Search result for sequence:
TACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCTGATACTGGCAAGCTTGAGTCTCGTAGAGGGGGGTAGAATTCCAGG
common ontology terms
term enrichment score
TermScore
feces0.591780
homo sapiens0.440432
united states of america0.381612
adult0.260431
china0.226413
research facility0.213606
soil0.126612
child0.095156
mus musculus0.092279
infant0.090458
mouse0.082578
canis lupus familiaris0.082411
farm0.081686
caecum0.079400
dog0.073845
wild0.073247
female0.072503
control0.066350
sus scrofa0.063816
LOWER IN control0.058975
pig0.058330
gallus gallus0.057187
chicken0.057187
state of michigan0.054995
state of california0.054250
city0.053290
rural community0.051991
bird0.048008
kingdom of spain0.046417
canada0.045517
zoological garden0.042934
australia0.042803
obsolete_juvenile stage0.042422
israel0.042014
whole body0.039568
depth (soil) 0-20cm0.038613
skin0.038052
ileum0.036917
male0.036490
hospital0.035522
monkey0.035410
iowa0.035365
french republic0.035158
water0.034602
colon0.034451
india0.033495
rectum0.031858
united states0.031481
des moines0.031481
nicollet soil series0.031481
crohn's disease0.029907
united kingdom0.029811
rat0.029783
river0.029685
fresh water0.029250
agricultural field0.029185
zea mays0.028765
marine sediment0.028725
diarrhea0.028143
state of texas0.027979
jiangsu province0.027624
rhizosphere0.026978
age 6 weeks0.026185
kalamazoo loam0.026071
mesic type hapludalf0.026071
kellogg biological station0.026071
glycine max0.025571
body proper0.024933
nepal0.024402
ulcerative colitis0.024402
urocyon littoralis0.024254
urocyon littoralis catalinae0.024254
santa catalina island fox0.024254
ovis aries0.024254
age0.024224
santa catalina island0.023963
mangrove swamp0.023679
rattus norvegicus0.022514
obesity0.022502
larval stage0.022493
duodenum0.022472
kingdom of norway0.022430
kenya0.022430
kingdom of denmark0.022263
digestive system0.022059
germany0.021794
beetle0.020706
air0.020599
broiler chicken0.020599
africa0.020599
japan0.020389
panama0.019982
hunter gatherer0.018880
colombia0.018850
rectal swab0.018821
commonwealth of pennsylvania0.018718
guangzhou city prefecture0.018674
sweden0.018657
adult organism0.018645
captive0.018374
Fraction of dbbact annotations with this term covered by the query
TermScore
rural community0.900000
hospital0.800000
rectum0.800000
diarrhea0.750000
sinusitis0.750000
hunter gatherer0.750000
nigeria0.750000
obese body mass index status0.750000
small village0.750000
state of arizona0.750000
balb/c0.750000
LOWER IN rumen0.750000
under-1-year-old human stage0.714286
bird0.700000
monkey0.700000
sus scrofa0.687500
city0.684211
crohn's disease0.666667
iowa0.666667
2-month-old human stage0.666667
age 2 weeks0.666667
dust0.666667
venezuela0.666667
amerindian0.666667
state of idaho0.666667
LOWER IN 1-year-old human stage0.666667
beetle0.666667
state of michigan0.666667
nepal0.666667
village0.666667
colombia0.666667
paranasal sinus0.666667
sinusoidal space0.666667
central african republic0.666667
madagascar0.666667
ulcerative colitis0.666667
cebus capucinus0.666667
white-faced capuchin0.666667
uropygial gland0.666667
nanchang city prefecture0.666667
homosexual0.666667
msm0.666667
anser cygnoides0.666667
age < 3 years0.666667
overweight body mass index status0.666667
atlanta0.666667
LOWER IN hindgut0.666667
city of melbourne0.666667
human contact0.666667
tibet autonomous region0.666667
state of oklahoma0.666667
fish feed0.666667
age 5-13 years0.666667
metabolic syndrome0.666667
hot spring0.666667
geothermal field0.666667
arm0.666667
seed0.666667
province of quebec0.666667
rex rabbit0.666667
age < 1 year0.666667
heavy metal0.666667
guangdong province0.666667
canis lupus familiaris0.653846
feces0.636964
dog0.636364
pig0.625000
infant0.625000
india0.625000
flower0.600000
age 4 weeks0.600000
rectal swab0.600000
age 6 weeks0.600000
rattus norvegicus0.600000
parkinson's disease0.600000
1-month-old human stage0.600000
obsolete_juvenile stage0.600000
heterosexual0.600000
msw0.600000
LOWER IN united states of america0.600000
shelled egg0.600000
colitis0.600000
cecal content0.600000
united kingdom0.583333
obesity0.583333
larval stage0.571429
state of texas0.571429
costa rica0.571429
mexico0.571429
state of minnesota0.571429
new york city0.571429
finland0.571429
woodland area0.571429
rat0.562500
felis catus0.555556
state of colorado0.555556
duodenum0.545455
french republic0.545455
ileum0.533333
mus musculus0.516129
Fraction of annotations for the query sequences containing the term
TermScore
feces0.552581
homo sapiens0.390057
united states of america0.304015
adult0.187380
china0.161568
research facility0.138623
soil0.085086
child0.052581
mus musculus0.050669
infant0.048757
farm0.045889
mouse0.044933
canis lupus familiaris0.043977
caecum0.043021
control0.042065
female0.042065
wild0.040153
dog0.039197
LOWER IN control0.034417
sus scrofa0.033461
pig0.030593
gallus gallus0.030593
chicken0.030593
state of california0.028681
state of michigan0.028681
city0.027725
rural community0.026769
bird0.024857
kingdom of spain0.024857
canada0.023901
zoological garden0.022945
australia0.022945
israel0.021989
obsolete_juvenile stage0.021989
whole body0.021033
depth (soil) 0-20cm0.021033
skin0.020076
male0.020076
ileum0.019120
water0.019120
colon0.018164
iowa0.018164
french republic0.018164
hospital0.018164
monkey0.018164
india0.017208
zea mays0.016252
agricultural field0.016252
united states0.016252
des moines0.016252
nicollet soil series0.016252
rectum0.016252
united kingdom0.015296
crohn's disease0.015296
river0.015296
fresh water0.015296
rat0.015296
marine sediment0.015296
diarrhea0.014340
state of texas0.014340
jiangsu province0.014340
rhizosphere0.014340
body proper0.013384
glycine max0.013384
age 6 weeks0.013384
kalamazoo loam0.013384
mesic type hapludalf0.013384
kellogg biological station0.013384
age0.012428
santa catalina island0.012428
urocyon littoralis0.012428
urocyon littoralis catalinae0.012428
santa catalina island fox0.012428
nepal0.012428
ovis aries0.012428
ulcerative colitis0.012428
mangrove swamp0.012428
larval stage0.011472
duodenum0.011472
kingdom of norway0.011472
kenya0.011472
digestive system0.011472
kingdom of denmark0.011472
obesity0.011472
rattus norvegicus0.011472
germany0.011472
air0.010516
japan0.010516
broiler chicken0.010516
beetle0.010516
africa0.010516
panama0.010516
adult organism0.009560
hunter gatherer0.009560
captive0.009560
sweden0.009560
rectal swab0.009560
colombia0.009560
commonwealth of pennsylvania0.009560
guangzhou city prefecture0.009560
Exp. ID User ID Description Date Region Flag Sequences
117amnonlower in sox10 mutant fish with high neutrophil count ( high in control low neutrophils compared to neutrophil hirschsprung disease high neutrophils in united states of america research facility larval stage intestine danio rerio zebra fish )2017-04-10v4No1 / 1
207amnonhigher in people hospitalized with diarrhea compared to healthy controls ( high in diarrhea compared to control in feces homo sapiens pathogen israel )2017-10-05v4No1 / 1
256amnonhigher in illeum compared to other gi tract locations in pigs ( high in ileum compared to caecum duodenum jejunum left colon right colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 1
234amnoncandidate contaminant (high in blank) (contamination)2017-11-07v4No1 / 2
702amnondominant feces, united states of america, equus caballus, state of north carolina, horse2028-04-02v4No1 / 2
16amnon high in diarrhea compared to control in feces felis catus state of california 2016-11-08v4No1 / 3
127amnonhigh in young (0-3 days) compared to old (28 day) chickens ( high in age young age compared to old age in united states of america caecum gallus gallus chicken )2017-04-14v4No1 / 3
399amnon high in crohn's disease compared to ulcerative colitis in feces homo sapiens united states of america 2018-11-16v4No1 / 3
456amnonreagent contaminant (high in blanks) in mouse nasopharynx study (contamination)2019-01-10v4No1 / 3
567amnon high in chronic rhinosinusitis sinusitis compared to control in homo sapiens pair of nares adult belgium anterior naris 2019-12-05v4No1 / 3
320amnonlower in CD patients with remission ( high in crohn's disease compared to remission in feces homo sapiens adult )2018-04-19v4No1 / 4
440amnoncommon feces, geospiza fortis, galapagos islands, bird, finch, medium ground finch2019-01-06v4No1 / 4
301amnon high in duodenum ileum compared to rectum colon in united states of america canis lupus familiaris dog 2018-03-05v4No1 / 5
108amnondominant united states of america, research facility, colon, state of texas, quail, coturnix coturnix2017-04-07v4No1 / 6
347amnondominant permafrost, soil, kingdom of norway, svalbard archipelago, depth 100-150cm2018-07-15v4No1 / 6
582amnondominant united states of america, external acoustic meatus, ear canal, wild, santa catalina island, urocyon littoralis, urocyon littoralis catalinae, santa catalina island fox2020-01-22v4No1 / 6
795amnoncommon research facility, gallus gallus, chicken, uterine tube infundibulum, adult organism, china, age 90 weeks2021-06-08v4No1 / 6
801sheryoDominant at depth 60-90cm in corn agriculture fields, Iowa USA (dominant soil, zea mays, iowa, agricultural field, united states, des moines, nicollet soil series, depth (soil) 60-90cm, kanawha, ph 8.3)2021-06-15v4No1 / 6
49amnonincreases during sample storage in giraffe feces (other feces, giraffa camelopardalis)2017-01-19v4No1 / 6
207amnoncommon in people hospitalized with diarrhea (common feces, homo sapiens, israel, diarrhea)2017-10-05v4No1 / 7
262amnondominant research facility, larval stage, body proper, ixodes scapularis, tick2017-12-10v4No1 / 8
332amnoncommon homo sapiens, city, infant, vellore district, india, 2-month-old human stage2018-05-14v4No1 / 8
406amnondominant feces, united states of america, zoological garden, equus przewalskii, przewalski horse2018-11-21v4No1 / 8
406amnondominant feces, zoological garden, french republic, connochaetes taurinus, blue wildebeest2018-11-21v4No1 / 8
406amnondominant feces, united states of america, zoological garden, myrmecophaga tridactyla, giant anteater2018-11-21v4No1 / 8
440amnoncommon feces, geospiza difficilis, galapagos islands, bird, finch, sharp-beaked ground finch2019-01-06v4No1 / 8
454amnondominant feces, wild, elaphurus davidianus, pere deer, deer, china2019-01-10v4No1 / 8
516amnoncommon homo sapiens, united states of america, urine, adult, state of ohio2019-05-29v4No1 / 8
801sheryoDominant in soybean and corn agriculture fields at depth 60-90cm, Iowa USA (dominant soil, zea mays, glycine max, iowa, agricultural field, united states, ames, des moines, ph 7.7, nicollet soil series, depth (soil) 60-90cm)2021-06-15v4No1 / 8
56amnondominant nectar, israel, flower, nicotiana glauca2017-01-30v4No1 / 8
92amnoncommon air, japan2017-03-09v4No1 / 9
301amnondominant united states of america, duodenum, canis lupus familiaris, dog2018-03-05v4No1 / 9
332amnondominant homo sapiens, city, infant, vellore district, india, 2-month-old human stage2018-05-14v4No1 / 9
391amnoncommon feces, hospital, infant, diarrhea, china, under-1-year-old human stage2018-11-04v4No1 / 9
399amnondominant feces, united states of america, mustela putorius furo, ferret2018-11-16v4No1 / 9
423amnondominant skin, ukraine, bank vole, myodes glareolus2018-12-05v4No1 / 9
497amnondominant feces, farm, gallus gallus, austria, chicken, broiler chicken, age 2 weeks2019-03-04v4No1 / 9
10amnon high in female compared to male in feces homo sapiens toronto 2016-10-27v4No1 / 10
117amnondominant united states of america, research facility, larval stage, intestine, danio rerio, zebra fish2017-04-10v4No1 / 10
177amnonblooming bacteria (grows in storage at room temp.) (contamination)2017-07-30v4No1 / 10
234amnoncommon homo sapiens, united states of america, lung2017-11-07v4No1 / 10
256amnondominant duodenum, jejunum, ileum, sus scrofa, pig, united kingdom2017-11-26v4No1 / 10
408amnoncommon united states of america, stomach, costa rica, ant, pseudomyrmex elongatus2018-11-22v4No1 / 10
497amnondominant feces, farm, gallus gallus, austria, chicken, age 4 weeks, broiler chicken2019-03-04v4No1 / 10
530amnondominant feces, farm, hunan province, adula, snake, snake farm, elaphe carinata, king ratsnake, china2019-07-21v4No1 / 10
544amnondominant united states of america, commonwealth of massachusetts, vaccinium macrocarpon, american cranberry, botanical fruit food product2019-08-04v4No1 / 10
71amnondominant research facility, small intestine, argentina, liolaemus ruibali2017-02-25v4No1 / 10
78amnondominant feces, tropical grassland biome, kenya, nanger granti, gazelle2017-03-01v4No1 / 10
152amnonhigh in blanks compares to dust/nose samples (contamination)2017-05-04v4No1 / 10
206amnonhigh freq. in air from israel particles <10um size (dominant air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 11
371amnondominant feces, homo sapiens, venezuela, amerindian, hunter gatherer2018-09-06v4No1 / 11
391amnondominant feces, hospital, infant, diarrhea, china, under-1-year-old human stage2018-11-04v4No1 / 11
406amnondominant feces, zoological garden, french republic, antidorcas marsupialis, springbok2018-11-21v4No1 / 11
418amnondominant ocean, mucus, coral, pocillopora damicornis2018-12-02v4No1 / 11
513amnondominant city, waste water, hospital, xinxiang city prefecture, china2019-03-25v4No1 / 11
558amnondominant united states of america, crop, state of wyoming, bird, centrocercus urophasianus, greater sage-grouse2019-09-20v4No1 / 11
644amnonhigher in older adults (total age range 20-80) ( high in age old age compared to young age in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v4No1 / 11
89amnondominant cloaca, commonwealth of virginia, junco hyemalis, songbird2017-03-08v4No1 / 12
161amnonhigh freq. in barn swallows in colorado (dominant feces, united states of america, state of colorado, hirundo rustica, barn swallow)2017-07-12v4No1 / 12
206amnonhigh freq. in dust storm air from israel particles <10um size (dominant air, dust, israel, size < 10um, dust storm)2017-10-04v4No1 / 12
231amnonhigh freq. in dog genitalia (dominant united states of america, reproductive system, reproductive organ, canis lupus familiaris, dog, genitalia)2017-11-02v4No1 / 12
301amnondominant united states of america, ileum, canis lupus familiaris, dog2018-03-05v4No1 / 12
381amnoncommon feces, kingdom of spain, isla de salvora, bird, age 8 days, larus michahellis, gull2018-10-22v4No1 / 12
408amnondominant united states of america, larval stage, costa rica, cephalotes, ant2018-11-22v4No1 / 12
440amnondominant feces, geospiza difficilis, galapagos islands, bird, finch, sharp-beaked ground finch2019-01-06v4No1 / 12
495amnondominant farm, caecum, gallus gallus, kingdom of spain, chicken, broiler chicken, age 3 days2019-03-03v4No1 / 12
582amnondominant united states of america, wild, external ear, santa catalina island, urocyon littoralis, urocyon littoralis catalinae, santa catalina island fox2020-01-22v4No1 / 12
595amnondominant switzerland, whole body, ixodes ricinus, castor bean tick2020-03-16v4No1 / 12
645amnondominant feces, state of idaho, bird, captive, gymnogyps californianus, california condor2020-09-03v4No1 / 12
669amnoncommon feces, homo sapiens, infant, sweden, 2-month-old human stage2020-09-26v4No1 / 12
689amnoncommon feces, homo sapiens, united states of america, hospital, adult, non c. diff diarrhea, tucson2028-03-11v4No1 / 12
766amnoncommon feces, canis lupus familiaris, french republic, dog, rectal swab, age 2 days, puppy2021-04-12v4No1 / 12
71amnondominant research facility, stomach, argentina, liolaemus ruibali2017-02-25v4No1 / 12
210amnonhigher in bangladeshi diet compared to american diet in mice with american human FMT ( high in diet bangladesh diet compared to american diet in feces research facility mus musculus mouse humanized mouse )2017-10-21v4No1 / 13
241amnonhigher in babies age <1 year compared to age 1-3 years ( high in age under-1-year-old human stage compared to age 1-3 years 2-year-old human stage 1-year-old human stage in feces homo sapiens infant )2017-11-13v4No1 / 13
243amnondominant digestive system, united states of america, beetle, anoplophora glabripennis2017-11-15v4No1 / 13
389amnondominant united states of america, farm, vagina, sus scrofa, state of michigan, pig2018-11-04v4No1 / 13
405amnondominant feces, united states of america, research facility, mus musculus, mouse, ketogenic diet, swiss webster2018-11-20v4No1 / 13
515amnondominant feces, bulgaria, balkan mountains, whole body, beetle, detritivorous beetle, onthophagus similis2019-04-18v4No1 / 13
516amnondominant homo sapiens, united states of america, urine, adult, state of ohio2019-05-29v4No1 / 13
530amnondominant feces, farm, hunan province, adula, snake, snake farm, naja atra, chinese cobra, china2019-07-21v4No1 / 13
534amnondominant river, tributary, water, fresh water, nepal, free floating, depth (water) 10cm, filtered 0.2um, koshi river2019-07-22v4No1 / 13
620amnondominant feces, homo sapiens, rural community, village, republic of congo, nouabale-ndoki national park2020-05-06v4No1 / 13
644amnondominant feces, homo sapiens, united states of america, adult, hispanic or latin american2020-08-31v4No1 / 13
669amnondominant feces, homo sapiens, infant, sweden, 2-month-old human stage2020-09-26v4No1 / 13
673amnondominant research facility, ileum, sus scrofa, male, canada, pig, age 6 weeks, male organism, salmonella enterica subsp. enterica serovar typhimurium, salmonellosis, province of alberta2020-09-28v4No1 / 13
785amnondominant research facility, ileum, sus scrofa, state of iowa, pig, age 9 weeks2021-05-16v4No1 / 13
795amnoncommon research facility, vagina, gallus gallus, chicken, adult organism, china, age 90 weeks2021-06-08v4No1 / 13
48amnondominant homo sapiens, hypopharynx, infant, kingdom of denmark2017-01-19v4No1 / 13
129amnonfound INSIDE leaves of cactus (common leaf, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, leaf interior)2017-04-15v4No1 / 14
185amnoncommon in patients with c. diff infection before treatment (common feces, homo sapiens, united states of america, state of minnesota, clostridium difficile intestinal infectious disease)2017-08-20v4No1 / 14
