia compared to estonia ( high in estonia compared to russia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 169
123amnon high in high fat diet diet compared to normal diet mouse chow in mus musculus mouse feces research facility united states of america c57bl/6j 2017-04-13v4No1 / 170
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 170
374amnoncommon skin, costa rica, amphibia, craugastor bransfordii, bransford’s litter frog, frog2018-09-09v4No1 / 171
534amnoncommon filtered 0.2um, free floating, nepal, koshi river, depth 10 cm, fresh water, water, river2019-07-22v4No1 / 172
347amnoncommon kingdom of norway, svalbard archipelago, permafrost, soil, depth 100-150cm2018-07-15v4No1 / 173
403amnon high in winter compared to summer in air kingdom of spain pyrenees autumn 2018-11-18v4No1 / 176
405amnoncommon mouse, mus musculus, research facility, feces, united states of america, swiss webster, ketogenic diet2018-11-20v4No1 / 177
515amnoncommon onthophagus ruficapillus, balkan mountains, bulgaria, feces, detritivorous beetle, beetle, whole body2019-04-18v4No1 / 178
530amnoncommon hunan province, adula, china, farm, snake farm, feces, pit viper, deinagkistrodon acutus, snake2019-07-21v4No1 / 178
179amnoncommon mus musculus, mouse, oral cavity, mouth, research facility, united states of america, balb/c2017-08-13v4No1 / 183
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 183
399amnoncommon feces, united states of america, research facility, rat, rattus norvegicus2018-11-16v4No1 / 184
495amnoncommon gallus gallus, chicken, caecum, broiler chicken, kingdom of spain, farm, age 4 weeks2019-03-03v4No1 / 185
299amnoncommon saliva, adult, homo sapiens, china, cancer, mouth neoplasm2018-02-27v4No1 / 188
73amnonhigh in children with Crohn's disease compared to healthy adult controls ( high in crohn's disease obsolete_juvenile stage child compared to control adult in homo sapiens feces glasgow )2017-02-26v4No1 / 189
197amnon high in india compared to finland in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 189
386amnoncommon mouse, mus musculus, caecum, wild, brazil2018-10-28v4No1 / 189
402amnon high in zone 1 compared to zone 2,3 in china sediment soil mine tailing alkaline mine tailing guangxi zhuang autonomous region 2018-11-18v4No1 / 189
495amnoncommon gallus gallus, chicken, caecum, kingdom of spain, farm, free range chicken, age 8 weeks2019-03-03v4No1 / 189
352amnon high in feces compared to small intestine duodenum in homo sapiens india new delhi 2018-07-30v4No1 / 190
75amnoncommon homo sapiens, skin, arm, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 191
80amnon high in dry forest compared to tropical moist broadleaf forest biome in feces alouatta pigra howler monkey woodland central america 2017-03-03v4No1 / 193
109amnon high in water treatment plant compared to distribution system in usa water drinking water site c 2017-04-08v4No1 / 193
534amnoncommon filtered 2.7um, particle bound, nepal, tributary, koshi river, depth 10 cm, fresh water, water, river2019-07-22v4No1 / 193
371amnoncommon homo sapiens, skin, amerindian, hunter gatherer, venezuela2018-09-06v4No1 / 195
312amnoncommon feces, homo sapiens, french republic, adult, spondylitis, spondyloarthritis2018-04-09v4No1 / 197
80amnoncommon feces, alouatta pigra, howler monkey, woodland, tropical broadleaf forest biome, central america2017-03-03v4No1 / 198
411amnoncommon zambia, feces, monkey, papio kindae, kinda baboon, wild2018-11-23v4No1 / 200
42amnoncommon in tcr-b deficient c57bl6 mice (common feces, research facility, mus musculus, c57bl/6, japan)2016-12-10v4No1 / 201
248amnoncommon mouse, mus musculus, research facility, fvb/n mice, germany, feces2017-11-22v4No1 / 203