190amnondominant feces, homo sapiens, tanzania, hunter gatherer, hadza2017-09-04v4No1 / 14
232amnoncommon in foot ulcer of diabetic patients (common homo sapiens, skin, foot, ulcer, australia, wound, diabetes mellitus)2017-11-05v4No1 / 14
290amnon high in city compared to small village rural community in feces homo sapiens adult china 2018-02-01v4No1 / 14
302amnonhigh freq. in feces of Cockatiel pet birds (dominant feces, mexico, bird, pet, nymphicus hollandicus, cockatiel)2018-03-05v4No1 / 14
389amnondominant united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 8 hours2018-11-04v4No1 / 14
400amnonhigh freq. in karen (burma) females from thailand (dominant feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 14
404amnon high in high bmi obesity compared to lean body mass low bmi in feces homo sapiens city adult colombia 2018-11-20v4No1 / 14
406amnondominant feces, united states of america, zoological garden, giraffa camelopardalis, giraffe2018-11-21v4No1 / 14
438amnondominant feces, homo sapiens, adult, jiangsu province, age >94, china, ninth decade human stage, tenth decade human stage2018-12-30v4No1 / 14
477amnondominant feces, homo sapiens, adult, nepal, himalayas, rural community, tharu, agrarian2019-01-28v4No1 / 14
499amnondominant digestive system, pond, intestine, brazil, ranatra, water stick-insect2019-03-05v4No1 / 14
515amnondominant feces, bulgaria, balkan mountains, whole body, beetle, detritivorous beetle, onthophagus ruficapillus2019-04-18v4No1 / 14
530amnondominant feces, farm, hunan province, adula, snake, snake farm, ptyas mucosa, oriental ratsnake, china2019-07-21v4No1 / 14
622amnondominant research facility, caecum, gallus gallus, chicken, great britain, liverpool, age 42 days2020-05-08v4No1 / 14
648amnon high in antibiotic metronidazole compared to control in feces united states of america canis lupus familiaris dog state of louisiana 2020-09-06v4No1 / 14
673amnondominant control, research facility, ileum, sus scrofa, male, canada, pig, age 6 weeks, male organism, province of alberta2020-09-28v4No1 / 14
759amnondominant feces, united states of america, sus scrofa, state of alabama, wild, wild boar2021-04-04v4No1 / 14
781amnondominant feces, kenya, wild, giraffe, masai mara national park, giraffa tippelskirchi2021-04-28v4No1 / 14
42amnonhigher on stressed mice compared to control in c57bl tcr-b deficient mice ( high in stress compared to control in feces research facility mus musculus c57bl/6 japan )2016-12-10v4No1 / 15
159amnondominant hindgut, australia, siganidae, rabbitfish2017-07-06v4No1 / 15
228amnonhigh freq. in sinus brush of sinusitis patients (dominant homo sapiens, united states of america, mucosa, paranasal sinus, sinusoidal space, sinusitis)2017-10-31v4No1 / 15
339amnondominant feces, homo sapiens, infant, india, under-1-year-old human stage2018-05-24v4No1 / 15
405amnondominant feces, united states of america, research facility, mus musculus, mouse, swiss webster, control diet2018-11-20v4No1 / 15
409amnondominant homo sapiens, united states of america, left colon, biopsy site, adult, biopsy2018-11-22v4No1 / 15
425amnondominant feces, homo sapiens, child, africa, central african republic, bangui2018-12-08v4No1 / 15
425amnondominant feces, homo sapiens, child, africa, madagascar, antananarivo2018-12-08v4No1 / 15
502amnondominant feces, homo sapiens, united states of america, adult, schizophrenia2019-03-12v4No1 / 15
586amnoncommon feces, research facility, antibiotic, ampicillin, rattus norvegicus, sprague dawley, israel, rat, neomycin, male2020-02-09v4No1 / 15
651amnondominant feces, homo sapiens, control, united states of america, adult, state of alabama2020-09-13v4No1 / 15
651amnondominant feces, homo sapiens, united states of america, adult, state of alabama, parkinson's disease2020-09-13v4No1 / 15
673amnoncommon research facility, ileum, sus scrofa, male, canada, pig, age 6 weeks, male organism, salmonella enterica subsp. enterica serovar typhimurium, salmonellosis, province of alberta2020-09-28v4No1 / 15
702amnoncommon feces, united states of america, canis lupus familiaris, state of north carolina, dog2028-04-02v4No1 / 15
48amnoncommon homo sapiens, hypopharynx, infant, kingdom of denmark2017-01-19v4No1 / 15
51amnondominant feces, homo sapiens, united states of america2017-01-19v4No1 / 15
15amnondominant feces, namibia, canis mesomelas2016-11-08v4No1 / 16
19amnonhigh freq in biopsies of children (IBD study) (dominant homo sapiens, united states of america, rectum, caecum, colon, sigmoid colon, terminal ileum, biopsy, children)2016-11-14v4No1 / 16
46amnonsmj: higher in female mice feces treated with antibiotics ( high in antibiotic pulsed antibiotic treatment, macrolide tylosin tartrate compared to control in feces united states of america female research facility mus musculoides nyulmc nod/shiltj (no. 001976, jackson labs) )2017-01-12v4No1 / 16
94amnoncommon feces, homo sapiens, state of michigan, clostridium difficile intestinal infectious disease, diarrhea2017-03-12v4No1 / 16
150amnonlow in healthy dogs compared to EPI dogs recieving enzyme supplementation ( high in enzyme supplementation exocrine pancreatic insufficiency compared to control in feces united states of america canis lupus familiaris dog )2017-04-26v4No1 / 16
229amnonhigh freq. in sinuses from chronic rhinosinositis patients (dominant homo sapiens, paranasal sinus, sinusoidal space, australia, sinusitis)2017-10-31v4No1 / 16
273amnoncommon feces, homo sapiens, infant, kingdom of denmark, 1-month-old human stage2018-01-14v4No1 / 16
310amnondominant feces, homo sapiens, female, rectum, adult, poland2018-04-07v4No1 / 16
352amnondominant feces, homo sapiens, new delhi, india2018-07-30v4No1 / 16
363amnondominant dairy, rectum, caecum, colon, ovis aries, italy, obsolete_juvenile stage, age 30 days2018-08-29v4No1 / 16
365amnondominant feces, homo sapiens, child, azerbaijan, obsolete_juvenile stage2018-08-30v4No1 / 16
395amnonhigher in kids with ibd compared to healthy donors ( high in child inflammatory bowel disease crohn's disease ulcerative colitis compared to control in feces homo sapiens united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 16
407amnondominant feces, costa rica, monkey, wild, cebus capucinus, white-faced capuchin2018-11-21v4No1 / 16
440amnondominant feces, geospiza fortis, galapagos islands, bird, finch, medium ground finch2019-01-06v4No1 / 16
448amnondominant feces, farm, equus caballus, horse, equine grass sickness, disease, united kingdom2019-01-08v4No1 / 16
567amnondominant homo sapiens, nasopharynx, adult, belgium2019-12-05v4No1 / 16
582amnondominant united states of america, axilla, wild, santa catalina island, urocyon littoralis, urocyon littoralis catalinae, santa catalina island fox2020-01-22v4No1 / 16
586amnondominant feces, research facility, antibiotic, ampicillin, rattus norvegicus, sprague dawley, israel, rat, neomycin, male2020-02-09v4No1 / 16
645amnondominant cloaca, state of idaho, bird, captive, gymnogyps californianus, california condor2020-09-03v4No1 / 16
659amnondominant feces, homo sapiens, ulcerative colitis, child, acute severe colitis2020-09-19v4No1 / 16
683amnondominant during antibiotics treatment in feces (dominant feces, homo sapiens, united states of america, antibiotic, vancomycin, adult, state of california, metronidazole, neomycin)2028-03-04v4No1 / 16
49amnondominant feces, giraffa camelopardalis2017-01-19v4No1 / 16
159amnondominant midgut, australia, siganidae, rabbitfish2017-07-06v4No1 / 17
215amnonhigher in people with Roux-en-Y gastric bypass compared to controls ( high in gastric bypass compared to control in feces homo sapiens united states of america )2017-10-23v4No1 / 17
227amnonhigh freq. in baby nasopharynx age <= 1 day (dominant homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, age <= 24 hours, 1-month-old human stage)2017-10-30v4No1 / 17
237amnondominant uropygial gland, canada, bon portage island, bird, oceanodroma leucorhoa, seabird2017-11-07v4No1 / 17
337amnonhigh freq. in feces of house mice from new york city (dominant united states of america, city, mus musculus, new york city, mouse, house mice)2018-05-18v4No1 / 17
352amnonhigh freq. in duodenal biopsies (dominant homo sapiens, small intestine, duodenum, new delhi, india)2018-07-30v4No1 / 17
365amnondominant feces, homo sapiens, child, nigeria, obsolete_juvenile stage2018-08-30v4No1 / 17
368amnondominant feces, homo sapiens, united states of america, adult, commonwealth of virginia, systemic lupus erythematosus2018-09-03v4No1 / 17
381amnondominant feces, kingdom of spain, isla de salvora, bird, age 8 days, larus michahellis, gull2018-10-22v4No1 / 17
389amnondominant united states of america, farm, nipple, skin, adult, sus scrofa, state of michigan, pig2018-11-04v4No1 / 17
406amnondominant feces, zoological garden, south africa, aardvark, orycteropus afer2018-11-21v4No1 / 17
428amnondominant feces, homo sapiens, adult, nanchang city prefecture, acute pancreatitis, pancreatitis, china2018-12-09v4No1 / 17
591amnondominant feces, homo sapiens, control, united states of america, adult, human late adulthood stage2020-02-17v4No1 / 17
607amnondominant feces, homo sapiens, control, germany2020-04-19v4No1 / 17
661amnondominant farm, lung, china, maojian district, andrias davidianus, chinese giant salamander, age 3 years2020-09-20v4No1 / 17
674amnondominant female, body proper, whole body, panama, culex coronator, mosquito2020-09-28v4No1 / 17
674amnondominant female, body proper, whole body, panama, coquillettidia, mosquito, coquilettidia venezuelensis2020-09-28v4No1 / 17
759amnondominant feces, united states of america, rattus norvegicus, state of new york, new york city, rat, wild2021-04-06v4No1 / 17
36amnondominant feces, homo sapiens, sichuan province2016-12-06v4No1 / 18
207amnonhigh freq. in people hospitalized with diarrhea (dominant feces, homo sapiens, israel, diarrhea)2017-10-05v4No1 / 18
215amnondominant feces, homo sapiens, united states of america2017-10-23v4No1 / 18
273amnondominant feces, homo sapiens, infant, kingdom of denmark, 1-month-old human stage2018-01-14v4No1 / 18
284amnondominant feces, homo sapiens, female, infant, state of california, 6-month-old human stage2018-01-27v4No1 / 18
339amnondominant feces, homo sapiens, adult, india2018-05-24v4No1 / 18
387amnonhigh freq. in feces of wild brown bear (dominant feces, sweden, wild, ursus arctos, brown bear)2018-11-03v4No1 / 18
440amnondominant feces, galapagos islands, bird, finch, geospiza fuliginosa, small ground finch2019-01-06v4No1 / 18
477amnondominant feces, homo sapiens, adult, nepal, himalayas, forager, rural community, chepang2019-01-28v4No1 / 18
488amnondominant feces, canis lupus familiaris, italy, dog, lymphoma2019-02-25v4No1 / 18
563amnondominant feces, homo sapiens, control, united states of america, homosexual, msm, male, rectal swab2019-11-18v4No1 / 18
567amnon high in chronic rhinosinusitis sinusitis compared to control in homo sapiens nasopharynx adult belgium 2019-12-05v4No1 / 18
582amnondominant united states of america, wild, lip, labial commissure, santa catalina island, urocyon littoralis, urocyon littoralis catalinae, santa catalina island fox2020-01-22v4No1 / 18
607amnondominant feces, homo sapiens, germany, parkinson's disease2020-04-19v4No1 / 18
607amnondominant homo sapiens, nasopharynx, germany, rem sleep behavior disorder, nasal wash2020-04-19v4No1 / 18
636amnon high in tracheal aspirate trachea endotracheal aspirate compared to oropharynx oropharyngeal swab in homo sapiens united states of america hospital adult commonwealth of pennsylvania acute respiratory failure respiratory failure 2020-08-08v4No1 / 18
650amnondominant feces, homo sapiens, united states of america, adult, state of new york, asian2020-09-09v4No1 / 18
663amnondominant feces, homo sapiens, obesity, adult, obese body mass index status, poland2020-09-22v4No1 / 18
795amnondominant research facility, cloaca, gallus gallus, chicken, adult organism, china, age 90 weeks2021-06-08v4No1 / 18
121amnondominant feces, homo sapiens, adult, bangladesh2017-04-13v4No1 / 19
276amnondominant feces, homo sapiens, adult, peru, small village, tunapuco, rural community2018-01-22v4No1 / 19
292amnondominant feces, homo sapiens, control, adult, china2018-02-05v4No1 / 19
301amnondominant united states of america, colon, canis lupus familiaris, dog2018-03-05v4No1 / 19
330amnon high in infant age 1 year compared to adult fourth decade human stage in feces homo sapiens kingdom of norway oslo 2018-05-13v4No1 / 19
339amnoncommon feces, homo sapiens, infant, india, under-1-year-old human stage2018-05-24v4No1 / 19
404amnondominant feces, homo sapiens, city, adult, colombia2018-11-20v4No1 / 19
438amnondominant feces, homo sapiens, china, young adult stage2018-12-30v4No1 / 19
438amnondominant feces, homo sapiens, adult, jiangsu province, china, 65-79 year-old human stage2018-12-30v4No1 / 19
449amnondominant feces, homo sapiens, colombia2019-01-09v4No1 / 19
455amnondominant feces, homo sapiens, adult, canada, atherosclerosis2019-01-10v4No1 / 19
477amnondominant feces, homo sapiens, nepal, himalayas, rural community, raute2019-01-29v4No1 / 19
482amnondominant feces, homo sapiens, child, colombia, medellin metropolitan area, daycare, 1-5-years-old human2019-02-12v4No1 / 19
489amnondominant feces, french republic, anal swab, myotis myotis, bat, greater mouse eared bat2019-02-25v4No1 / 19
495amnondominant farm, caecum, gallus gallus, kingdom of spain, chicken, age 4 weeks, broiler chicken2019-03-03v4No1 / 19
516amnondominant feces, homo sapiens, united states of america, adult, state of ohio2019-05-29v4No1 / 19
558amnondominant united states of america, colon, state of wyoming, bird, centrocercus urophasianus, greater sage-grouse2019-09-20v4No1 / 19
567amnondominant homo sapiens, adult, belgium, maxillary sinus, ethmoid sinus2019-12-05v4No1 / 19
573amnondominant feces, united states of america, juvenile stage, canis lupus familiaris, commonwealth of pennsylvania, dog2019-12-22v4No1 / 19
582amnondominant united states of america, pair of nares, wild, external naris, santa catalina island, urocyon littoralis, urocyon littoralis catalinae, santa catalina island fox2020-01-22v4No1 / 19
582amnondominant united states of america, rectum, wild, perianal skin, santa catalina island, urocyon littoralis, urocyon littoralis catalinae, santa catalina island fox2020-01-22v4No1 / 19
689amnoncommon feces, homo sapiens, united states of america, hospital, clostridium difficile colitis, adult, clostridium difficile infection, tucson2028-03-11v4No1 / 19
706amnondominant feces, united states of america, canis lupus familiaris, state of north carolina, dog2028-04-10v4No1 / 19
795amnoncommon research facility, cloaca, gallus gallus, chicken, adult organism, china, age 90 weeks2021-06-08v4No1 / 19
803amnondominant feces, homo sapiens, united states of america, adult, commonwealth of massachusetts, type 2 diabetes mellitus, caribbean latino, human late adulthood stage2021-06-18v4No1 / 19
59amnoncommon digestive system, geniotrigona thoracica2017-02-03v4No1 / 19
60amnondominant feces, anser cygnoides, china2017-02-03v4No1 / 19
45amnonhigh freq. in feces babies <2 years in india (dominant feces, homo sapiens, infant, india)2016-12-19v4No1 / 20
197amnondominant feces, homo sapiens, juvenile organism, finland, obsolete_juvenile stage, 13-year-old human stage2017-09-12v4No1 / 20
227amnoncommon in baby nasopharynx age <= 1 day (common homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, age <= 24 hours, 1-month-old human stage)2017-10-30v4No1 / 20
238amnondominant feces, homo sapiens, colombia2017-11-07v4No1 / 20
271amnoncommon root structure, glycine max, soybean, root, root nodule, china, depth (soil) 0-20cm2018-01-09v4No1 / 20
273amnoncommon feces, homo sapiens, infant, kingdom of denmark, age one week, 1-month-old human stage2018-01-14v4No1 / 20
273amnondominant feces, homo sapiens, infant, kingdom of denmark, age one week, 1-month-old human stage2018-01-14v4No1 / 20
273amnondominant feces, homo sapiens, infant, kingdom of denmark, 1-year-old human stage2018-01-14v4No1 / 20
284amnoncommon feces, homo sapiens, female, infant, state of california, age 2 months2018-01-27v4No1 / 20
284amnondominant feces, homo sapiens, female, infant, state of california, age 2 months2018-01-27v4No1 / 20
286amnonhigh freq. in feces of individuals with kidney stones (dominant feces, homo sapiens, adult, nanning city prefecture, nephrolithiasis, china, sixth decade human stage)2018-01-27v4No1 / 20
292amnondominant feces, homo sapiens, adult, ulcerative colitis, china2018-02-05v4No1 / 20
292amnondominant feces, homo sapiens, adult, crohn's disease, china2018-02-05v4No1 / 20
390amnondominant feces, homo sapiens, hospital, salmonella gastroenteritis, australia, diarrhea2018-11-04v4No1 / 20
390amnondominant feces, homo sapiens, hospital, australia, diarrhea2018-11-04v4No1 / 20
394amnondominant feces, homo sapiens, united states of america, adult, state of california, ulcerative colitis2018-11-06v4No1 / 20
399amnoncommon feces, united states of america, mustela putorius furo, ferret2018-11-16v4No1 / 20
409amnondominant homo sapiens, united states of america, right colon, biopsy site, adult, biopsy2018-11-22v4No1 / 20
477amnondominant feces, homo sapiens, raji, nepal, himalayas, rural community2019-01-29v4No1 / 20
495amnondominant farm, caecum, gallus gallus, kingdom of spain, chicken, free range chicken, age 4 days2019-03-03v4No1 / 20
535amnonhigh freq. in adult vaginal samples with ICC (dominant homo sapiens, united states of america, female, vagina, cervical carcinoma, adult, state of arizona, phoenix, invasive carcinoma, invasive cervical carcinoma)2019-07-25v4No1 / 20
563amnondominant feces, homo sapiens, united states of america, hiv infection, homosexual, msm, male, rectal swab2019-11-18v4No1 / 20
629amnondominant feces, homo sapiens, adult, kingdom of the netherlands, amsterdam, homosexual, msm2020-05-31v4No1 / 20
629amnondominant feces, homo sapiens, adult, kingdom of the netherlands, amsterdam, heterosexual, msw2020-05-31v4No1 / 20
766amnondominant feces, canis lupus familiaris, french republic, dog, rectal swab, age 2 days, puppy2021-04-12v4No1 / 20
803amnondominant feces, homo sapiens, control, united states of america, adult, commonwealth of massachusetts, caribbean latino, human late adulthood stage2021-06-18v4No1 / 20
59amnoncommon digestive system, sundatrigona moorei2017-02-03v4No1 / 20
333amnonhigh freq. in healthy controls feces (dominant feces, homo sapiens, control, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 20
15amnondominant feces, acinonyx jubatus, namibia2016-11-08v4No1 / 21
24amnonappears on transition to cow milk ( high in mammalian milk beverage compared to breast milk in feces homo sapiens infant )2016-12-01v4No1 / 21
108amnondominant united states of america, research facility, caecum, mus musculus, state of texas, mouse2017-04-07v4No1 / 21
108amnondominant united states of america, research facility, caecum, state of texas, quail, coturnix coturnix2017-04-07v4No1 / 21
122amnondominant feces, homo sapiens, united kingdom2017-04-13v4No1 / 21
240amnonhigh freq. in infants age <3 years (dominant feces, homo sapiens, infant, finland, age < 3 years)2017-11-12v4No1 / 21
241amnonhigh freq. in babies age < 3 years in finland (dominant feces, homo sapiens, infant, finland, age < 3 years)2017-11-13v4No1 / 21
249amnondominant feces, homo sapiens, united states of america2017-11-22v4No1 / 21
320amnondominant feces, homo sapiens, adult, crohn's disease2018-04-19v4No1 / 21
350amnonhigh freq. in feces of white faced capuchin from costa rica rain forest (dominant feces, costa rica, monkey, cebus capucinus, white-faced capuchin, woodland area)2018-07-30v4No1 / 21
390amnondominant feces, homo sapiens, hospital, australia, clostridium difficile intestinal infectious disease, diarrhea2018-11-04v4No1 / 21
429amnondominant feces, research facility, rattus norvegicus, dahl salt-sensitive, israel, rat, salt, salt rich diet2018-12-13v4No1 / 21
497amnoncommon feces, farm, gallus gallus, austria, chicken, age 4 weeks, broiler chicken2019-03-04v4No1 / 21
591amnondominant feces, homo sapiens, united states of america, adult, parkinson's disease, human late adulthood stage2020-02-17v4No1 / 21
642amnon high in gastrointestinal system alimentary part of gastrointestinal system compared to feces digesta in pacific ocean san diego fish scomber japonicus chub mackerel 2020-08-28v4No1 / 21
779amnondominant feces, homo sapiens, adult, guangzhou city prefecture, crohn's disease, china2021-04-28v4No1 / 21
794amnondominant feces, homo sapiens, hiv infection, adult, kingdom of spain, human immunodeficiency virus infectious disease, municipality of logrono, antiretroviral therapy2021-06-08v4No1 / 21
814amnondominant feces, homo sapiens, female, obesity, adult, obese body mass index status, germany, high bmi, overweight body mass index status, age 50-70 years2021-06-30v4No1 / 21
47amnonsmj: higher in bullied, non-immunized mouse ( high in stress: chronic subordinate colony housing compared to no stress: single housed control in feces united states of america research facility mus musculus male no immunization: vehicle as control c57bc/6ncrl )2017-01-13v4No1 / 21
58amnoncommon homo sapiens, skin of face, new york city, skin under eyes2017-02-02v4No1 / 21
72amnondominant feces, united states of america, canis lupus familiaris, iowa2017-02-25v4No1 / 21
94amnondominant feces, homo sapiens, state of michigan, clostridium difficile intestinal infectious disease, diarrhea2017-03-12v4No1 / 22
185amnonhigh freq. in patients with c. diff infection before treatment (dominant feces, homo sapiens, united states of america, state of minnesota, clostridium difficile intestinal infectious disease)2017-08-20v4No1 / 22
284amnondominant feces, homo sapiens, female, adult, state of california2018-01-27v4No1 / 22
297amnondominant feces, homo sapiens, united states of america, child, atlanta, obsolete_juvenile stage, age<17 years, immature stage, adolescent stage2018-02-12v4No1 / 22
389amnoncommon united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 8 hours2018-11-04v4No1 / 22
395amnondominant feces, homo sapiens, united states of america, child, commonwealth of pennsylvania, inflammatory bowel disease, crohn's disease, ulcerative colitis2018-11-14v4No1 / 22
399amnoncommon feces, united states of america, state of tennessee, zoological garden, ailurus fulgens, red panda2018-11-16v4No1 / 22
502amnondominant feces, homo sapiens, control, united states of america, adult2019-03-12v4No1 / 22
509amnondominant feces, homo sapiens, control, child, nigeria, kebbi state, rural community, 10-15-years-old human2019-03-18v4No1 / 22
670amnon high in adult adult organism compared to larval stage in croatia opatija anisakis pegreffii dolphin parasite 2020-09-26v4No1 / 22
674amnondominant female, body proper, panama, whole body, lutzomyia gomezi, sand fly2020-09-28v4No1 / 22
674amnondominant female, body proper, whole body, panama, psychodopygus panamensis, sand fly2020-09-28v4No1 / 22
689amnondominant feces, homo sapiens, united states of america, hospital, clostridium difficile colitis, adult, clostridium difficile infection, tucson2028-03-11v4No1 / 22
759amnondominant feces, united states of america, canis lupus familiaris, state of minnesota, dog, domestic2021-04-04v4No1 / 22
779amnoncommon feces, homo sapiens, adult, guangzhou city prefecture, crohn's disease, china2021-04-28v4No1 / 22
779amnondominant feces, homo sapiens, control, adult, guangzhou city prefecture, china2021-04-28v4No1 / 22
795amnondominant research facility, gallus gallus, chicken, uterine tube infundibulum, adult organism, china, age 90 weeks2021-06-08v4No1 / 22
69amnondominant feces, united states of america, research facility, canis lupus familiaris, beagle dog2017-02-21v4No1 / 22
333amnonhigh freq. in stroke patient feces (dominant feces, homo sapiens, stroke, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 22
197amnondominant feces, homo sapiens, juvenile organism, obsolete_juvenile stage, india, 13-year-old human stage2017-09-12v4No1 / 23
241amnonhigh freq. in babies age < 3 years in russia (dominant feces, homo sapiens, infant, russia, age < 3 years)2017-11-13v4No1 / 23
241amnoncommon in babies age < 3 years in finland (common feces, homo sapiens, infant, finland, age < 3 years)2017-11-13v4No1 / 23
241amnonhigh freq. in babies age < 3 years in estonia (dominant feces, homo sapiens, infant, estonia, age < 3 years)2017-11-13v4No1 / 23
284amnondominant feces, homo sapiens, female, infant, state of california, 12-month-old human stage2018-01-27v4No1 / 23
312amnondominant feces, homo sapiens, adult, french republic, spondyloarthritis, spondylitis2018-04-09v4No1 / 23
394amnondominant feces, homo sapiens, control, united states of america, adult, state of california2018-11-06v4No1 / 23
399amnondominant feces, united states of america, state of tennessee, zoological garden, panthera leo, lion2018-11-16v4No1 / 23
509amnondominant feces, homo sapiens, child, nigeria, kebbi state, rural community, schistosomiasis, urinary schistosomiasis, 10-15-years-old human2019-03-18v4No1 / 23
542amnon high in child age 1-7 years compared to adult age 12-23 years in research facility dentition macaca mulatta puerto rico subgingival plaque monkey 2019-08-01v4No1 / 23
601amnondominant feces, homo sapiens, adult, type 2 diabetes mellitus, china2020-03-30v4No1 / 23
636amnondominant homo sapiens, united states of america, hospital, adult, commonwealth of pennsylvania, tracheal aspirate, acute respiratory failure, respiratory failure, trachea, endotracheal aspirate2020-08-08v4No1 / 23
702amnondominant feces, united states of america, canis lupus familiaris, state of north carolina, dog2028-04-02v4No1 / 23
779amnondominant feces, homo sapiens, ulcerative colitis, adult, guangzhou city prefecture, china2021-04-28v4No1 / 23
795amnondominant research facility, vagina, gallus gallus, chicken, adult organism, china, age 90 weeks2021-06-08v4No1 / 23
830amnondominant feces, homo sapiens, peru, age 9-17 years, teenager2021-09-10v4No1 / 23
53amnondominant feces, homo sapiens, city, el salvador, small village2017-01-21v4No1 / 23
58amnoncommon homo sapiens, new york city, contact lens2017-02-02v4No1 / 23
239amnondominant feces, homo sapiens, united states of america2017-11-08v4No1 / 24
241amnoncommon in babies age < 3 years in estonia (common feces, homo sapiens, infant, estonia, age < 3 years)2017-11-13v4No1 / 24
330amnondominant feces, homo sapiens, infant, kingdom of norway, oslo, age 1 year2018-05-13v4No1 / 24
365amnondominant feces, homo sapiens, child, sudan, obsolete_juvenile stage2018-08-30v4No1 / 24
489amnoncommon feces, french republic, anal swab, myotis myotis, bat, greater mouse eared bat2019-02-25v4No1 / 24
566amnondominant feces, homo sapiens, adult, china2019-11-24v4No1 / 24
580amnondominant feces, homo sapiens, female, pregnancy, adult, israel, first trimester2020-01-14v4No1 / 24
670amnoncommon adult, adult organism, croatia, opatija, anisakis pegreffii, dolphin parasite2020-09-26v4No1 / 24
702amnondominant feces, united states of america, felis catus, state of north carolina, cat2028-04-02v4No1 / 24
35amnoncommon homo sapiens, hospital, dense settlement biome, breast milk, tanzania2016-12-06v4No1 / 25
108amnondominant united states of america, research facility, colon, mus musculus, state of texas, mouse2017-04-07v4No1 / 25
159amnon high in midgut compared to hindgut in australia siganidae rabbitfish 2017-07-06v4No1 / 25
284amnoncommon feces, homo sapiens, female, infant, state of california, 6-month-old human stage2018-01-27v4No1 / 25
290amnondominant feces, homo sapiens, city, adult, china2018-02-01v4No1 / 25
379amnondominant feces, gallus gallus, chicken, age 15 - 35 days, united kingdom2018-09-14v4No1 / 25
395amnoncommon feces, homo sapiens, united states of america, child, commonwealth of pennsylvania, inflammatory bowel disease, crohn's disease, ulcerative colitis2018-11-14v4No1 / 25
428amnoncommon feces, homo sapiens, adult, nanchang city prefecture, acute pancreatitis, pancreatitis, china2018-12-09v4No1 / 25
544amnoncommon united states of america, commonwealth of massachusetts, flower, vaccinium macrocarpon, american cranberry2019-08-04v4No1 / 25
673amnoncommon control, research facility, ileum, sus scrofa, male, canada, pig, age 6 weeks, male organism, province of alberta2020-09-28v4No1 / 25
683amnoncommon during antibiotics treatment in feces (common feces, homo sapiens, united states of america, antibiotic, vancomycin, adult, state of california, metronidazole, neomycin)2028-03-04v4No1 / 25
779amnoncommon feces, homo sapiens, ulcerative colitis, adult, guangzhou city prefecture, china2021-04-28v4No1 / 25
53amnondominant feces, homo sapiens, city, lima, shantytown2017-01-21v4No1 / 25
301amnondominant united states of america, rectum, canis lupus familiaris, dog2018-03-05v4No1 / 26
354amnoncommon homo sapiens, united states of america, nasal cavity, pair of nares, adult, nasal brush2018-07-30v4No1 / 26
438amnondominant feces, homo sapiens, adult, jiangsu province, china, fourth decade human stage, fifth decade human stage2018-12-30v4No1 / 26
674amnoncommon female, body proper, whole body, panama, coquillettidia, mosquito, coquilettidia venezuelensis2020-09-28v4No1 / 26
689amnondominant feces, homo sapiens, united states of america, hospital, adult, non c. diff diarrhea, tucson2028-03-11v4No1 / 26
766amnondominant feces, canis lupus familiaris, french republic, dog, age 8 weeks, rectal swab, puppy2021-04-12v4No1 / 26
785amnoncommon research facility, ileum, sus scrofa, state of iowa, pig, age 9 weeks2021-05-16v4No1 / 26
131amnondominant feces, homo sapiens, south korea2017-04-16v4No1 / 27
228amnoncommon in sinus brush of sinusitis patients (common homo sapiens, united states of america, mucosa, paranasal sinus, sinusoidal space, sinusitis)2017-10-31v4No1 / 27
387amnoncommon in feces of wild brown bear (common feces, sweden, wild, ursus arctos, brown bear)2018-11-03v4No1 / 27
399amnon high in crohn's disease compared to control in feces homo sapiens united states of america 2018-11-16v4No1 / 27
404amnon high in hard stool compared to normal stool in feces homo sapiens city adult columbia 2018-11-20v4No1 / 27
438amnondominant feces, homo sapiens, child, jiangsu province, age 8-12, china, 6-12 year-old child stage2018-12-30v4No1 / 27
495amnondominant farm, caecum, gallus gallus, kingdom of spain, chicken, age 3 weeks, free range chicken2019-03-03v4No1 / 27
540amnondominant feces, united states of america, canis lupus familiaris, state of arizona, flagstaff, dog2019-07-31v4No1 / 27
601amnondominant feces, homo sapiens, control, adult, china2020-03-30v4No1 / 27
659amnoncommon feces, homo sapiens, ulcerative colitis, child, acute severe colitis2020-09-19v4No1 / 27
674amnoncommon female, body proper, panama, whole body, lutzomyia gomezi, sand fly2020-09-28v4No1 / 27
674amnoncommon female, body proper, whole body, panama, nyssomyia trapidoi, sand fly2020-09-28v4No1 / 27
695amnondominant feces, homo sapiens, child, israel, food allergy, milk allergy, age 4-10 years2028-03-27v4No1 / 27
838amnondominant united states of america, research facility, caecum, state of ohio, meleagris gallopavo, wild turkey2021-10-13v4No1 / 27
127amnondominant united states of america, caecum, gallus gallus, chicken, age 14-28 days2017-04-14v4No1 / 28
365amnondominant feces, homo sapiens, child, jordan, obsolete_juvenile stage2018-08-30v4No1 / 28
495amnondominant farm, caecum, gallus gallus, kingdom of spain, chicken, broiler chicken, age 2 weeks2019-03-03v4No1 / 28
540amnoncommon feces, united states of america, canis lupus familiaris, state of arizona, flagstaff, dog2019-07-31v4No1 / 28
710amnonsuspected contaminant (common in blanks) (contamination)2028-05-20v4No1 / 28
766amnoncommon feces, canis lupus familiaris, french republic, dog, age 8 weeks, rectal swab, puppy2021-04-12v4No1 / 28
822amnondominant feces, research facility, canis lupus familiaris, australia, city of melbourne, dog, high protein diet, foxhound, meat diet2021-08-29v4No1 / 28
26amnoncommon in combined swab of inguinal region and axilla (common homo sapiens, united states of america, sebum, axilla, inguinal region)2016-12-05v4No1 / 29
165amnoncommon in house fly larva grown on moist wheat bran (common digestive system, research facility, larval stage, musca domestica, house fly, china)2017-07-16v4No1 / 29
438amnondominant feces, homo sapiens, jiangsu province, age 13-14, china, 13-year-old human stage, 14-year-old human stage2018-12-30v4No1 / 29
622amnon high in ileum compared to caecum in research facility gallus gallus chicken great britain liverpool age 42 days 2020-05-08v4No1 / 29
822amnondominant feces, research facility, canis lupus familiaris, australia, city of melbourne, dog, foxhound, hydrolized diet2021-08-29v4No1 / 29
822amnondominant feces, research facility, canis lupus familiaris, australia, city of melbourne, high fiber, dog, foxhound2021-08-29v4No1 / 29
36amnonhigher in centernarians ( high in centererians compared to adult in feces homo sapiens sichuan province )2016-12-06v4No1 / 30
211amnon high in female compared to male in feces united states of america research facility mus musculus diet high fat diet mouse 2017-10-22v4No1 / 30
284amnoncommon feces, homo sapiens, female, infant, state of california, 12-month-old human stage2018-01-27v4No1 / 30
320amnoncommon feces, homo sapiens, adult, crohn's disease2018-04-19v4No1 / 30
438amnondominant feces, homo sapiens, child, jiangsu province, age 3-6, china, 2-5 year-old child stage2018-12-30v4No1 / 30
573amnoncommon feces, united states of america, juvenile stage, canis lupus familiaris, commonwealth of pennsylvania, dog2019-12-22v4No1 / 30
582amnoncommon united states of america, external acoustic meatus, ear canal, wild, santa catalina island, urocyon littoralis, urocyon littoralis catalinae, santa catalina island fox2020-01-22v4No1 / 30
695amnondominant feces, homo sapiens, child, israel, food allergy, age 4-10 years, sesame allergy2028-03-27v4No1 / 30
45amnoncommon in feces babies age 0-2 in india (common feces, homo sapiens, infant, india)2016-12-19v4No1 / 31
108amnonincreases during fasting in mouse colon ( high in fasting late timepoints compared to early timepoints in united states of america research facility colon mus musculus state of texas mouse )2017-04-07v4No1 / 31
189amnonhigherin stems of grape vines with pierce disease compared to control ( high in xylella fastidiosa temecula1 pierce disease compared to control in united states of america stem vitis vinifera state of california grape endosphere )2017-08-30v4No1 / 31
262amnoncommon research facility, larval stage, body proper, ixodes scapularis, tick2017-12-10v4No1 / 31
390amnoncommon feces, homo sapiens, hospital, australia, clostridium difficile intestinal infectious disease, diarrhea2018-11-04v4No1 / 31
544amnoncommon united states of america, commonwealth of massachusetts, vaccinium macrocarpon, american cranberry, botanical fruit food product2019-08-04v4No1 / 31
673amnon high in ileum compared to caecum ascending colon in control research facility sus scrofa male canada pig age 6 weeks male organism province of alberta 2020-09-28v4No1 / 31
674amnoncommon female, body proper, whole body, panama, culex coronator, mosquito2020-09-28v4No1 / 31
165amnoncommon in moist wheat bran (common research facility, wheat bran, china)2017-07-16v4No1 / 32
292amnon high in crohn's disease ulcerative colitis compared to control in feces homo sapiens adult china 2018-02-05v4No1 / 32
411amnonhigher in wild baboons feeding on discarded human foods ( high in human contact compared to low human contact in feces zambia monkey wild papio kindae kinda baboon )2018-11-23v4No1 / 33
669amnon high in 14-days-old human compared to 12-month-old human stage in feces homo sapiens infant sweden 2020-09-26v4No1 / 33
19amnonhigher in CD compared to control in biopsies ( high in crohn's disease compared to control in homo sapiens united states of america rectum caecum colon sigmoid colon terminal ileum biopsy children )2016-11-14v4No1 / 34
269amnondecreases during one month in refrigeration of yao meat ( high in early timepoint fresh compared to late timpoint food spoilage in foodon product type china )2018-01-09v4No1 / 34