405amnoncommon mouse, mus musculus, research facility, feces, united states of america, swiss webster, control diet2018-11-20v4No1 / 203
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
150amnoncommon canis lupus familiaris, dog, feces, united states of america2017-04-26v4No1 / 208
159amnoncommon siganidae, rabbitfish, hindgut, australia2017-07-06v4No1 / 208
542amnoncommon adult, age 12-23 years, puerto rico, research facility, macaca mulatta, monkey, dentition, subgingival plaque2019-08-01v4No1 / 208
388amnon high in age 6-10 weeks compared to age 12-19 weeks in pig sus scrofa tonsil farm united states of america state of michigan 2018-11-03v4No1 / 210
495amnoncommon gallus gallus, chicken, caecum, broiler chicken, kingdom of spain, farm, age 6 weeks2019-03-03v4No1 / 210
511amnoncommon snow, depth 0-5cm, lapland, finland, sweden, kingdom of norway2019-03-20v4No1 / 213
495amnoncommon gallus gallus, chicken, caecum, kingdom of spain, farm, free range chicken, age 12 weeks2019-03-03v4No1 / 214
520amnonhigher in gastric cancer compared to paired normal tissue ( high in stomach neoplasm gastric carcinoma compared to control in adult stomach zhejiang province china homo sapiens )2019-06-26v3No1 / 214
201amnonhigher in cactus fly compared to decaying cactus ( high in drosophila fly drosophila nigrospiracula compared to cactus decaying in mexico desert )2017-10-01v4No1 / 215
433amnoncommon sea water, ocean, depth 4m, south china sea, coast2018-12-19v4No1 / 215
108amnoncommon research facility, texas, united states of america, caecum, coturnix coturnix, common quail2017-04-07v4No1 / 216
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon homo sapiens, feces, china, adult, small village, rural community2018-02-01v4No1 / 218
347amnon high in depth 100-150cm depth 150-200cm compared to depth 20-30cm in kingdom of norway svalbard archipelago permafrost soil 2018-07-15v4No1 / 221
411amnoncommon zambia, feces, monkey, wild, papio ursinus, grayfoot chacma baboon2018-11-23v4No1 / 224
265amnoncommon in tree leaves (common canada, province of quebec, tree, leaf)2017-12-11v4No1 / 226
42amnoncommon in tcr-b deficient balb/c mice (common mus musculus, research facility, japan, feces, balb/c)2016-12-10v4No1 / 227
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 227
25amnon high in antibiotic compared to control in oryctolagus cuniculus caecum rex rabbit sichuan province research facility 2016-12-01v4No1 / 231
214amnonlower in mice from jackson laboratories compared to taconic farms ( high in taconic farms compared to jackson laboratories in mouse mus musculus feces united states of america research facility strain 129s )2017-10-23v4No1 / 232
349amnoncommon rattus, rat, feces, china, research facility, sprague dawley, male2018-07-29v4No1 / 235
78amnoncommon nanger granti, kenya, feces, tropical grassland biome, gazelle2017-03-01v4No1 / 236
495amnoncommon gallus gallus, chicken, caecum, kingdom of spain, farm, free range chicken, age 3 weeks2019-03-03v4No1 / 236
53amnon high in shantytown lima compared to el salado small village in homo sapiens feces city 2017-01-21v4No1 / 237
286amnoncommon in feces of individuals with kidney stones (common homo sapiens, feces, adult, age 50-60 years, china, nanning city prefecture, nephrolithiasis)2018-01-27v4No1 / 239
406amnoncommon feces, zoological garden, french republic, gorilla gorilla, monkey, gorilla2018-11-21v4No1 / 239
108amnoncommon research facility, texas, united states of america, caecum, mus musculus, mouse2017-04-07v4No1 / 241
220amnoncommon feces, united states of america, female, research facility, mus musculus, balb/c, high fat diet, mouse, diet2017-10-24v4No1 / 241
483amnoncommon hawaii, pearl harbor, research facility, hydroides elegans, tubeworm, united states of america, egg2019-02-13v4No1 / 243