407amnoncommon feces, costa rica, monkey, wild, cebus capucinus, white-faced capuchin2018-11-21v4No1 / 34
674amnoncommon female, body proper, panama, whole body, psychodopygus panamensis, sand fly2020-09-28v4No1 / 34
108amnoncommon united states of america, research facility, colon, state of texas, quail, coturnix coturnix2017-04-07v4No1 / 35
240amnonhigher in infants age<1 year compared to 1-3 years in baby feces ( high in age under-1-year-old human stage compared to 1-year-old human stage in feces homo sapiens infant finland )2017-11-12v4No1 / 35
262amnonhigher in tick larvae fed on PIXR immunized mice compared to non immunized ( high in pixr immunized compared to control in research facility larval stage body proper ixodes scapularis tick )2017-12-10v4No1 / 35
287amnoncommon mountain, snow field, depth 1-2m, japan2018-01-29v4No1 / 35
350amnoncommon in feces of white faced capuchin from costa rica rain forest (common feces, costa rica, monkey, cebus capucinus, white-faced capuchin, woodland area)2018-07-30v4No1 / 35
669amnoncommon feces, homo sapiens, infant, sweden, 12-month-old human stage2020-09-26v4No1 / 35
48amnonlower in 3 months compared to 1 week in infant hypopharynx ( high in age age 1 week 1-month-old human stage compared to 3-month-old human stage in homo sapiens hypopharynx infant kingdom of denmark )2017-01-19v4No1 / 35
219amnonhigher in pre-weaning compared to post-weaning in mouse feces ( high in breast milk age age 21 days compared to mouse chow age 28 days in feces research facility mus musculus c57bl/6 male mouse south korea )2017-10-24v4No1 / 36
240amnoncommon in infants age <3 years (common feces, homo sapiens, infant, finland, age < 3 years)2017-11-12v4No1 / 36
674amnoncommon female, body proper, whole body, panama, culex declarator, mosquito2020-09-28v4No1 / 36
232amnoncommon in foot of diabetic patients (common homo sapiens, skin, foot, australia, diabetes mellitus)2017-11-05v4No1 / 37
345amnoncommon homo sapiens, nasal cavity, nasal cavity mucosa, adult, austria, graz city district2018-06-11v4No1 / 37
706amnoncommon feces, united states of america, canis lupus familiaris, state of north carolina, dog2028-04-10v4No1 / 37
50amnoncommon in mitten crab gills (common gill, eriocheir sinensis, china)2017-01-19v4No1 / 37
723amnon high in infant age 0-6 months compared to 2-5 year-old child stage in feces homo sapiens child indonesia municipality of yogyakarta 2021-01-02v3No1 / 37
243amnoncommon digestive system, united states of america, beetle, anoplophora glabripennis2017-11-15v4No1 / 38
390amnoncommon feces, homo sapiens, hospital, australia, diarrhea2018-11-04v4No1 / 38
409amnonhigher in colon biopsies compared to stool and luminal content ( high in biopsy site biopsy compared to feces luminal content in homo sapiens united states of america )2018-11-22v4No1 / 38
503amnonincreases following malaria infection ( high in late time points experimental cerebral malaria malaria compared to control early time points in feces research facility mus musculus c57bl/6 mouse japan )2019-03-12v4No1 / 38
102amnonlower in saliva compared to teeth, cheek ( high in cheek dentition compared to saliva in homo sapiens united states of america atlanta mouth )2017-04-03v4No1 / 39
330amnoncommon feces, homo sapiens, infant, kingdom of norway, oslo, age 1 year2018-05-13v4No1 / 39
360amnoncommon desert, leaf, mexico, guanajuato, agave, leaf endosphere, agave salmiana2018-08-21v4No1 / 39
497amnoncommon feces, farm, gallus gallus, austria, chicken, broiler chicken, age 2 weeks2019-03-04v4No1 / 39
19amnoncommon in biopsies of children (IBD study) (common homo sapiens, united states of america, rectum, caecum, colon, sigmoid colon, terminal ileum, biopsy, children)2016-11-14v4No1 / 40
119amnonhigher in late timepoints (>4weeks) of worm infected mice ( high in parasitic helminthiasis infectious disease late timepoints trichuris muris compared to control in feces research facility mus musculus sweden mouse )2017-04-12v4No1 / 40
212amnonlower in obese mice fed quinoa diet compared to ain-93g rodent diet ( high in diet ain-93g rodent diet compared to quinoa food product in feces united states of america research facility mus musculus obese body mass index status mouse db/db mouse obesity )2017-10-22v4No1 / 40
79amnoncommon united states of america, skin, stenella attenuata2017-03-03v4No1 / 40
102amnonhigher in cheeks compared to teeth, saliva ( high in cheek compared to saliva dentition in homo sapiens united states of america atlanta mouth )2017-04-03v4No1 / 41
117amnoncommon united states of america, research facility, larval stage, intestine, danio rerio, zebra fish2017-04-10v4No1 / 41
352amnoncommon feces, homo sapiens, new delhi, india2018-07-30v4No1 / 41
389amnoncommon united states of america, farm, tonsil, adult, sus scrofa, state of michigan, pig2018-11-04v4No1 / 41
400amnonhigher in children of hmong migrands born in the usa compared to non-migrant usa people ( high in hmong hmong 2nd generation compared to united states of america in feces homo sapiens )2018-11-18v4No1 / 41
401amnonlower in endospore enriched (lysis resistant) replicates ( high in control compared to endospore enriched fraction lysis in feces homo sapiens united states of america adult )2018-11-18v4No1 / 41
542amnoncommon research facility, dentition, macaca mulatta, child, puerto rico, subgingival plaque, monkey, age 1-7 years2019-08-01v4No1 / 41
51amnoncommon feces, homo sapiens, united states of america2017-01-19v4No1 / 41
14amnon high in stomach duodenum jejunum ileum compared to feces caecum transverse colon left colon right colon in united states of america gastrointestinal system mus musculus 2016-11-08v4No1 / 42
95amnoncommon in root canal (common homo sapiens, tooth, brazil, root canal)2017-03-12v4No1 / 42
595amnoncommon switzerland, whole body, ixodes ricinus, castor bean tick2020-03-16v4No1 / 42
60amnoncommon feces, anser cygnoides, china2017-02-03v4No1 / 42
79amnoncommon united states of america, skin, globicephala macrorhynchus, short finned pilot whale2017-03-03v4No1 / 42
89amnoncommon uropygial gland, commonwealth of virginia, junco hyemalis, songbird2017-03-08v4No1 / 43
189amnoncommon united states of america, stem, vitis vinifera, state of california, grape, endosphere2017-08-30v4No1 / 43
389amnoncommon united states of america, farm, vagina, sus scrofa, state of michigan, pig2018-11-04v4No1 / 43
406amnoncommon feces, acinonyx jubatus, south africa, cheetah2018-11-21v4No1 / 43
36amnoncommon feces, homo sapiens, sichuan province2016-12-06v4No1 / 44
241amnoncommon in babies age < 3 years in russia (common feces, homo sapiens, infant, russia, age < 3 years)2017-11-13v4No1 / 44
268amnoncommon digestive system, gadus morhua, kingdom of norway, fish, atlantic cod2017-12-24v4No1 / 44
302amnoncommon in feces of parakeet pet birds (common feces, melopsittacus undulatus, mexico, bird, parakeet, pet)2018-03-05v4No1 / 44
365amnoncommon feces, homo sapiens, child, sudan, obsolete_juvenile stage2018-08-30v4No1 / 44
406amnoncommon feces, united states of america, zoological garden, myrmecophaga tridactyla, giant anteater2018-11-21v4No1 / 44
244amnoncommon digestive system, research facility, drosophila melanogaster, fruit fly, united kingdom2017-11-15v4No1 / 45
327amnonlower in nasopharynx of antibiotics treated cows compared to cows without antibiotic injection ( high in control compared to antibiotic in nasopharynx bos taurus canada cow )2018-04-30v4No1 / 45
558amnoncommon united states of america, duodenum, state of wyoming, bird, centrocercus urophasianus, greater sage-grouse2019-09-20v4No1 / 45
773amnoncommon homo sapiens, adult, palatine tonsil, tonsillitis, japan, tonsillectomy, recurrent tonsillitis2021-04-23v4No1 / 45
273amnoncommon feces, homo sapiens, infant, kingdom of denmark, 1-year-old human stage2018-01-14v4No1 / 46
428amnon high in acute pancreatitis pancreatitis compared to control in feces homo sapiens adult nanchang city prefecture china 2018-12-09v4No1 / 46
287amnoncommon mountain, snow field, depth 6-7m, japan2018-01-29v4No1 / 47
301amnoncommon united states of america, duodenum, canis lupus familiaris, dog2018-03-05v4No1 / 47
302amnoncommon in feces of canary pet birds (common feces, mexico, bird, pet, serinus canaria, canary)2018-03-05v4No1 / 47
482amnoncommon feces, homo sapiens, child, colombia, medellin metropolitan area, daycare, 1-5-years-old human2019-02-12v4No1 / 47
591amnoncommon feces, homo sapiens, united states of america, adult, parkinson's disease, human late adulthood stage2020-02-17v4No1 / 47
708amnonhigher in mice with iron deficient diet ( high in iron deficient diet low iron compared to iron iron supplemented diet in feces united states of america research facility mus musculus c57bl/6 mouse state of montana )2028-05-16v4No1 / 47
779amnoncommon feces, homo sapiens, control, adult, guangzhou city prefecture, china2021-04-28v4No1 / 47
830amnoncommon feces, homo sapiens, peru, age 9-17 years, teenager2021-09-10v4No1 / 47
89amnoncommon cloaca, commonwealth of virginia, junco hyemalis, songbird2017-03-08v4No1 / 48
495amnon high in typhlitis disease intestinal disease compared to control in farm caecum gallus gallus kingdom of spain chicken free range chicken 2019-03-03v4No1 / 48
258amnoncommon in lungs of hiv patients with pneumonia (common homo sapiens, lung, bronchoalveolar lavage, hiv infection, bronchial epithelium, uganda, pneumonia)2017-11-27v4No1 / 49
645amnoncommon feces, state of idaho, bird, captive, gymnogyps californianus, california condor2020-09-03v4No1 / 49
651amnoncommon feces, homo sapiens, united states of america, adult, state of alabama, parkinson's disease2020-09-13v4No1 / 49
674amnoncommon female, body proper, whole body, culicoides <genus>, panama, culicoides foxi, biting midge2020-09-28v4No1 / 49
121amnoncommon feces, homo sapiens, adult, bangladesh2017-04-13v4No1 / 50
327amnoncommon nasopharynx, bos taurus, canada, cow2018-04-30v4No1 / 50
339amnon high in infant under-1-year-old human stage compared to adult in feces homo sapiens india 2018-05-24v4No1 / 50
406amnoncommon feces, united states of america, zoological garden, equus przewalskii, przewalski horse2018-11-21v4No1 / 50
702amnoncommon feces, united states of america, felis catus, state of north carolina, cat2028-04-02v4No1 / 51
321amnonhigher in mice treated with ampicillin compared to untreated mice ( high in antibiotic ampicillin compared to control in feces united states of america research facility mus musculus c57bl/6j mouse )2018-04-22v4No1 / 52
650amnoncommon feces, homo sapiens, united states of america, adult, african american, state of new york2020-09-09v4No1 / 52
671amnon high in state of california compared to state of oregon in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 3-month-old human stage 2020-09-27v4No1 / 52
93amnon high in egg jelly shelled egg compared to shell gland in hawaii bobtail squid euprymna scolopes 2017-03-12v4No1 / 53
292amnoncommon feces, homo sapiens, adult, ulcerative colitis, china2018-02-05v4No1 / 53
661amnoncommon farm, lung, china, maojian district, andrias davidianus, chinese giant salamander, age 3 years2020-09-20v4No1 / 53
333amnoncommon in stroke patient feces (common feces, homo sapiens, stroke, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 53
109amnoncommon united states of america, water, drinking water, site a2017-04-08v4No1 / 54
286amnonhigher in feces of individuals with kidney stones ( high in nephrolithiasis compared to control in feces homo sapiens adult nanning city prefecture china sixth decade human stage )2018-01-27v4No1 / 54
773amnoncommon homo sapiens, adult, palatine tonsil, iga glomerulonephritis, japan, tonsillectomy2021-04-23v4No1 / 54
15amnoncommon feces, acinonyx jubatus, namibia2016-11-08v4No1 / 55
292amnoncommon feces, homo sapiens, adult, crohn's disease, china2018-02-05v4No1 / 55
313amnonhigher in gut content of fish grown in 12C compared to 18C water ( high in temp 12c cold environment compared to warm temperature habitat temp 18c in digestive system research facility oncorhynchus mykiss sweden fish rainbow trout gut content )2018-04-10v4No1 / 55
390amnoncommon feces, homo sapiens, hospital, salmonella gastroenteritis, australia, diarrhea2018-11-04v4No1 / 55
683amnonhigher in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in antibiotic vancomycin metronidazole neomycin compared to control in feces homo sapiens united states of america adult state of california )2028-03-04v4No1 / 55
814amnoncommon feces, homo sapiens, female, obesity, adult, obese body mass index status, germany, high bmi, overweight body mass index status, age 50-70 years2021-06-30v4No1 / 55
649amnoncommon research facility, ileum, ovis aries, new zealand, sheep, lamb, age 6 weeks2020-09-07v3No1 / 55
45amnonhigher in younf babies compared to 2 year olds in india ( high in age under-1-year-old human stage compared to 1-year-old human stage in feces homo sapiens infant india )2016-12-19v4No1 / 56
368amnoncommon feces, homo sapiens, united states of america, adult, commonwealth of virginia, systemic lupus erythematosus2018-09-03v4No1 / 56
394amnoncommon feces, homo sapiens, united states of america, adult, state of california, ulcerative colitis2018-11-06v4No1 / 56
488amnoncommon feces, canis lupus familiaris, italy, dog, lymphoma2019-02-25v4No1 / 56
591amnoncommon feces, homo sapiens, control, united states of america, adult, human late adulthood stage2020-02-17v4No1 / 56
308amnoncommon in neonatal intensive care unit floor (common united states of america, dust, hospital, state of california, floor)2018-03-31v4No1 / 57
759amnoncommon feces, united states of america, canis lupus familiaris, state of minnesota, dog, domestic2021-04-04v4No1 / 57
56amnoncommon nectar, israel, nicotiana galuca, flower2017-01-30v4No1 / 57
237amnoncommon uropygial gland, canada, bon portage island, bird, oceanodroma leucorhoa, seabird2017-11-07v4No1 / 58
651amnoncommon feces, homo sapiens, control, united states of america, adult, state of alabama2020-09-13v4No1 / 58
759amnoncommon feces, united states of america, state of minnesota, canis lupus, wolf, wildlife sactuary2021-04-04v4No1 / 58
814amnonhigher after 2 months of caloric restriction diet ( high in caloric restriction diet compared to control diet in feces homo sapiens female obesity adult obese body mass index status germany high bmi overweight body mass index status age 50-70 years )2021-06-30v4No1 / 58
281amnoncommon cloaca, shinisaurus crocodilurus, crocodile lizard, china2018-01-25v4No1 / 59
9amnonhigher in sea water with coral ( high in porites astreoides compared to control in sea water bermuda )2016-10-27v4No1 / 61
333amnoncommon in healthy controls feces (common feces, homo sapiens, control, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 61
302amnoncommon in feces of Cockatiel pet birds (common feces, mexico, bird, pet, nymphicus hollandicus, cockatiel)2018-03-05v4No1 / 63
380amnoncommon feces, homo sapiens, adult, tibetan plateau, tibet autonomous region2018-10-03v4No1 / 63
442amnonhigher in tnbs induced colitis compared to controls ( high in tnbs colitis compared to control in feces research facility rattus norvegicus sprague dawley male rat china )2019-01-06v4No1 / 63
502amnoncommon feces, homo sapiens, united states of america, adult, schizophrenia2019-03-12v4No1 / 63
530amnoncommon feces, farm, hunan province, adula, snake, snake farm, elaphe carinata, king ratsnake, china2019-07-21v4No1 / 63
242amnoncommon in native-americans (common feces, homo sapiens, united states of america, state of oklahoma, cheyenne, native american, arapaho)2017-11-14v4No1 / 65
448amnoncommon feces, farm, equus caballus, horse, equine grass sickness, disease, united kingdom2019-01-08v4No1 / 65
365amnoncommon feces, homo sapiens, child, nigeria, obsolete_juvenile stage2018-08-30v4No1 / 66
558amnoncommon united states of america, colon, state of wyoming, bird, centrocercus urophasianus, greater sage-grouse2019-09-20v4No1 / 66
650amnoncommon feces, homo sapiens, united states of america, adult, state of new york, asian2020-09-09v4No1 / 66
671amnon high in state of california compared to state of oregon in feces united states of america research facility macaca mulatta monkey captive rhesus macaque age 8 months 2020-09-27v4No1 / 66
114amnon high in adult compared to tadpole in united states of america research facility intestine state of wisconsin digesta rana pipiens northern leopard frog 2017-04-10v4No1 / 67
365amnoncommon feces, homo sapiens, child, jordan, obsolete_juvenile stage2018-08-30v4No1 / 67
642amnon high in skin scomber japonicus chub mackerel compared to water saline water sea water in pacific ocean san diego 2020-08-28v4No1 / 67
71amnon high in stomach small intestine compared to feces hindgut colon in research facility argentina liolaemus ruibali 2017-02-25v4No1 / 67
398amnon high in crohn's disease compared to control in feces homo sapiens belgium 2018-11-15v4No1 / 68
582amnoncommon united states of america, wild, lip, labial commissure, santa catalina island, urocyon littoralis, urocyon littoralis catalinae, santa catalina island fox2020-01-22v4No1 / 68
690amnoncommon in squamous esophagos samples from patients undergoing endoscopy (common homo sapiens, united states of america, hospital, esophagus, new york city, esophageal disease, squamous esophagus)2028-03-11v4No1 / 68
301amnoncommon united states of america, ileum, canis lupus familiaris, dog2018-03-05v4No1 / 69
495amnoncommon farm, caecum, gallus gallus, kingdom of spain, chicken, free range chicken, age 4 days2019-03-03v4No1 / 69
72amnoncommon feces, united states of america, canis lupus familiaris, iowa2017-02-25v4No1 / 69
417amnoncommon feces, anser cygnoides, winter, bird, swan goose, china2018-12-01v4No1 / 70
803amnoncommon feces, homo sapiens, united states of america, adult, commonwealth of massachusetts, type 2 diabetes mellitus, caribbean latino, human late adulthood stage2021-06-18v4No1 / 70
313amnoncommon in fishfeed (common sweden, fish feed)2018-04-10v4No1 / 71
389amnoncommon united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 4 weeks2018-11-04v4No1 / 71
404amnon high in municipality of santiago de cali bucaramanga barranquilla compared to bogota medellin metropolitan area in feces homo sapiens city adult colombia 2018-11-20v4No1 / 71
644amnoncommon feces, homo sapiens, united states of america, adult, hispanic or latin american2020-08-31v4No1 / 71
645amnon high in cloaca compared to feces in state of idaho bird captive gymnogyps californianus california condor 2020-09-03v4No1 / 71
663amnoncommon feces, homo sapiens, obesity, adult, obese body mass index status, switzerland2020-09-22v4No1 / 71
389amnoncommon united states of america, farm, nipple, skin, adult, sus scrofa, state of michigan, pig2018-11-04v4No1 / 72
441amnonhigher in mice treated with indomethacin NSAID compared to non-treated controls ( high in non-steroidal anti-inflammatory drug indomethacin compared to control in feces united states of america research facility mus musculus c57bl/6j mouse )2019-01-06v4No1 / 72
448amnon high in equine grass sickness disease compared to control in feces farm equus caballus horse united kingdom 2019-01-08v4No1 / 72
541amnoncommon feces, australia, wild, phascolarctos cinereus, koala, cape otway, eucalyptus viminalis diet2019-08-01v4No1 / 72
663amnon high in poland compared to switzerland in feces homo sapiens adult 2020-09-22v4No1 / 72
26amnoncommon homo sapiens, united states of america, mucus, pair of nares2016-12-05v4No1 / 73
425amnoncommon feces, homo sapiens, child, africa, madagascar, antananarivo2018-12-08v4No1 / 73
477amnoncommon feces, homo sapiens, adult, nepal, himalayas, rural community, tharu, agrarian2019-01-28v4No1 / 74
832amnoncommon feces, homo sapiens, adult, nigeria, ibadan2021-09-11v4No1 / 74
395amnoncommon feces, homo sapiens, control, united states of america, commonwealth of pennsylvania2018-11-14v4No1 / 75
719amnoncommon united states of america, research facility, dentition, mus musculus, state of georgia, mouse, charles river laboratories, icr/cd-1 mice2028-05-23v4No1 / 75
794amnoncommon feces, homo sapiens, hiv infection, adult, kingdom of spain, human immunodeficiency virus infectious disease, municipality of logrono, antiretroviral therapy2021-06-08v4No1 / 75
477amnoncommon feces, homo sapiens, nepal, himalayas, rural community, raute2019-01-29v4No1 / 76
484amnoncommon feces, homo sapiens, united states of america, adult, state of michigan, 17-29-years-old human2019-02-13v4No1 / 76
74amnoncommon feces, homo sapiens, united states of america2017-02-27v4No1 / 76
431amnonhigher in midgut of hibernating bumble bees compared to non-hibernating ( high in hibernation compared to non hibernating in research facility midgut belgium bombus terrestris bumble bee queen )2018-12-16v4No1 / 77
516amnoncommon feces, homo sapiens, united states of america, adult, state of ohio2019-05-29v4No1 / 77
541amnoncommon feces, australia, wild, phascolarctos cinereus, koala, cape otway, eucalyptus obliqua diet2019-08-01v4No1 / 77
360amnoncommon desert, leaf, mexico, guanajuato, agave, leaf endosphere, agave tequiliana, cultivated environment2018-08-21v4No1 / 78
399amnoncommon feces, united states of america, state of tennessee, zoological garden, panthera leo, lion2018-11-16v4No1 / 79
401amnoncommon feces, homo sapiens, united states of america, adult2018-11-18v4No1 / 79
404amnoncommon feces, homo sapiens, city, adult, colombia2018-11-20v4No1 / 79
407amnon high in wet season compared to dry season in feces costa rica monkey wild cebus capucinus white-faced capuchin 2018-11-21v4No1 / 79
425amnoncommon feces, homo sapiens, child, africa, central african republic, bangui2018-12-08v4No1 / 79
26amnoncommon united states of america, mucus, pair of nares, felis catus2016-12-05v4No1 / 80
389amnoncommon united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 1-3 weeks2018-11-04v4No1 / 80
483amnoncommon united states of america, research facility, adult, hawaii, pearl harbor, hydroides elegans, tubeworm2019-02-13v4No1 / 80
534amnoncommon river, tributary, water, fresh water, nepal, free floating, depth (water) 10cm, filtered 0.2um, koshi river2019-07-22v4No1 / 80
695amnoncommon feces, homo sapiens, child, israel, food allergy, age 4-10 years, sesame allergy2028-03-27v4No1 / 80
292amnoncommon feces, homo sapiens, control, adult, china2018-02-05v4No1 / 81
339amnoncommon feces, homo sapiens, adult, india2018-05-24v4No1 / 81
643amnoncommon feces, homo sapiens, adult, south korea2020-08-30v4No1 / 81
344amnoncommon in feces of heterosexuals (common feces, homo sapiens, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 82
368amnoncommon feces, homo sapiens, control, united states of america, adult, commonwealth of virginia2018-09-03v4No1 / 82
562amnoncommon feces, child, ecuador, age 5-13 years, quito2019-11-05v4No1 / 82
334amnonhigher in dss induced colitis compared to controls ( high in dss induced colitis colitis compared to control in feces research facility mus musculus c57bl/6 israel mouse )2018-05-15v4No1 / 83
502amnoncommon feces, homo sapiens, control, united states of america, adult2019-03-12v4No1 / 83
648amnoncommon feces, united states of america, canis lupus familiaris, dog, state of louisiana2020-09-06v4No1 / 83
231amnoncommon in dog rectum (common feces, united states of america, rectum, canis lupus familiaris, dog)2017-11-02v4No1 / 84
393amnoncommon feces, homo sapiens, united states of america, city, adult, state of colorado, heterosexual, msw2018-11-06v4No1 / 84
663amnoncommon homo sapiens, lung, bronchoalveolar lavage, adult, poland2020-09-22v4No1 / 84
227amnonhiger in first 24hrs compared to later timepoints in baby nasopharynx ( high in age age <=24 hours newborn human stage compared to age >= 7 days newborn human stage in homo sapiens nasal cavity nasopharynx infant kingdom of the netherlands )2017-10-30v4No1 / 85
247amnoncommon feces, homo sapiens, italy, high bmi, obesity2017-11-21v4No1 / 85
405amnon high in ketogenic diet compared to control diet in feces united states of america research facility mus musculus mouse swiss webster 2018-11-20v4No1 / 85
601amnoncommon feces, homo sapiens, adult, type 2 diabetes mellitus, china2020-03-30v4No1 / 85
663amnoncommon feces, homo sapiens, adult, switzerland, low bmi2020-09-22v4No1 / 85
26amnon high in mucus pair of nares compared to saliva mouth in united states of america felis catus 2016-12-05v4No1 / 86
109amnoncommon united states of america, water, drinking water, site c2017-04-08v4No1 / 86
249amnoncommon feces, homo sapiens, united states of america2017-11-22v4No1 / 86
318amnoncommon ocean, vancouver, pacific ocean, canada, nereocystis, kelp2018-04-16v4No1 / 86
394amnoncommon feces, homo sapiens, control, united states of america, adult, state of california2018-11-06v4No1 / 86
513amnoncommon city, waste water, hospital, xinxiang city prefecture, china2019-03-25v4No1 / 86
530amnoncommon feces, farm, hunan province, adula, snake, snake farm, ptyas mucosa, oriental ratsnake, china2019-07-21v4No1 / 86
766amnon high in age 2 days compared to age 8 weeks in feces canis lupus familiaris french republic dog rectal swab puppy 2021-04-12v4No1 / 86
340amnoncommon feces, felis catus, australia, city of melbourne, cat2018-05-27v4No1 / 87
344amnoncommon in feces of homosexual males (common feces, homo sapiens, united states of america, state of colorado, denver, gay, homosexual, msm)2018-05-31v4No1 / 87
360amnoncommon desert, mexico, guanajuato, agave, root endosphere, agave salmiana, root2018-08-21v4No1 / 87
430amnoncommon feces, homo sapiens, united states of america, city, adult, state of arizona, 20-year-old human stage2018-12-15v4No1 / 87
477amnoncommon feces, homo sapiens, raji, nepal, himalayas, rural community2019-01-29v4No1 / 88
487amnoncommon feces, homo sapiens, united states of america, metabolic syndrome x, metabolic syndrome2019-02-24v4No1 / 88
582amnoncommon united states of america, rectum, wild, perianal skin, santa catalina island, urocyon littoralis, urocyon littoralis catalinae, santa catalina island fox2020-01-22v4No1 / 88
673amnon high in control compared to salmonella enterica subsp. enterica serovar typhimurium salmonellosis in research facility caecum sus scrofa male canada pig age 6 weeks ascending colon male organism province of alberta 2020-09-28v4No1 / 88
830amnon high in iga positive fraction compared to iga negative fraction iga igg negative fraction in feces homo sapiens peru age 9-17 years teenager 2021-09-10v4No1 / 88
71amnoncommon research facility, stomach, argentina, liolaemus ruibali2017-02-25v4No1 / 88
293amnoncommon feces, homo sapiens, united states of america, adult, american diet2018-02-07v4No1 / 89
382amnoncommon hot spring, geothermal field, water, ganzi tibetan autonomous prefecture, high temperature environment, china2018-10-22v4No1 / 89
629amnoncommon feces, homo sapiens, female, adult, kingdom of the netherlands, amsterdam2020-05-31v4No1 / 89
803amnoncommon feces, homo sapiens, control, united states of america, adult, commonwealth of massachusetts, caribbean latino, human late adulthood stage2021-06-18v4No1 / 89
530amnoncommon feces, farm, hunan province, adula, snake, snake farm, naja atra, chinese cobra, china2019-07-21v4No1 / 90
199amnonhigher in bathroom shower compared to kitchen sink ( high in bathroom shower tile building wall compared to kitchen sink in united states of america building urban biome )2017-10-01v4No1 / 91
503amnon high in balb/c compared to c57bl/6 in feces research facility mus musculus mouse japan 2019-03-12v4No1 / 91
582amnoncommon united states of america, pair of nares, wild, external naris, santa catalina island, urocyon littoralis, urocyon littoralis catalinae, santa catalina island fox2020-01-22v4No1 / 92
649amnon high in ileum compared to duodenum jejunum in research facility ovis aries new zealand sheep lamb age 6 weeks 2020-09-07v3No1 / 92
428amnoncommon feces, homo sapiens, control, adult, nanchang city prefecture, china2018-12-09v4No1 / 93
601amnoncommon feces, homo sapiens, control, adult, china2020-03-30v4No1 / 93
363amnoncommon dairy, rectum, caecum, colon, ovis aries, italy, obsolete_juvenile stage, age 30 days2018-08-29v4No1 / 94
393amnoncommon feces, homo sapiens, united states of america, city, adult, state of colorado, gay, homosexual, msm2018-11-06v4No1 / 94
488amnoncommon feces, control, canis lupus familiaris, italy, dog2019-02-25v4No1 / 94
695amnoncommon feces, homo sapiens, child, israel, food allergy, milk allergy, age 4-10 years2028-03-27v4No1 / 94
838amnoncommon united states of america, research facility, caecum, state of ohio, meleagris gallopavo, wild turkey2021-10-13v4No1 / 94
400amnoncommon in feces of european american females (common feces, homo sapiens, united states of america, female, adult)2018-11-18v4No1 / 95
400amnoncommon in hmong (chinese) females from thailand (common feces, homo sapiens, female, adult, thailand, hmong, china)2018-11-18v4No1 / 95
238amnoncommon feces, homo sapiens, colombia2017-11-07v4No1 / 96
365amnoncommon feces, homo sapiens, child, azerbaijan, obsolete_juvenile stage2018-08-30v4No1 / 97
409amnoncommon homo sapiens, united states of america, right colon, biopsy site, adult, biopsy2018-11-22v4No1 / 97
477amnoncommon feces, homo sapiens, adult, nepal, himalayas, forager, rural community, chepang2019-01-28v4No1 / 97
558amnoncommon united states of america, gizzard, state of wyoming, bird, centrocercus urophasianus, greater sage-grouse2019-09-20v4No1 / 97
629amnoncommon feces, homo sapiens, adult, kingdom of the netherlands, amsterdam, heterosexual, msw2020-05-31v4No1 / 97
663amnoncommon feces, homo sapiens, adult, poland, low bmi2020-09-22v4No1 / 98
753amnoncommon feces, zoological garden, adult, captive, canis lupus, china, wolf2021-03-12v4No1 / 98
645amnoncommon cloaca, state of idaho, bird, captive, gymnogyps californianus, california condor2020-09-03v4No1 / 99
455amnoncommon homo sapiens, saliva, adult, canada, atherosclerosis2019-01-10v4No1 / 100
804amnon high in iga positive fraction compared to iga negative fraction in feces homo sapiens child africa central african republic madagascar age 2-5 years 2021-06-18v4No1 / 100
363amnon high in rectum caecum colon compared to ruminant reticulum omasum rumen in dairy ovis aries italy obsolete_juvenile stage age 30 days 2018-08-29v4No1 / 101
438amnoncommon feces, homo sapiens, china, young adult stage2018-12-30v4No1 / 101
499amnoncommon digestive system, pond, intestine, tadpole, brazil, frog, dendropsophus minutus2019-03-05v4No1 / 102
198amnoncommon united states of america, hot spring, geothermal field, water, yellowstone national park, high temperature environment2017-09-13v4No1 / 103
213amnoncommon homo sapiens, vagina, south africa2017-10-22v4No1 / 103
425amnon high in madagascar antananarivo compared to central african republic bangui in homo sapiens duodenum child africa 2018-12-08v4No1 / 103
477amnoncommon feces, homo sapiens, united states of america, adult2019-01-28v4No1 / 103
563amnoncommon feces, homo sapiens, control, united states of america, homosexual, msm, male, rectal swab2019-11-18v4No1 / 103
580amnoncommon feces, homo sapiens, female, pregnancy, adult, israel, third trimester2020-01-14v4No1 / 103
499amnoncommon digestive system, pond, larval stage, intestine, brazil, remartinia, aeshnidae, dragonfly2019-03-05v4No1 / 104
515amnoncommon feces, bulgaria, balkan mountains, whole body, beetle, detritivorous beetle, onthophagus similis2019-04-18v4No1 / 104
673amnon high in control compared to salmonellosis salmonella enterica subsp. enterica serovar typhimurium in research facility caecum sus scrofa male canada pig age 6 weeks ascending colon male organism province of alberta 2020-09-28v4No1 / 104
284amnoncommon feces, homo sapiens, female, adult, state of california2018-01-27v4No1 / 105
301amnoncommon united states of america, colon, canis lupus familiaris, dog2018-03-05v4No1 / 105
683amnoncommon feces, homo sapiens, united states of america, adult, state of california2028-03-04v4No1 / 105
438amnoncommon feces, homo sapiens, child, jiangsu province, age 8-12, china, 6-12 year-old child stage2018-12-30v4No1 / 106
215amnoncommon feces, homo sapiens, united states of america2017-10-23v4No1 / 107
213amnonlower in patients with bacterial vaginosis compared to healthy controls ( high in control compared to bacterial vaginosis in homo sapiens vagina south africa )2017-10-31v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common feces, homo sapiens, control, adult, belgium)2018-11-15v4No1 / 107
406amnoncommon feces, zoological garden, south africa, aardvark, orycteropus afer2018-11-21v4No1 / 107
409amnoncommon feces, homo sapiens, united states of america, adult2018-11-22v4No1 / 108
436amnoncommon feces, united states of america, felis catus, state of colorado, cat2018-12-25v4No1 / 108
289amnoncommon feces, homo sapiens, united states of america, adult, state of michigan2018-02-01v4No1 / 109
438amnoncommon feces, homo sapiens, child, jiangsu province, age 3-6, china, 2-5 year-old child stage2018-12-30v4No1 / 109
271amnon high in root structure root compared to soil rhizosphere in glycine max soybean china depth (soil) 0-20cm 2018-01-09v4No1 / 110
276amnoncommon feces, homo sapiens, united states of america, city, adult, state of oklahoma2018-01-22v4No1 / 110
53amnoncommon feces, homo sapiens, city, lima, shantytown2017-01-21v4No1 / 110
425amnoncommon homo sapiens, stomach, child, africa, stunted growth2018-12-08v4No1 / 111
438amnoncommon feces, homo sapiens, adult, jiangsu province, china, 65-79 year-old human stage2018-12-30v4No1 / 111
477amnon high in nepal himalayas rural community compared to united states of america in feces homo sapiens adult 2019-01-28v4No1 / 111
563amnoncommon feces, homo sapiens, united states of america, hiv infection, homosexual, msm, male, rectal swab2019-11-18v4No1 / 111
388amnoncommon united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 6-10 weeks2018-11-03v4No1 / 112
580amnoncommon feces, homo sapiens, female, pregnancy, adult, israel, first trimester2020-01-14v4No1 / 112
663amnoncommon feces, homo sapiens, obesity, adult, obese body mass index status, poland2020-09-22v4No1 / 112
198amnoncommon united states of america, geothermal field, sediment, thermophilic sediment, yellowstone national park, high temperature environment2017-09-13v4No1 / 113
269amnoncommon in fresh yao meat food (common foodon product type, china)2018-01-09v4No1 / 113
517amnoncommon feces, homo sapiens, child, bolivia, chuquisaca department, rural community, age 5-13 years2019-05-29v4No1 / 113
79amnoncommon united states of america, skin, delphinus delphis2017-03-03v4No1 / 113
388amnoncommon united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 12-19 weeks2018-11-03v4No1 / 114
438amnoncommon feces, homo sapiens, adult, jiangsu province, china, fourth decade human stage, fifth decade human stage2018-12-30v4No1 / 115
195amnoncommon in boston subway surfaces (common city, urban biome, boston, train)2017-09-07v4No1 / 116
301amnoncommon united states of america, rectum, canis lupus familiaris, dog2018-03-05v4No1 / 116
48amnonhigher in 3 months compared to 1 week in infant hypopharynx ( high in age 3-month-old human stage compared to age 1 week 1-month-old human stage in homo sapiens hypopharynx infant kingdom of denmark )2017-01-19v4No1 / 116
149amnonhigher in larvae transferred to stream compared to pond ( high in stream compared to pond in mucus larval stage amphibian larval stage skin germany salamandra salamandra fire salamander )2017-04-24v4No1 / 117
239amnoncommon feces, homo sapiens, united states of america2017-11-08v4No1 / 117
343amnoncommon in apple flowers (common united states of america, flower structure, malus x domestica, state of connecticut, flower, apple)2018-05-28v4No1 / 118
409amnoncommon homo sapiens, united states of america, left colon, biopsy site, adult, biopsy2018-11-22v4No1 / 118
410amnonlower in feces compared to rectal biopsies in children with treatment naive uc ( high in rectum biopsy site biopsy compared to feces in homo sapiens united states of america child ulcerative colitis )2018-11-22v4No1 / 118
212amnoncommon feces, control, united states of america, research facility, mus musculus, lean body mass, mouse2017-10-22v4No1 / 120
294amnoncommon feces, homo sapiens, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