161amnoncommon in barn swallows in colorado (common hirundo rustica, feces, united states of america, colorado, barn swallow)2017-07-12v4No1 / 245
425amnon high in antananarivo madagascar compared to bangui central african republic in homo sapiens feces africa child 2018-12-08v4No1 / 248
351amnoncommon sea urchin, lytechinus variegatus, coelomic fluid, research facility, eagle harbor, state of florida, united states of america2018-07-30v4No1 / 249
429amnoncommon rat, rattus norvegicus, dahl salt-sensitive, feces, israel, research facility, salt rich diet, salt2018-12-13v4No1 / 249
219amnoncommon in mother mice feces (common mus musculus, mouse, feces, c57bl/6, research facility, south korea, female)2017-10-24v4No1 / 250
375amnonhigher in oil contaminated soil planted with plants compared to control oil contaminated soil ( high in rhizosphere planted soil compared to control in soil kuwait desert oil contaminated soil )2018-09-09v4No1 / 251
419amnoncommon rat, rattus norvegicus, sprague dawley, china, research facility, feces2018-12-02v4No1 / 254
214amnon high in diet high fat diet compared to nih-31m chow mouse chow in mouse mus musculus feces united states of america research facility 2017-10-23v4No1 / 255
503amnoncommon mouse, mus musculus, research facility, japan, feces, balb/c2019-03-12v4No1 / 257
220amnoncommon mus musculus, mouse, feces, research facility, united states of america, female, balb/c, diet, mouse chow, low fat diet2017-10-24v4No1 / 262
276amnoncommon feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 263
304amnoncommon united states of america, state of california, beach, pacific ocean, air, aerosol, monterey bay2018-03-12v4No1 / 263
253amnoncommon in clouds in puy de dome mountain in france (common cloud, french republic, air, fall)2017-11-22v4No1 / 267
49amnoncommon giraffa camelopardalis, feces2017-01-19v4No1 / 268
78amnonhigher in older gazelles ( high in age old age compared to young age in nanger granti kenya feces tropical grassland biome gazelle )2017-03-01v4No1 / 273
406amnonhigher in captive white rhinoceros compared to wild ( high in zoological garden french republic compared to wild south africa in feces bovidae ceratotherium simum white rhinoceros )2018-11-21v4No1 / 277
160amnoncommon in river water upstream of WTP effluent in spring in china (common river, china, water, spring)2017-07-12v4No1 / 278
225amnoncommon in polgA mutants (accelerated aging) (common mouse, mus musculus, feces, research facility, united kingdom, polga mutant)2017-10-29v4No1 / 281
286amnoncommon in feces of individuals without kidney stones (common homo sapiens, feces, adult, age 50-60 years, china, nanning city prefecture, control)2018-01-27v4No1 / 281
384amnon high in barn hay compared to pasture in equus caballus horse canada farm mouth saliva 2018-10-22v4No1 / 283
495amnoncommon gallus gallus, chicken, caecum, kingdom of spain, farm, free range chicken, age 6 weeks2019-03-03v4No1 / 290
423amnoncommon bank vole, myodes glareolus, ukraine, skin2018-12-05v4No1 / 291
411amnoncommon feces, monkey, united states of america, zoological garden, papio anubis, olive baboon2018-11-23v4No1 / 292
237amnonlower in burrow soil compared to bird ( high in oceanodroma leucorhoa bird seabird compared to soil burrow in canada bon portage island )2017-11-07v4No1 / 298
419amnoncommon in rats with induced constipation (common rat, rattus norvegicus, sprague dawley, china, research facility, feces, constipation)2018-12-02v4No1 / 300
363amnoncommon ovis aries, age 30 days, obsolete_juvenile stage, italy, dairy, rumen, ruminant reticulum, omasum2018-08-29v4No1 / 302
78amnon high in male compared to female in nanger granti kenya feces tropical grassland biome gazelle 2017-03-01v4No1 / 304