753amnoncommon feces, farm, adult, canis lupus familiaris, dog, china, dog breeding center2021-03-12v4No1 / 120
352amnoncommon in duodenal biopsies (common homo sapiens, small intestine, duodenum, new delhi, india)2018-07-30v4No1 / 121
371amnoncommon feces, homo sapiens, venezuela, amerindian, hunter gatherer2018-09-06v4No1 / 121
438amnoncommon feces, homo sapiens, adult, jiangsu province, age >94, china, ninth decade human stage, tenth decade human stage2018-12-30v4No1 / 121
515amnoncommon feces, bulgaria, balkan mountains, whole body, beetle, aphodius depressus, detritivorous beetle2019-04-18v4No1 / 121
517amnoncommon homo sapiens, arm, skin, forearm, child, bolivia, chuquisaca department, rural community, age 5-13 years2019-05-29v4No1 / 121
632amnonhigher following metronidazole treatment in horse feces ( high in metronidazole compared to control in feces united states of america research facility adult equus caballus state of texas horse )2020-06-10v4No1 / 121
425amnoncommon homo sapiens, duodenum, child, africa, madagascar, antananarivo2018-12-08v4No1 / 123
660amnoncommon feces, homo sapiens, ecuador, rural community, village, shuar population2020-09-20v4No1 / 123
449amnoncommon feces, homo sapiens, colombia2019-01-09v4No1 / 124
582amnoncommon united states of america, wild, external ear, santa catalina island, urocyon littoralis, urocyon littoralis catalinae, santa catalina island fox2020-01-22v4No1 / 124
10amnonnegatively correlated with age (6-35) ( high in child compared to adult in feces homo sapiens toronto )2016-10-27v4No1 / 125
425amnoncommon homo sapiens, duodenum, child, africa, central african republic, bangui, stunted growth2018-12-08v4No1 / 125
607amnoncommon feces, homo sapiens, germany, parkinson's disease2020-04-19v4No1 / 125
69amnoncommon feces, united states of america, research facility, canis lupus familiaris, beagle dog2017-02-21v4No1 / 125
347amnoncommon permafrost, soil, kingdom of norway, svalbard archipelago, depth 150-200cm2018-07-15v4No1 / 126
67amnoncommon in dry processing of coffee beans (common coffea arabica, ecuador, dry processing)2017-02-19v4No1 / 126
113amnon high in larval stage compared to adult in united states of america research facility intestine danio rerio zebra fish 2017-04-10v4No1 / 128
131amnoncommon feces, homo sapiens, south korea2017-04-16v4No1 / 128
280amnoncommon coral reef, atlantic ocean, portuguese republic, depth (water) 20m, eunicella labiata, gorgonian coral, coral2018-01-25v4No1 / 128
607amnoncommon feces, homo sapiens, control, germany2020-04-19v4No1 / 128
173amnoncommon homo sapiens, saliva, austria, graz city district2017-07-26v4No1 / 129
330amnoncommon feces, homo sapiens, adult, kingdom of norway, oslo, fourth decade human stage2018-05-13v4No1 / 130
721amnoncommon feces, homo sapiens, obesity, adult, scotland, overweight body mass index status, gaz:000521002028-05-23v4No1 / 131
39amnoncommon in obese lepr-db mice (common feces, research facility, mus musculus, obesity)2016-12-09v4No1 / 132
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
625amnoncommon feces, united states of america, zoological garden, state of minnesota, saguinus imperator, como zoo, emperor tamarin2020-05-16v4No1 / 132
176amnoncommon in skin of hairless mice (common united states of america, female, research facility, dorsum, mus musculus, skin, mouse, skh-1 hairless mouse)2017-07-29v4No1 / 133
775amnoncommon homo sapiens, saliva, adult, china, jinan city prefecture2021-04-24v4No1 / 133
794amnoncommon feces, homo sapiens, control, adult, kingdom of spain, municipality of logrono2021-06-08v4No1 / 133
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
438amnoncommon feces, homo sapiens, jiangsu province, age 13-14, china, 13-year-old human stage, 14-year-old human stage2018-12-30v4No1 / 134
495amnoncommon farm, caecum, gallus gallus, kingdom of spain, chicken, broiler chicken, age 2 weeks2019-03-03v4No1 / 134
511amnoncommon united states of america, state of colorado, depth 0-5cm, snow2019-03-20v4No1 / 134
607amnoncommon feces, homo sapiens, germany, rem sleep behavior disorder2020-04-19v4No1 / 134
197amnoncommon feces, homo sapiens, juvenile organism, finland, obsolete_juvenile stage, 13-year-old human stage2017-09-12v4No1 / 136
594amnoncommon feces, homo sapiens, adult, rural community, cameroon, ngoantet2020-03-12v4No1 / 136
212amnoncommon feces, united states of america, research facility, mus musculus, obese body mass index status, mouse, db/db mouse, obesity2017-10-22v4No1 / 137
294amnoncommon in non-IBS healthy controls (common feces, homo sapiens, control, adult, kingdom of spain)2018-02-09v4No1 / 137
10amnoncommon feces, homo sapiens, toronto2016-10-27v4No1 / 138
582amnoncommon united states of america, axilla, wild, santa catalina island, urocyon littoralis, urocyon littoralis catalinae, santa catalina island fox2020-01-22v4No1 / 140
255amnoncommon in fish feed (common united states of america, research facility, state of minnesota, fish feed)2017-11-24v4No1 / 141
629amnoncommon feces, homo sapiens, adult, kingdom of the netherlands, amsterdam, homosexual, msm2020-05-31v4No1 / 141
291amnoncommon nasal cavity, pair of nares, canis lupus familiaris, germany, dog2018-02-01v4No1 / 144
62amnon high in egypt compared to united states of america in feces homo sapiens child obsolete_juvenile stage 2017-02-13v4No1 / 144
132amnoncommon feces, homo sapiens, united states of america2017-04-16v4No1 / 145
611amnoncommon research facility, caecum, mus musculus, mouse, cecal content, canada, age 9 months2020-04-21v4No1 / 145
822amnoncommon feces, research facility, canis lupus familiaris, australia, city of melbourne, dog, foxhound, hydrolized diet2021-08-29v4No1 / 145
509amnoncommon feces, homo sapiens, child, nigeria, kebbi state, rural community, schistosomiasis, urinary schistosomiasis, 10-15-years-old human2019-03-18v4No1 / 146
15amnoncommon feces, namibia, canis mesomelas2016-11-08v4No1 / 147
85amnoncommon digestive system, sea water, litopenaeus vannamei, shenzhen city prefecture, pacific white shrimp, china2017-03-06v4No1 / 147
406amnoncommon feces, south africa, lycaon pictus, african wild dog2018-11-21v4No1 / 147
458amnonhigher in BALB/c strain compared to A/J and C57BL/6 strains ( high in balb/c compared to a/j c57bl/6 in feces united states of america female research facility mus musculus mouse )2019-01-11v4No1 / 147
475amnoncommon in air next to subway stations in hong kong (common city, air, hong kong)2019-01-20v4No1 / 147
509amnoncommon feces, homo sapiens, control, child, nigeria, kebbi state, rural community, 10-15-years-old human2019-03-18v4No1 / 147
515amnoncommon feces, bulgaria, balkan mountains, whole body, beetle, detritivorous beetle, aphodius haemorrhoidalis2019-04-18v4No1 / 147
73amnoncommon feces, homo sapiens, adult, glasgow2017-02-26v4No1 / 147
74amnonHigher in animal product diet compared to plant diet ( high in diet animal product diet compared to plant diet in feces homo sapiens united states of america )2017-02-27v4No1 / 149
362amnoncommon hydrothermal vent, volcanic crater, water, volcanic rock, marine sediment, sea water, marine hydrothermal vent, mediterranean sea, greece, active vent2018-08-29v4No1 / 150
822amnoncommon feces, research facility, canis lupus familiaris, australia, city of melbourne, dog, high protein diet, foxhound, meat diet2021-08-29v4No1 / 151
822amnoncommon feces, research facility, canis lupus familiaris, australia, city of melbourne, high fiber, dog, foxhound2021-08-29v4No1 / 153
358amnonhigher in dnbs induced colitis compared to controls in rat feces ( high in dnbs induced colitis colitis compared to control in feces research facility rattus czech republic rat wistar rat )2018-08-19v4No1 / 154
594amnoncommon feces, homo sapiens, city, adult, cameroon, yaounde2020-03-12v4No1 / 154
673amnoncommon control, research facility, caecum, sus scrofa, male, canada, pig, age 6 weeks, ascending colon, male organism, province of alberta2020-09-28v4No1 / 154
273amnon high in age 1-month-old human stage compared to 1-year-old human stage in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 155
53amnoncommon feces, homo sapiens, city, el salvador, small village2017-01-21v4No1 / 155
108amnon high in colon compared to caecum in united states of america research facility state of texas quail coturnix coturnix 2017-04-07v4No1 / 157
122amnoncommon feces, homo sapiens, united kingdom2017-04-13v4No1 / 157
108amnoncommon united states of america, research facility, colon, mus musculus, state of texas, mouse2017-04-07v4No1 / 158
180amnoncommon larval stage, czech republic, dermanyssus gallinae, red poulty mite, poulty farm, shelled egg2017-08-14v4No1 / 158
379amnoncommon feces, gallus gallus, chicken, age 15 - 35 days, united kingdom2018-09-14v4No1 / 160
192amnoncommon seed structure, brassica napus, seed2017-09-05v4No1 / 161
475amnoncommon in air in subway train in hong kong (common city, air, hong kong, subway)2019-01-20v4No1 / 161
121amnonhigh in diarrhea compared to recovery period ( high in diarrhea compared to control in feces homo sapiens adult bangladesh )2017-04-13v4No1 / 162
290amnoncommon feces, homo sapiens, city, adult, china2018-02-01v4No1 / 162
297amnoncommon feces, homo sapiens, united states of america, child, atlanta, obsolete_juvenile stage, age<17 years, immature stage, adolescent stage2018-02-12v4No1 / 162
337amnoncommon in feces of house mice from new york city (common united states of america, city, mus musculus, new york city, mouse, house mice)2018-05-18v4No1 / 165
209amnon high in atlantic ocean cape cod canal compared to vancouver pacific ocean in ocean sea water north america depth (water) 25cm 2017-10-15v4No1 / 166
232amnoncoomon in foot of healthy controls (common homo sapiens, skin, foot, australia)2017-11-05v4No1 / 166
159amnoncommon midgut, australia, siganidae, rabbitfish2017-07-06v4No1 / 169
190amnoncommon feces, homo sapiens, tanzania, hunter gatherer, hadza2017-09-04v4No1 / 169
241amnonlower in babies from russia compared to estonia ( high in estonia compared to russia in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 169
123amnon high in diet high fat diet compared to normal diet mouse chow in feces united states of america research facility mus musculus c57bl/6j mouse 2017-04-13v4No1 / 170
197amnoncommon feces, homo sapiens, juvenile organism, obsolete_juvenile stage, india, 13-year-old human stage2017-09-12v4No1 / 170
374amnoncommon skin, costa rica, frog, amphibia, craugastor bransfordii, bransford’s litter frog2018-09-09v4No1 / 171
534amnoncommon river, water, fresh water, nepal, free floating, depth (water) 10cm, filtered 0.2um, koshi river2019-07-22v4No1 / 172
589amnoncommon in high fat diet supplemented with cellulose in mice feces (common feces, united states of america, research facility, mus musculus, high fat diet, c57bl/6, state of georgia, mouse, jackson laboratories)2020-02-10v4No1 / 172
347amnoncommon permafrost, soil, kingdom of norway, svalbard archipelago, depth 100-150cm2018-07-15v4No1 / 173
403amnon high in winter compared to summer in air kingdom of spain pyrenees autumn 2018-11-18v4No1 / 176
405amnoncommon feces, united states of america, research facility, mus musculus, mouse, ketogenic diet, swiss webster2018-11-20v4No1 / 177
515amnoncommon feces, bulgaria, balkan mountains, whole body, beetle, detritivorous beetle, onthophagus ruficapillus2019-04-18v4No1 / 178
530amnoncommon feces, farm, hunan province, adula, snake, deinagkistrodon acutus, pit viper, snake farm, china2019-07-21v4No1 / 178
671amnon high in age 8 months compared to female adult in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-27v4No1 / 182
179amnoncommon united states of america, research facility, oral cavity, mus musculus, balb/c, mouse, mouth2017-08-13v4No1 / 183
319amnoncommon feces, homo sapiens, united states of america, state of texas2018-04-18v4No1 / 183
399amnoncommon feces, united states of america, research facility, rattus norvegicus, rat2018-11-16v4No1 / 184
495amnoncommon farm, caecum, gallus gallus, kingdom of spain, chicken, age 4 weeks, broiler chicken2019-03-03v4No1 / 185
73amnonhigh in children with Crohn's disease compared to healthy adult controls ( high in child obsolete_juvenile stage crohn's disease compared to control adult in feces homo sapiens glasgow )2017-02-26v4No1 / 185
299amnoncommon homo sapiens, saliva, adult, mouth neoplasm, cancer, china2018-02-27v4No1 / 188
197amnon high in india compared to finland in feces homo sapiens juvenile organism obsolete_juvenile stage 13-year-old human stage 2017-09-12v4No1 / 189
386amnoncommon caecum, mus musculus, brazil, mouse, wild2018-10-28v4No1 / 189
402amnon high in zone 1 compared to zone 2,3 in mine tailing sediment soil guangxi zhuang autonomous region alkaline mine tailing china 2018-11-18v4No1 / 189
495amnoncommon farm, caecum, gallus gallus, kingdom of spain, chicken, free range chicken, age 8 weeks2019-03-03v4No1 / 189
352amnon high in feces compared to small intestine duodenum in homo sapiens new delhi india 2018-07-30v4No1 / 190
75amnoncommon homo sapiens, arm, skin, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 190
80amnon high in dry forest compared to tropical moist broadleaf forest biome in feces state of florida central america alouatta pigra howler monkey 2017-03-03v4No1 / 193
109amnon high in water treatment plant compared to distribution system in united states of america water drinking water site c 2017-04-08v4No1 / 193
534amnoncommon river, tributary, water, fresh water, nepal, depth (water) 10cm, filtered 2.7um, particle bound, koshi river2019-07-22v4No1 / 193
371amnoncommon homo sapiens, skin, venezuela, amerindian, hunter gatherer2018-09-06v4No1 / 195
620amnoncommon feces, gorilla gorilla, wild, republic of congo, nouabale-ndoki national park2020-05-06v4No1 / 196
312amnoncommon feces, homo sapiens, adult, french republic, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
620amnoncommon feces, homo sapiens, rural community, village, republic of congo, nouabale-ndoki national park2020-05-06v4No1 / 197
80amnoncommon feces, tropical broadleaf forest biome, central america, alouatta pigra, howler monkey, woodland area2017-03-03v4No1 / 198
411amnoncommon feces, zambia, monkey, wild, papio kindae, kinda baboon2018-11-23v4No1 / 200
42amnoncommon in tcr-b deficient c57bl6 mice (common feces, research facility, mus musculus, c57bl/6, japan)2016-12-10v4No1 / 201
248amnoncommon feces, research facility, mus musculus, germany, mouse, fvb/n mice2017-11-22v4No1 / 203
405amnoncommon feces, united states of america, research facility, mus musculus, mouse, swiss webster, control diet2018-11-20v4No1 / 203
702amnoncommon feces, united states of america, equus caballus, state of north carolina, horse2028-04-02v4No1 / 207
120amnoncommon feces, homo sapiens, brazil2017-04-12v4No1 / 208
150amnoncommon feces, united states of america, canis lupus familiaris, dog2017-04-26v4No1 / 208
159amnoncommon hindgut, australia, siganidae, rabbitfish2017-07-06v4No1 / 208
542amnoncommon research facility, dentition, adult, macaca mulatta, puerto rico, subgingival plaque, monkey, age 12-23 years2019-08-01v4No1 / 208
388amnon high in age 6-10 weeks compared to age 12-19 weeks in united states of america farm tonsil sus scrofa state of michigan pig 2018-11-03v4No1 / 210
495amnoncommon farm, caecum, gallus gallus, kingdom of spain, chicken, broiler chicken, age 6 weeks2019-03-03v4No1 / 210
511amnoncommon kingdom of norway, sweden, finland, lapland, depth 0-5cm, snow2019-03-20v4No1 / 213
495amnoncommon farm, caecum, gallus gallus, kingdom of spain, chicken, free range chicken, age 12 weeks2019-03-03v4No1 / 214
520amnonhigher in gastric cancer compared to paired normal tissue ( high in gastric carcinoma stomach neoplasm compared to control in homo sapiens stomach adult zhejiang province china )2019-06-26v3No1 / 214
201amnonhigher in cactus fly compared to decaying cactus ( high in drosophila drosophila nigrospiracula fly compared to cactus decaying in desert mexico )2017-10-01v4No1 / 215
433amnoncommon ocean, coast, sea water, south china sea, depth (water) 4m2018-12-19v4No1 / 215
108amnoncommon united states of america, research facility, caecum, state of texas, quail, coturnix coturnix2017-04-07v4No1 / 216
455amnoncommon feces, homo sapiens, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon feces, homo sapiens, adult, small village, rural community, china2018-02-01v4No1 / 218
347amnon high in depth 100-150cm depth 150-200cm compared to depth (soil) 20-30cm in permafrost soil kingdom of norway svalbard archipelago 2018-07-15v4No1 / 221
566amnoncommon feces, homo sapiens, adult, china2019-11-24v4No1 / 221
411amnoncommon feces, zambia, monkey, wild, papio ursinus, grayfoot chacma baboon2018-11-23v4No1 / 224
265amnoncommon in tree leaves (common leaf, canada, province of quebec, tree)2017-12-11v4No1 / 226
42amnoncommon in tcr-b deficient balb/c mice (common feces, research facility, mus musculus, balb/c, japan)2016-12-10v4No1 / 227
310amnoncommon feces, homo sapiens, female, rectum, adult, poland2018-04-07v4No1 / 227
25amnon high in antibiotic compared to control in research facility caecum oryctolagus cuniculus rex rabbit sichuan province 2016-12-01v4No1 / 231
214amnonlower in mice from jackson laboratories compared to taconic farms ( high in taconic farms compared to jackson laboratories in feces united states of america research facility mus musculus mouse strain 129s )2017-10-23v4No1 / 232
78amnoncommon feces, tropical grassland biome, kenya, nanger granti, gazelle2017-03-01v4No1 / 234
349amnoncommon feces, research facility, sprague dawley, rattus, male, rat, china2018-07-29v4No1 / 235
495amnoncommon farm, caecum, gallus gallus, kingdom of spain, chicken, age 3 weeks, free range chicken2019-03-03v4No1 / 236
53amnon high in lima shantytown compared to el salado small village in feces homo sapiens city 2017-01-21v4No1 / 236
286amnoncommon in feces of individuals with kidney stones (common feces, homo sapiens, adult, nanning city prefecture, nephrolithiasis, china, sixth decade human stage)2018-01-27v4No1 / 239
406amnoncommon feces, zoological garden, gorilla gorilla, french republic, monkey, gorilla2018-11-21v4No1 / 239