80amnoncommon feces, woodland, central america, alouatta palliata, mantled howler monkey2017-03-03v4No1 / 309
358amnoncommon rattus, rat, research facility, wistar rat, czech republic, feces2018-08-19v4No1 / 309
80amnon high in dry forest compared to tropical moist broadleaf forest biome in feces woodland central america alouatta palliata mantled howler monkey 2017-03-03v4No1 / 314
208amnoncommon mus musculus, mouse, feces, united states of america, state of texas, balb/c2017-10-06v4No1 / 316
510amnoncommon kingdom of spain, water, bilbao, estuary, estuary water, fresh water, salinity <5 ppt2019-03-20v4No1 / 317
299amnon high in cancer mouth neoplasm compared to control in saliva adult homo sapiens china 2018-02-27v4No1 / 319
515amnoncommon onthophagus ovatus, balkan mountains, bulgaria, feces, detritivorous beetle, beetle, whole body2019-04-18v4No1 / 322
518amnonhigher in beginning of experiment ( high in days 1-2 compared to days 14-28 in angus steer post-weaning state of georgia united states of america feces cow bos taurus )2019-06-11v4No1 / 325
429amnoncommon rat, rattus norvegicus, dahl salt-sensitive, feces, israel, research facility, control diet2018-12-13v4No1 / 327
61amnoncommon canis lupus familiaris, skin, research facility, united states of america, inguinal region2017-02-05v4No1 / 328
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
400amnonlower in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in karen myanmar compared to hmong china in homo sapiens feces thailand rural community )2018-11-18v4No1 / 329
111amnoncommon mongolian sheep, china, ovis aries, rectum, ileum, cecum, colon2017-04-09v4No1 / 330
433amnoncommon sea water, ocean, depth 4m, indian ocean2018-12-19v4No1 / 333
423amnon high in human contact compared to no human contact chernobyl exclusion zone in bank vole myodes glareolus ukraine skin 2018-12-05v4No1 / 334
351amnoncommon in artificial sea water where sea urchins were grown (common sea urchin, lytechinus variegatus, research facility, state of florida, united states of america, artificial seawater, sea water)2018-07-30v4No1 / 338
124amnoncommon mus musculus, mouse, caecum, feces, c57bl/6j, united states of america2017-04-14v4No1 / 339
190amnon high in wet season compared to dry season in homo sapiens tanzania hadza hunter gatherer feces 2017-09-04v4No1 / 341
93amnoncommon in seawater near the shore in hawaii (common hawaii, sea water, shore)2017-03-12v4No1 / 345
254amnoncommon river, china, water, fresh water, depth 0.5m, jiulong river, fujian province2017-11-23v4No1 / 347
254amnonhigher in river when close to populated region compared to downstream ( high in city populated place upstream compared to downstream in river china water fresh water depth 0.5m jiulong river fujian province )2017-11-23v4No1 / 356
442amnoncommon in tnbs induced colitis in rat feces (common rattus norvegicus, rat, sprague dawley, male, research facility, china, feces, colitis, tnbs)2019-01-06v4No1 / 360
341amnonhigher in fresh drinking water compared to week old water ( high in fresh water compared to stagnant water in water drinking water united states of america tap water state of illinois )2018-05-28v4No1 / 365
225amnoncommon in wild type cotrols (common mouse, mus musculus, feces, research facility, united kingdom, wild type genotype)2017-10-29v4No1 / 370
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
160amnoncommon in river water upstream of WTP effluent in autumn in china (common river, china, water, autumn)2017-07-12v4No1 / 376
400amnonhigher in people from thailand compared to 2nd generation immigrants to usa ( high in thailand rural community compared to united states of america in homo sapiens feces )2018-11-18v4No1 / 378
29amnon high in seed compared to seedling in brassica oleracea french republic 2016-12-05v4No1 / 379
458amnonlower in A/J strain compared to BALB/c and C57BL/6 strains ( high in balb/c c57bl/6 compared to a/j in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 379
256amnoncommon sus scrofa, pig, united kingdom, duodenum, jejunum, ileum2017-11-26v4No1 / 380
314amnoncommon caecum, cecal content, china, tibet autonomous region, farm, sus scrofa, pig2018-04-10v4No1 / 402
347amnoncommon kingdom of norway, svalbard archipelago, permafrost, soil, depth 0-20cm, permafrost active layer2018-07-15v4No1 / 405
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
515amnoncommon aphodius pusillus, balkan mountains, bulgaria, feces, detritivorous beetle, beetle, whole body2019-04-18v4No1 / 421
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, grivet monkey2018-01-16v4No1 / 440
75amnoncommon homo sapiens, venezuela, feces, amerindian, hunter gatherer2017-02-27v4No1 / 442
371amnonhigher in amerindians compared to western visitors ( high in hunter gatherer amerindian venezuela compared to city united states of america in feces homo sapiens )2018-09-06v4No1 / 443
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, vervet monkey2018-01-16v4No1 / 446
399amnoncommon feces, united states of america, zoological garden, state of tennessee, ovis aries, sheep2018-11-16v4No1 / 451
424amnoncommon sus scrofa, pig, jinhua city prefecture, china, jinhua pig, feces, farm2018-12-06v4No1 / 452
470amnoncommon sus scrofa, pig, canada, farm, province of quebec, feces, female, adult, pregnancy2019-01-14v4No1 / 457
111amnon high in rectum caecum ileum colon compared to rumen ruminant reticulum omasum in mongolian sheep china ovis aries 2017-04-09v4No1 / 464
406amnoncommon feces, zoological garden, french republic, connochaetes taurinus, blue wildebeest2018-11-21v4No1 / 467
160amnoncommon in wastewater treatment plant effluent in autumn in china (common china, autumn, wastewater treatment plant, effluent)2017-07-12v4No1 / 469
276amnon high in peru small village tunapuco rural community compared to united states of america city state of oklahoma in feces homo sapiens adult 2018-01-22v4No1 / 469
221amnoncommon rattus, sprague dawley, rat, feces, china, research facility2017-10-25v4No1 / 470
406amnoncommon feces, zoological garden, ceratotherium simum, white rhinoceros, french republic2018-11-21v4No1 / 474
406amnoncommon feces, zoological garden, french republic, antidorcas marsupialis, springbok2018-11-21v4No1 / 477
454amnoncommon feces, china, elaphurus davidianus, pere deer, deer, wild2019-01-10v4No1 / 480
236amnoncommon state of california, bodega bay, ocean, zostera marina, marine eelgrass, root2017-11-07v4No1 / 483
438amnon high in age 30-50 age 60-79 adult compared to age 3-6 age 8-12 child in homo sapiens feces china 2018-12-30v4No1 / 486
274amnoncommon monkey, chlorocebus djamdjamensis, bale monkey, ethiopia, feces2018-01-16v4No1 / 489
256amnoncommon sus scrofa, pig, united kingdom, caecum, right colon, left colon2017-11-26v4No1 / 490
518amnoncommon angus steer, post-weaning, state of georgia, united states of america, feces, cow, bos taurus2019-06-11v4No1 / 498
304amnoncommon united states of america, state of california, beach, pacific ocean, air, aerosol, santa cruz province2018-03-12v4No1 / 518
27amnoncommon bos grunniens, rumen, china2016-12-05v4No1 / 532
209amnonlower in whale blow condensate compared to ocean water ( high in sea water ocean depth 25cm compared to megaptera novaeangliae humpback whale respiratory airway whale blow exhaled air condensate in north america )2017-10-15v4No1 / 560