108amnoncommon united states of america, research facility, caecum, mus musculus, state of texas, mouse2017-04-07v4No1 / 241
220amnoncommon feces, united states of america, female, research facility, mus musculus, balb/c, diet, high fat diet, mouse2017-10-24v4No1 / 241
483amnoncommon united states of america, research facility, hawaii, pearl harbor, hydroides elegans, tubeworm, shelled egg2019-02-13v4No1 / 243
622amnoncommon research facility, caecum, gallus gallus, chicken, great britain, liverpool, age 42 days2020-05-08v4No1 / 244
161amnoncommon in barn swallows in colorado (common feces, united states of america, state of colorado, hirundo rustica, barn swallow)2017-07-12v4No1 / 245
425amnon high in madagascar antananarivo compared to central african republic bangui in feces homo sapiens child africa 2018-12-08v4No1 / 248
781amnoncommon feces, kenya, wild, masai mara national park, madoqua kirkii, kirk's dik-dik2021-04-28v4No1 / 248
351amnoncommon united states of america, research facility, coelomic fluid, state of florida, eagle harbor, lytechinus variegatus, sea urchin2018-07-30v4No1 / 249
429amnoncommon feces, research facility, rattus norvegicus, dahl salt-sensitive, israel, rat, salt, salt rich diet2018-12-13v4No1 / 249
219amnoncommon in mother mice feces (common feces, female, research facility, mus musculus, c57bl/6, mouse, south korea)2017-10-24v4No1 / 250
837sheryoHigher at 100-300cm depth compared 0-40cm to in soil after 10 years reforestation with Black locust trees, shaanxi, China ( high in depth 100-300cm compared to depth 0-40cm in soil silt loam reforestation china shaanxi province loess plateau robinia pseudoacacia 10 years )2021-09-26v4No1 / 250
375amnonhigher in oil contaminated soil planted with plants compared to control oil contaminated soil ( high in rhizosphere planted soil compared to control in desert soil oil contaminated soil kuwait )2018-09-09v4No1 / 251
419amnoncommon feces, research facility, rattus norvegicus, sprague dawley, rat, china2018-12-02v4No1 / 254
214amnon high in diet high fat diet compared to mouse chow nih 31m chow in feces united states of america research facility mus musculus mouse 2017-10-23v4No1 / 255
503amnoncommon feces, research facility, mus musculus, balb/c, mouse, japan2019-03-12v4No1 / 257
220amnoncommon feces, united states of america, female, research facility, mus musculus, balb/c, diet, low fat diet, mouse, mouse chow2017-10-24v4No1 / 262
276amnoncommon feces, homo sapiens, adult, peru, small village, tunapuco, rural community2018-01-22v4No1 / 263
304amnoncommon united states of america, beach, air, aerosol, state of california, pacific ocean, monterey bay2018-03-12v4No1 / 263
49amnoncommon feces, giraffa camelopardalis2017-01-19v4No1 / 264
253amnoncommon in clouds in puy de dome mountain in france (common air, french republic, autumn, cloud)2017-11-22v4No1 / 267
759amnon high in state of alabama wild wild boar compared to farm pig state of vermont in feces united states of america sus scrofa 2021-04-04v4No1 / 268
78amnonhigher in older gazelles ( high in age old age compared to young age in feces tropical grassland biome kenya nanger granti gazelle )2017-03-01v4No1 / 273
406amnonhigher in captive white rhinoceros compared to wild ( high in zoological garden french republic compared to south africa wild in feces ceratotherium simum white rhinoceros bovidae )2018-11-21v4No1 / 277
160amnoncommon in river water upstream of WTP effluent in spring in china (common river, water, china, spring)2017-07-12v4No1 / 278
688amnoncommon feces, research facility, sus scrofa, nanchang city prefecture, pig, china, duroc pig, age 140 days2028-03-09v4No1 / 278
770amnoncommon feces, infant, macaca mulatta, age < 1 year, cayo santiago, puerto rico, rectal swab, indian rhesus macaque2021-04-19v4No1 / 280
225amnoncommon in polgA mutants (accelerated aging) (common feces, research facility, mus musculus, mouse, polga mutant, united kingdom)2017-10-29v4No1 / 281
286amnoncommon in feces of individuals without kidney stones (common feces, homo sapiens, control, adult, nanning city prefecture, china, sixth decade human stage)2018-01-27v4No1 / 281
384amnon high in hay barn compared to pasture in farm saliva equus caballus canada horse mouth 2018-10-22v4No1 / 283
586amnoncommon feces, research facility, rattus norvegicus, sprague dawley, israel, rat, fructose diet, fructose, male2020-02-09v4No1 / 287
495amnoncommon farm, caecum, gallus gallus, kingdom of spain, chicken, age 6 weeks, free range chicken2019-03-03v4No1 / 290
423amnoncommon skin, ukraine, bank vole, myodes glareolus2018-12-05v4No1 / 291
411amnoncommon feces, united states of america, zoological garden, papio anubis, monkey, olive baboon2018-11-23v4No1 / 292
237amnonlower in burrow soil compared to bird ( high in bird oceanodroma leucorhoa seabird compared to soil burrow in canada bon portage island )2017-11-07v4No1 / 298
419amnoncommon in rats with induced constipation (common feces, research facility, rattus norvegicus, sprague dawley, rat, constipation, china)2018-12-02v4No1 / 300
78amnon high in male compared to female in feces tropical grassland biome kenya nanger granti gazelle 2017-03-01v4No1 / 301
363amnoncommon dairy, ruminant reticulum, omasum, rumen, ovis aries, italy, obsolete_juvenile stage, age 30 days2018-08-29v4No1 / 302
615amnon high in soil compared to rhizosphere in brazil greenhouse campinas saccharum sugarcane 2020-04-27v4No1 / 306
80amnoncommon feces, state of florida, central america, alouatta palliata, mantled howler monkey2017-03-03v4No1 / 309
358amnoncommon feces, research facility, rattus, czech republic, rat, wistar rat2018-08-19v4No1 / 309
816amnoncommon feces, united states of america, pregnancy, research facility, sus scrofa, commonwealth of pennsylvania, pig, female organism, adult organism, early pregnancy2021-07-04v4No1 / 313
80amnon high in dry forest compared to tropical moist broadleaf forest biome in feces state of florida central america alouatta palliata mantled howler monkey 2017-03-03v4No1 / 314
208amnoncommon feces, united states of america, mus musculus, balb/c, state of texas, mouse2017-10-06v4No1 / 316
510amnoncommon estuary, water, fresh water, kingdom of spain, estuary water, salinity <5 ppt, bilbao2019-03-20v4No1 / 317
650amnon high in asian compared to caucasian european in feces homo sapiens united states of america adult state of new york 2020-09-12v4No1 / 317
299amnon high in mouth neoplasm cancer compared to control in homo sapiens saliva adult china 2018-02-27v4No1 / 319
756amnoncommon research facility, caecum, gallus gallus, canada, chicken, broiler chicken, lethbridge, age 35 days2021-03-22v4No1 / 321
801sheryoHigher at depth 60-90cm compared to depth 0-15cm in corn and soybean agriculture fields, Iowa USA ( high in depth (soil) 60-90cm compared to depth (soil) 0-15cm in soil zea mays glycine max iowa agricultural field united states des moines nicollet soil series kelley subsurface drainage )2021-06-16v4No1 / 321
515amnoncommon feces, bulgaria, balkan mountains, whole body, beetle, detritivorous beetle, onthophagus ovatus2019-04-18v4No1 / 322
518amnonhigher in beginning of experiment ( high in days 1-2 compared to days 14-28 in feces united states of america bos taurus state of georgia cow post-weaning angus steer )2019-06-11v4No1 / 325
429amnoncommon feces, research facility, rattus norvegicus, dahl salt-sensitive, israel, rat, control diet2018-12-13v4No1 / 327
61amnoncommon united states of america, research facility, skin, inguinal region, canis lupus familiaris2017-02-05v4No1 / 327
467amnoncommon feces, homo sapiens, metabolic syndrome, adult, kingdom of denmark2019-01-14v4No1 / 328
400amnonlower in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in myanmar karen compared to hmong china in feces homo sapiens thailand rural community )2018-11-18v4No1 / 329
111amnoncommon rectum, caecum, colon, ileum, ovis aries, mongolian sheep, china2017-04-09v4No1 / 330
433amnoncommon ocean, sea water, indian ocean, depth (water) 4m2018-12-19v4No1 / 333
423amnon high in human contact compared to no human contact chernobyl exclusion zone in skin ukraine bank vole myodes glareolus 2018-12-05v4No1 / 334
351amnoncommon in artificial sea water where sea urchins were grown (common united states of america, research facility, sea water, state of florida, lytechinus variegatus, sea urchin, artificial seawater)2018-07-30v4No1 / 338
649amnon high in ileum compared to colon in research facility ovis aries new zealand sheep lamb age 6 weeks 2020-09-07v3No1 / 338
124amnoncommon feces, united states of america, caecum, mus musculus, c57bl/6j, mouse2017-04-14v4No1 / 339
816amnoncommon feces, united states of america, pregnancy, research facility, sus scrofa, commonwealth of pennsylvania, pig, female organism, adult organism, late pregnancy2021-07-04v4No1 / 340
190amnon high in wet season compared to dry season in feces homo sapiens tanzania hunter gatherer hadza 2017-09-04v4No1 / 341
93amnoncommon in seawater near the shore in hawaii (common shore, sea water, hawaii)2017-03-12v4No1 / 345
254amnoncommon river, water, fresh water, fujian province, depth (soil) 50cm, jiulong river, china2017-11-23v4No1 / 347
620amnon high in gorilla gorilla compared to chimpanzee pan troglodytes troglodytes in feces wild republic of congo nouabale-ndoki national park 2020-05-06v4No1 / 351
792amnoncommon desert, rhizosphere, depth (soil) 50cm, china, minqin county, sand, nitraria tangutorum, ph 9, depth (soil) 20-60cm2021-06-07v4No1 / 352
254amnonhigher in river when close to populated region compared to downstream ( high in populated place city upstream compared to downstream in river water fresh water fujian province depth (soil) 50cm jiulong river china )2017-11-23v4No1 / 356
442amnoncommon in tnbs induced colitis in rat feces (common feces, research facility, rattus norvegicus, sprague dawley, male, rat, tnbs, colitis, china)2019-01-06v4No1 / 360
759amnoncommon feces, united states of america, sus scrofa, state of alabama, wild, wild boar2021-04-04v4No1 / 362
341amnonhigher in fresh drinking water compared to week old water ( high in fresh water compared to stagnant water in united states of america water drinking water tap water state of illinois )2018-05-28v4No1 / 365
620amnon high in wild republic of congo nouabale-ndoki national park compared to united states of america zoological garden in feces gorilla gorilla gorilla 2020-05-06v4No1 / 368
801sheryoHigher at depth 60-90cm compared to depth 0-15cm in corn agriculture fields, Iowa USA ( high in depth (soil) 60-90cm compared to depth (soil) 0-15cm in soil zea mays iowa agricultural field united states des moines nicollet soil series kanawha )2021-06-15v4No1 / 369
225amnoncommon in wild type cotrols (common feces, research facility, mus musculus, wild type genotype, mouse, united kingdom)2017-10-29v4No1 / 370
62amnoncommon feces, homo sapiens, united states of america, child, obsolete_juvenile stage2017-02-13v4No1 / 373
160amnoncommon in river water upstream of WTP effluent in autumn in china (common river, water, autumn, china)2017-07-12v4No1 / 376
400amnonhigher in people from thailand compared to 2nd generation immigrants to usa ( high in thailand rural community compared to united states of america in feces homo sapiens )2018-11-18v4No1 / 378
29amnon high in seed compared to seedling in brassica oleracea french republic 2016-12-05v4No1 / 379
458amnonlower in A/J strain compared to BALB/c and C57BL/6 strains ( high in balb/c c57bl/6 compared to a/j in feces united states of america female research facility mus musculus mouse )2019-01-11v4No1 / 379
256amnoncommon duodenum, jejunum, ileum, sus scrofa, pig, united kingdom2017-11-26v4No1 / 380
801sheryoHigher at depth 60-90cm compared to depth0-15cm in soybean and corn agriculture fields , Iowa USA ( high in depth (soil) 60-90cm compared to depth (soil) 0-15cm in soil zea mays glycine max iowa agricultural field united states ames des moines nicollet soil series )2021-06-15v4No1 / 386
582amnon high in rectum perianal skin compared to external acoustic meatus ear canal in united states of america wild santa catalina island urocyon littoralis urocyon littoralis catalinae santa catalina island fox 2020-01-22v4No1 / 400
781amnoncommon feces, kenya, wild, giraffe, masai mara national park, giraffa tippelskirchi2021-04-28v4No1 / 400
314amnoncommon farm, caecum, sus scrofa, tibet autonomous region, pig, cecal content, china2018-04-10v4No1 / 402
347amnoncommon permafrost, soil, kingdom of norway, svalbard archipelago, permafrost active layer, depth (soil) 0-20cm2018-07-15v4No1 / 405
558amnon high in gizzard compared to crop in united states of america state of wyoming bird centrocercus urophasianus greater sage-grouse 2019-09-20v4No1 / 408
625amnoncommon feces, united states of america, zoological garden, state of minnesota, pongo abelii, sumatran orangutan, como zoo2020-05-16v4No1 / 414
425amnon high in feces compared to duodenum in homo sapiens child africa 2018-12-08v4No1 / 416
781amnoncommon feces, kenya, wild, loxodonta africana, masai mara national park, elephant2021-04-28v4No1 / 419
515amnoncommon feces, bulgaria, balkan mountains, whole body, beetle, detritivorous beetle, aphodius pusillus2019-04-18v4No1 / 421
62amnoncommon feces, homo sapiens, child, egypt, obsolete_juvenile stage2017-02-13v4No1 / 422
781amnoncommon feces, kenya, wild, masai mara national park, eudorcas thomsonii, thomson's gazelle2021-04-28v4No1 / 425
792amnon high in soil compared to rhizosphere haloxylon ammodendron nitraria tangutorum in desert depth (soil) 50cm china minqin county sand ph 9 depth (soil) 20-60cm 2021-06-07v4No1 / 432
274amnoncommon feces, chlorocebus aethiops, ethiopia, monkey, grivet monkey2018-01-16v4No1 / 440
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in city wastewater treatment plant south america )2017-01-21v4No1 / 440
75amnoncommon feces, homo sapiens, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 442
371amnonhigher in amerindians compared to western visitors ( high in venezuela amerindian hunter gatherer compared to united states of america city in feces homo sapiens )2018-09-06v4No1 / 443
792amnoncommon desert, rhizosphere, depth (soil) 50cm, china, minqin county, sand, haloxylon ammodendron, ph 9, depth (soil) 20-60cm2021-06-07v4No1 / 443
274amnoncommon feces, chlorocebus aethiops, ethiopia, monkey, vervet monkey2018-01-16v4No1 / 446
702amnoncommon feces, united states of america, ovis aries, state of north carolina, sheep2028-04-02v4No1 / 450
399amnoncommon feces, united states of america, state of tennessee, zoological garden, ovis aries, sheep2018-11-16v4No1 / 451
424amnoncommon feces, farm, sus scrofa, jinhua city prefecture, pig, jinhua pig, china2018-12-06v4No1 / 452
470amnoncommon feces, female, pregnancy, farm, adult, sus scrofa, canada, province of quebec, pig2019-01-14v4No1 / 457
111amnon high in rectum caecum colon ileum compared to ruminant reticulum omasum rumen in ovis aries mongolian sheep china 2017-04-09v4No1 / 464
406amnoncommon feces, zoological garden, french republic, connochaetes taurinus, blue wildebeest2018-11-21v4No1 / 467
160amnoncommon in wastewater treatment plant effluent in autumn in china (common wastewater treatment plant, effluent, autumn, china)2017-07-12v4No1 / 469
276amnon high in peru small village tunapuco rural community compared to united states of america city state of oklahoma in feces homo sapiens adult 2018-01-22v4No1 / 469
221amnoncommon feces, research facility, sprague dawley, rattus, rat, china2017-10-25v4No1 / 470
406amnoncommon feces, zoological garden, french republic, ceratotherium simum, white rhinoceros2018-11-21v4No1 / 474
406amnoncommon feces, zoological garden, french republic, antidorcas marsupialis, springbok2018-11-21v4No1 / 477
454amnoncommon feces, wild, elaphurus davidianus, pere deer, deer, china2019-01-10v4No1 / 480
236amnoncommon ocean, zostera marina, state of california, bodega bay, marine eelgrass, root2017-11-07v4No1 / 483
438amnon high in adult 65-79 year-old human stage fourth decade human stage fifth decade human stage compared to child age 3-6 age 8-12 2-5 year-old child stage 6-12 year-old child stage in feces homo sapiens china 2018-12-30v4No1 / 486
274amnoncommon feces, ethiopia, monkey, chlorocebus djamdjamensis, bale monkey2018-01-16v4No1 / 489
256amnoncommon caecum, left colon, right colon, sus scrofa, pig, united kingdom2017-11-26v4No1 / 490
518amnoncommon feces, united states of america, bos taurus, state of georgia, cow, post-weaning, angus steer2019-06-11v4No1 / 498
781amnoncommon feces, kenya, wild, aepyceros melampus, impala, masai mara national park2021-04-28v4No1 / 510
748amnoncommon feces, united states of america, research facility, bos taurus, cow, female organism, state of mississippi, jersey cow2021-03-10v4No1 / 516
657amnoncommon research facility, rumen, ovis aries, qinghai province, rumen liquid, age < 1 year, sheep, lamb, china2020-09-13v4No1 / 517
304amnoncommon united states of america, beach, air, aerosol, state of california, pacific ocean, santa cruz province2018-03-12v4No1 / 518
27amnoncommon rumen, bos grunniens, china2016-12-05v4No1 / 532
209amnonlower in whale blow condensate compared to ocean water ( high in ocean sea water depth (water) 25cm compared to respiratory airway megaptera novaeangliae humpback whale exhaled air condensate whale blow in north america )2017-10-15v4No1 / 560
254amnon high in summer autumn wet season compared to winter dry season in river water fresh water fujian province depth (soil) 50cm jiulong river china 2017-11-23v4No1 / 571
160amnoncommon in wastewater treatment plant effluent in spring in china (common wastewater treatment plant, effluent, china, spring)2017-07-12v4No1 / 573
254amnon high in summer wet season compared to winter autumn dry season in river water fresh water fujian province depth (soil) 50cm jiulong river china 2017-11-23v4No1 / 581
84amnoncommon peatland, soil, sphagnum bog, peat soil, temperate grassland biome, depth 20cm, wetland area2017-03-06v4No1 / 590
633amnoncommon feces, thailand, captive, elephas maximus, asian elephant2020-06-16v4No1 / 591