254amnon high in summer fall wet season compared to winter dry season in river china water fresh water depth 0.5m jiulong river fujian province 2017-11-23v4No1 / 571
160amnoncommon in wastewater treatment plant effluent in spring in china (common china, wastewater treatment plant, effluent, spring)2017-07-12v4No1 / 573
254amnon high in summer wet season compared to fall winter dry season in river china water fresh water depth 0.5m jiulong river fujian province 2017-11-23v4No1 / 581
84amnoncommon soil, peatland, wetland, peat soil, sphagnum bog, temperate grassland biome, depth 20cm2017-03-06v4No1 / 590
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in kingdom of spain water bilbao estuary estuary water 2019-03-20v4No1 / 592
318amnoncommon canada, vancouver, ocean, pacific ocean, red alga, mastocarpus2018-04-16v4No1 / 598
406amnoncommon feces, zoological garden, diceros bicornis, black rhinoceros, united states of america, switzerland2018-11-21v4No1 / 600
517amnon high in feces compared to forearm arm skin in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 606
265amnonhigher in tree leaves compared to soil and soilwater ( high in leaf tree compared to soil soilwater water in canada province of quebec )2017-12-11v4No1 / 610
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in homo sapiens feces china )2018-12-30v4No1 / 617
264amnoncommon oryctolagus cuniculus, rex rabbit, china, caecum, research facility, jiangsu province2017-12-11v4No1 / 622
458amnonhigher in mice from hsd compared to jackson laboratories ( high in harlan sprague dawley compared to jackson laboratories in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 644
443amnonhigher in lower mississippi river (downstream) compared to upper mississippi river ( high in downstream lower mississippi river compared to upstream higher mississippi river in mississippi river water river fresh water depth 1m united states of america free floating filtered 0.2um )2019-01-07v4No1 / 652
103amnonlower in particle bound fraction compared to free floating bacteria in mississippi river ( high in free floating compared to particle in river united states of america mississippi river fresh water aquatic biome )2017-04-05v4No1 / 653
25amnoncommon oryctolagus cuniculus, caecum, rex rabbit, sichuan province, research facility2016-12-01v4No1 / 669
406amnoncommon feces, south africa, antidorcas marsupialis, springbok2018-11-21v4No1 / 678
347amnoncommon kingdom of norway, svalbard archipelago, permafrost, soil, depth 20-30cm2018-07-15v4No1 / 698
517amnon high in feces compared to mouth mucosa mouth in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 752
206amnoncommon in air from israel particles <10um size (common air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 765
157amnoncommon in naers of weened calves (common nasal cavity, bos taurus, calve, united states of america, juvenile organism, pair of nares)2017-07-04v4No1 / 766
454amnon high in summer compared to winter in china elaphurus davidianus pere deer deer feces 2019-01-10v4No1 / 791
371amnonhigher in skin of amerindians compared to western visitors ( high in venezuela hunter gatherer amerindian compared to city united states of america in homo sapiens skin )2018-09-06v4No1 / 854
479amnoncommon rhizosphere, united states of america, state of california, ph 6-7, ceanothus jepsonii2019-02-05v4No1 / 900
206amnoncommon in dust storm air from israel particles <10um size (common israel, air, size < 10um, dust, dust storm)2017-10-04v4No1 / 902
103amnoncommon river, united states of america, mississippi river, fresh water, aquatic biome, particle2017-04-05v4No1 / 909
103amnoncommon river, united states of america, mississippi river, fresh water, aquatic biome, free floating2017-04-05v4No1 / 909
359amnoncommon soil, china, topsoil, depth 0-10cm, guangdong province, subtropical broadleaf forest biome, forest, woodland2018-08-19v4No1 / 935
479amnoncommon rhizosphere, united states of america, state of california, heteromeles arbutifolia, ph 6-72019-02-05v4No1 / 1006
517amnon high in forearm arm skin compared to mouth mucosa mouth in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 1014
83amnon high in diet control normal diet compared to restricted diet in bos taurus rumen holstein-friesian bull ireland 2017-03-05v4No1 / 1023
406amnoncommon feces, zoological garden, hippotragus niger, sable antelope, french republic2018-11-21v4No1 / 1075
252amnoncommon in river rock biofilm (common kingdom of spain, biofilm, river, rock, epilithic)2017-11-22v4No1 / 1081
478amnoncommon china, farm, shrimp farm, sediment2019-02-19v4No1 / 1085
454amnon high in wild compared to captive in china elaphurus davidianus pere deer deer feces 2019-01-10v4No1 / 1094
93amnoncommon in marine sediment near the shore in hawaii (common hawaii, shore, marine sediment)2017-03-12v4No1 / 1151
266amnon high in leaf compared to root in brassicaceae boechera stricta plant united states of america state of idaho 2017-12-19v4No1 / 1175
252amnoncommon in river sand biofilm (common river, biofilm, kingdom of spain, sand)2017-11-22v4No1 / 1181
223amnoncommon china, ocean, sediment, east china sea, marine sediment2017-10-26v4No1 / 1311
40amnoncommon soil, china, field soil, nicotiana tabacum, rhizosphere2016-12-09v4No1 / 1420
76amnoncommon in seleniferous soil (common soil, rhizosphere, united states of america, woodland, selenium, seleniferous)2017-02-28v4No1 / 1438
271amnoncommon china, rhizosphere, glycine max, depth 0-20cm, soybean2018-01-09v4No1 / 1459
515amnon high in bulgaria detritivorous beetle compared to poland herbivorous beetle in beetle whole body 2019-04-19v4No1 / 1543
304amnoncommon united states of america, state of california, beach, pacific ocean, sand, santa cruz province2018-03-12v4No1 / 1838
155amnoncommon in soil tightly bound to wheat root (common triticum aestivum, wheat, china, soil, root)2017-07-02v4No1 / 1977
175amnoncommon in heavy metal contaminated soils in china (common china, soil, heavy metal, ph 7-9)2017-07-29v4No1 / 2133
296amnoncommon china, soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>6, ph<72018-02-11v4No1 / 2223
296amnoncommon in wheat field soil (common china, soil, north china plain, depth 5cm, agricultural feature, wheat, winter)2018-02-11v4No1 / 2341
155amnoncommon in soil loosely bound to wheat root (common triticum aestivum, wheat, china, soil, rhizosphere)2017-07-02v4No1 / 2425
155amnoncommon in bulk soil in wheat field (common triticum aestivum, wheat, china, soil, bulk soil)2017-07-02v4No1 / 2594
296amnoncommon china, soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>82018-02-11v4No1 / 2646
265amnon high in soil compared to soilwater water in canada province of quebec 2017-12-11v4No1 / 2715
271amnoncommon china, depth 0-20cm, soil2018-01-09v4No1 / 2856
84amnoncommon soil, temperate grassland biome, fen, peat soil, flooded grassland biome, united kingdom, depth 20 cm2017-03-06v4No1 / 2866
84amnoncommon soil, temperate grassland biome, fen, peat soil, flooded grassland biome, united kingdom, depth 5 cm2017-03-07v4No1 / 3434
296amnoncommon china, soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>5, ph<62018-02-11v4No1 / 3508
271amnon high in soil compared to rhizosphere glycine max soybean in china depth 0-20cm 2018-01-09v4No1 / 4853
171amnonlower in roots compared to rhizosphere soil in rice ( high in rhizosphere soil compared to root in united states of america state of california oryza sativa rice )2017-07-25v4No1 / 7628

Problems / suggestions? Please email info AT dbbact DOT org