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in estuary water kingdom of spain estuary water bilbao 2019-03-20v4No1 / 592
792amnoncommon desert, soil, depth (soil) 50cm, china, minqin county, sand, ph 9, depth (soil) 20-60cm2021-06-07v4No1 / 595
318amnoncommon ocean, vancouver, pacific ocean, canada, mastocarpus, red alga2018-04-16v4No1 / 598
801sheryoCommon at depth 15-30cm in corn agriculture fields, Iowa USA (common soil, zea mays, iowa, agricultural field, united states, des moines, ph 7.7, nicollet soil series, depth (soil) 15-30cm, kanawha)2021-06-15v4No1 / 598
406amnoncommon feces, united states of america, zoological garden, switzerland, diceros bicornis, black rhinoceros2018-11-21v4No1 / 600
517amnon high in feces compared to arm skin forearm in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 606
265amnonhigher in tree leaves compared to soil and soilwater ( high in leaf tree compared to soil water soilwater in canada province of quebec )2017-12-11v4No1 / 610
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age >94 65-79 year-old human stage fourth decade human stage fifth decade human stage ninth decade human stage tenth decade human stage compared to soldiers young adult stage in feces homo sapiens china )2018-12-30v4No1 / 617
264amnoncommon research facility, caecum, oryctolagus cuniculus, rex rabbit, jiangsu province, china2017-12-11v4No1 / 622
781amnoncommon feces, kenya, wild, masai mara national park, damaliscus lunatus, tsessebe2021-04-28v4No1 / 622
458amnonhigher in mice from hsd compared to jackson laboratories ( high in harlan sprague dawley compared to jackson laboratories in feces united states of america female research facility mus musculus mouse )2019-01-11v4No1 / 644
800amnonhigher at 100-250 days compared to 7-28 days following heavy metal contamination ( high in summer autumn compared to spring in lake sediment fresh water heavy metal reservoir china xiannv lake sediment depth 0-10cm )2021-06-15v4No1 / 644
801sheryoCommon in soybean and corn agriculture fields at depth 60-90cm, Iowa USA (common soil, zea mays, glycine max, iowa, agricultural field, united states, ames, des moines, ph 7.7, nicollet soil series, depth (soil) 60-90cm)2021-06-15v4No1 / 650
443amnonhigher in lower mississippi river (downstream) compared to upper mississippi river ( high in downstream lower mississippi river compared to upstream higher mississippi river in united states of america river water fresh water mississippi river free floating depth (water) 1m filtered 0.2um )2019-01-07v4No1 / 652
103amnonlower in particle bound fraction compared to free floating bacteria in mississippi river ( high in free floating compared to particles in united states of america river aquatic biome fresh water mississippi river )2017-04-05v4No1 / 653
781amnoncommon feces, kenya, wild, masai mara national park, tragelaphus oryx, eland2021-04-28v4No1 / 666
801sheryoCommon at depth 60-90cm in corn and soybean agriculture fields, Iowa USA (common soil, zea mays, glycine max, iowa, agricultural field, united states, des moines, ph 7.9, nicollet soil series, depth (soil) 60-90cm, kelley, subsurface drainage)2021-06-16v4No1 / 667
25amnoncommon research facility, caecum, oryctolagus cuniculus, rex rabbit, sichuan province2016-12-01v4No1 / 669
406amnoncommon feces, south africa, antidorcas marsupialis, springbok2018-11-21v4No1 / 678
347amnoncommon permafrost, soil, kingdom of norway, svalbard archipelago, depth (soil) 20-30cm2018-07-15v4No1 / 698
801sheryoCommon at depth 30-60cm in corn agriculture fields, Iowa USA (common soil, zea mays, iowa, agricultural field, united states, des moines, depth (soil) 30-60cm, nicollet soil series, kanawha, ph 8.1)2021-06-15v4No1 / 703
809amnoncommon research facility, rhizosphere, greenhouse, china, lu'an city prefecture, dendrobium officinale, flowerpot2021-06-20v4No1 / 715
821sheryoComoon in soil of miscanthus field at 50-100cm depth, Michigan USA (common united states of america, soil, state of michigan, depth 50-100m, miscanthus, kalamazoo loam, mesic type hapludalf, kellogg biological station, restored prairie)2021-08-02v4No1 / 726
821sheryoCommon in soil of restored prairie at 50-100cm depth, Michigan USA (common united states of america, soil, state of michigan, depth 50-100m, kalamazoo loam, mesic type hapludalf, kellogg biological station, restored prairie)2021-07-28v4No1 / 744
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 752
801sheryoCommon at depth 30-60cm in corn and soybean agriculture fields, Iowa USA (common soil, zea mays, glycine max, iowa, agricultural field, united states, des moines, ph 6.7, depth (soil) 30-60cm, nicollet soil series, kelley, subsurface drainage)2021-06-15v4No1 / 760
801sheryoCommon at depth 60-90cm in corn agriculture fields, Iowa USA (common soil, zea mays, iowa, agricultural field, united states, des moines, nicollet soil series, depth (soil) 60-90cm, kanawha, ph 8.3)2021-06-15v4No1 / 764
206amnoncommon in air from israel particles <10um size (common air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 765
157amnoncommon in naers of weened calves (common united states of america, nasal cavity, pair of nares, juvenile organism, bos taurus, calve)2017-07-04v4No1 / 766
821sheryoCommon in soil of continuous corn field at 50-100cm depth, Michigan USA (common united states of america, soil, state of michigan, corn, depth 50-100m, continuous corn, kalamazoo loam, mesic type hapludalf, kellogg biological station)2021-07-28v4No1 / 769
454amnon high in summer compared to winter in feces elaphurus davidianus pere deer deer china 2019-01-10v4No1 / 791
824sheryoHigher at 0-10cm depth compared to 10-20cm depth in soil after grazing exclusion at 0-10cm depth, Ningxia china ( high in depth (soil) 0-10cm compared to depth 10-20cm in soil china grazing exclusion haplic calcisol calci-orthic aridisol ningxia province yunwushan national natural grassland protection zone )2021-08-08v4No1 / 807
801sheryoCommon in soybean and corn agriculture fields at depth 30-60cm, Iowa USA (common soil, zea mays, glycine max, iowa, agricultural field, united states, ames, des moines, depth (soil) 30-60cm, nicollet soil series, ph 7.4)2021-06-15v4No1 / 839
801sheryoCommon at depth 15-30cm in corn and soybean agriculture fields, Iowa USA (common soil, zea mays, glycine max, iowa, ph 6, agricultural field, united states, des moines, nicollet soil series, depth (soil) 15-30cm, kelley, subsurface drainage)2021-06-15v4No1 / 841
632amnoncommon feces, united states of america, research facility, adult, equus caballus, state of texas, horse2020-06-10v4No1 / 848
371amnonhigher in skin of amerindians compared to western visitors ( high in venezuela amerindian hunter gatherer compared to united states of america city in homo sapiens skin )2018-09-06v4No1 / 854
801sheryoCommon at depth 0-15cm in corn agriculture fields, Iowa USA (common soil, zea mays, iowa, agricultural field, united states, des moines, depth (soil) 0-15cm, nicollet soil series, ph 7.1, kanawha)2021-06-15v4No1 / 862
767sheryoCommon in soil planted with Chrysanthemum, fertilized with bio-organic fertilizer in Nanjing China (common soil, compost biofilter, compost, pig manure, paenibacillus, china, nanjing county, chrysanthemum, bio-organic fertilizer, chrysanthemum morifolium ramat., ph 6.9, paenibacillus polymyxa)2021-04-14v4No1 / 866
821sheryoCommon in soil of switchgrass field at 50-100cm depth, Michigan USA (common united states of america, soil, state of michigan, depth 50-100m, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station)2021-08-03v4No1 / 872
767sheryoCommon in soil planted with Chrysanthemum, fertilized with bio-organic fertilizer and amended with soil fumigant 'Dazomet' in Nanjing China (common soil, compost biofilter, pig manure, compost soil, paenibacillus, china, nanjing county, chrysanthemum, bio-organic fertilizer, chrysanthemum morifolium ramat., ph 6.9, paenibacillus polymyxa, soil fumigation, dazomet)2021-04-14v4No1 / 875
479amnoncommon united states of america, rhizosphere, state of california, ph 6-7, ceanothus jepsonii2019-02-05v4No1 / 900
206amnoncommon in dust storm air from israel particles <10um size (common air, dust, israel, size < 10um, dust storm)2017-10-04v4No1 / 902
801sheryoCommon in soybean and corn agriculture fields at depth 15-30cm, Iowa USA (common soil, zea mays, glycine max, iowa, agricultural field, united states, ames, des moines, nicollet soil series, depth (soil) 15-30cm, ph 7.4)2021-06-15v4No1 / 905
103amnoncommon united states of america, river, aquatic biome, fresh water, mississippi river, particles2017-04-05v4No1 / 909
103amnoncommon united states of america, river, aquatic biome, fresh water, mississippi river, free floating2017-04-05v4No1 / 909
632amnoncommon united states of america, research facility, caecum, adult, equus caballus, state of texas, cecal content, horse2020-06-10v4No1 / 914
359amnoncommon soil, subtropical broadleaf forest biome, topsoil, guangdong province, depth (soil) 0-10cm, woodland area, forest ecosystem, china2018-08-19v4No1 / 935
767sheryoCommon in soil planted with Chrysanthemum, amended with soil fumigant 'Dazomet' in Nanjing China (common soil, china, nanjing county, chrysanthemum, chrysanthemum morifolium ramat., ph 6.9, soil fumigation, dazomet)2021-04-14v4No1 / 946
821sheryoCommon in soil of continuous corn field at 25-50cm depth, Michigan USA (common united states of america, soil, state of michigan, corn, continuous corn, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth (soil) 25-50cm)2021-07-28v4No1 / 963
624sheryoCommon in ryegrass rhizosphere soil after 30-40 days (common soil, rhizosphere, 10 cm depth, jiangsu province, ph 7-8, china, ryegrass, days 30-40)2020-05-11v4No1 / 966
821sheryoCommon in soil of restored prairie at 25-50cm depth, Michigan USA (common united states of america, soil, state of michigan, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth (soil) 25-50cm, restored prairie)2021-07-28v4No1 / 968
821sheryoCommon in soil of switchgrass field at 25-50cm depth, Michigan USA (common united states of america, soil, state of michigan, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth (soil) 25-50cm)2021-08-03v4No1 / 974
821sheryoCommon in soil of switchgrass field at 25-50cm depth, Michigan USA (common united states of america, soil, state of michigan, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth (soil) 25-50cm)2021-08-03v4No1 / 974
809amnoncommon research facility, rhizosphere, greenhouse, china, lu'an city prefecture, dendrobium moniliforme, flowerpot2021-06-20v4No1 / 1002
479amnoncommon united states of america, rhizosphere, state of california, ph 6-7, heteromeles arbutifolia2019-02-05v4No1 / 1006
517amnon high in arm skin forearm compared to mouth mucosa mouth in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 1014
624sheryocommon in ryegrass rhizosphere soil amended with biochar after 30-40 days (common soil, rhizosphere, 10 cm depth, jiangsu province, ph 7-8, biochar, china, ryegrass, days 30-40)2020-05-11v4No1 / 1017
83amnon high in control diet normal diet compared to restricted diet in rumen bos taurus ireland holstein-friesian bull 2017-03-05v4No1 / 1023
406amnoncommon feces, zoological garden, french republic, hippotragus niger, sable antelope2018-11-21v4No1 / 1075
252amnoncommon in river rock biofilm (common river, rock, biofilm, kingdom of spain, epilithic)2017-11-22v4No1 / 1081
478amnoncommon farm, sediment, shrimp farm, china2019-02-19v4No1 / 1085
454amnon high in wild compared to captive in feces elaphurus davidianus pere deer deer china 2019-01-10v4No1 / 1094
767sheryocommon in soil planted with Chrysanthemum, fertilized with bio-organic fertilizer, amended with soil fumigant 'Dazomet' and deep plough in Nanjing China (common soil, compost biofilter, pig manure, compost soil, paenibacillus, china, nanjing county, chrysanthemum, bio-organic fertilizer, conventional tillage, chrysanthemum morifolium ramat., ph 6.9, paenibacillus polymyxa, soil fumigation, dazomet, deep plough)2021-04-18v4No1 / 1109
93amnoncommon in marine sediment near the shore in hawaii (common shore, marine sediment, hawaii)2017-03-12v4No1 / 1151
571amnoncommon mangrove swamp, soil, marine sediment, spartina alterniflora, china, hainan autonomous prefecture, danzhou xinyinggang nature reserve, depth (soil) 0-20cm2019-12-16v4No1 / 1169
266amnon high in leaf compared to root in united states of america state of idaho plant brassicaceae boechera stricta 2017-12-19v4No1 / 1175
252amnoncommon in river sand biofilm (common river, biofilm, sand, kingdom of spain)2017-11-22v4No1 / 1181
801sheryoCommon at depth 0-15cm in corn and soybean agriculture fields, Iowa USA (common soil, zea mays, glycine max, iowa, agricultural field, united states, des moines, depth (soil) 0-15cm, nicollet soil series, kelley, ph 6.2, subsurface drainage)2021-06-15v4No1 / 1202
571amnoncommon mangrove swamp, soil, marine sediment, mangrove, china, hainan autonomous prefecture, rhizophora stylosa, danzhou xinyinggang nature reserve, depth (soil) 0-20cm2019-12-16v4No1 / 1210
801sheryoCommon in soybean and corn agriculture fields at depth 0-15cm, Iowa USA (common soil, zea mays, glycine max, iowa, agricultural field, united states, ames, des moines, ph 7.5, depth (soil) 0-15cm, nicollet soil series)2021-06-15v4No1 / 1226
821sheryoCommon in soil of restored prairie at 10-25cm depth, Michigan USA (common united states of america, soil, state of michigan, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth (soil) 10-25cm, restored prairie)2021-07-28v4No1 / 1241
649amnon high in colon compared to duodenum jejunum in research facility ovis aries new zealand sheep lamb age 6 weeks 2020-09-07v3No1 / 1261
821sheryoCommon in soil of restored prairie at 0-10cm depth, Michigan USA (common united states of america, soil, state of michigan, depth (soil) 0-10cm, ph 6.5, kalamazoo loam, mesic type hapludalf, kellogg biological station, restored prairie)2021-07-28v4No1 / 1291
223amnoncommon ocean, sediment, marine sediment, east china sea, china2017-10-26v4No1 / 1311
783sheryocommon in desert soil in mongolia without water addition treatment (common soil, mongolia, sandy desert, bajada, china, dengkou county, ph 7.85, ulan buh desert, cambic arenosols, luvic gypsisols, ambient precipitation, no water addition)2021-05-11v4No1 / 1324
571amnoncommon mangrove swamp, soil, marine sediment, mangrove, china, hainan autonomous prefecture, kandelia candel, dongzhaigang national nature reserve, depth (soil) 0-20cm2019-12-16v4No1 / 1351
809amnoncommon research facility, rhizosphere, greenhouse, china, lu'an city prefecture, dendrobium huoshanense, flowerpot2021-06-20v4No1 / 1356
821sheryoCommon in soil of miscanthus field at 10-25cm depth, Michigan USA (common united states of america, soil, state of michigan, miscanthus, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth (soil) 10-25cm, restored prairie)2021-08-02v4No1 / 1377
821sheryoCommon in soil of switchgrass field at 10-25cm depth, Michigan USA (common united states of america, soil, state of michigan, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth (soil) 10-25cm)2021-08-02v4No1 / 1387
40amnoncommon soil, field soil, rhizosphere, nicotiana tabacum, china2016-12-09v4No1 / 1420
571amnoncommon mangrove swamp, soil, marine sediment, mudflat, china, hainan autonomous prefecture, dongzhaigang national nature reserve, depth (soil) 0-20cm2019-12-16v4No1 / 1422
571amnoncommon mangrove swamp, soil, marine sediment, zhejiang province, mangrove, china, kandelia candel, futian national nature reserve, depth (soil) 0-20cm2019-12-16v4No1 / 1435
571amnoncommon mangrove swamp, soil, marine sediment, spartina alterniflora, guangdong province, china, leizhou nature reserve, depth (soil) 0-20cm2019-12-16v4No1 / 1437
76amnoncommon in seleniferous soil (common united states of america, soil, rhizosphere, selenium, seleniferous, woodland area)2017-02-28v4No1 / 1438
271amnoncommon rhizosphere, glycine max, soybean, china, depth (soil) 0-20cm2018-01-09v4No1 / 1459
571amnoncommon mangrove swamp, soil, marine sediment, guangdong province, mangrove, china, kandelia candel, leizhou nature reserve, depth (soil) 0-20cm2019-12-16v4No1 / 1523
515amnon high in bulgaria detritivorous beetle compared to poland herbivorous beetle in whole body beetle 2019-04-19v4No1 / 1543
571amnoncommon mangrove swamp, soil, marine sediment, zhejiang province, mudflat, china, futian national nature reserve, depth (soil) 0-20cm2019-12-16v4No1 / 1587
571amnoncommon mangrove swamp, soil, marine sediment, guangdong province, mangrove, china, kandelia candel, shenzhen futian national nature reserve, depth (soil) 0-20cm2019-12-16v4No1 / 1593
571amnoncommon mangrove swamp, soil, marine sediment, zhejiang province, mangrove, china, kandelia candel, ximendao national marine reserve, depth (soil) 0-20cm2019-12-16v4No1 / 1636
571amnoncommon mangrove swamp, soil, marine sediment, guangdong province, mudflat, china, shenzhen futian national nature reserve, depth (soil) 0-20cm2019-12-16v4No1 / 1649
821sheryoCommon in soil of continuous corn field at 10-25cm depth, Michigan USA (common united states of america, soil, state of michigan, corn, continuous corn, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth (soil) 10-25cm)2021-07-28v4No1 / 1649
824sheryoCommon in soil after 27-35 years of grazing exclusion at 0-10cm depth, Ningxia china (common soil, depth (soil) 0-10cm, china, grazing exclusion, 27-35 years of grazing exclusion, haplic calcisol, calci-orthic aridisol, ningxia province, yunwushan national natural grassland protection zone)2021-08-08v4No1 / 1659
571amnoncommon mangrove swamp, soil, marine sediment, spartina alterniflora, zhejiang province, china, ximendao national marine reserve, depth (soil) 0-20cm2019-12-16v4No1 / 1668
571amnoncommon mangrove swamp, soil, marine sediment, spartina alterniflora, zhejiang province, china, futian national nature reserve, depth (soil) 0-20cm2019-12-16v4No1 / 1747
304amnoncommon united states of america, beach, sand, state of california, pacific ocean, santa cruz province2018-03-12v4No1 / 1838
155amnoncommon in soil tightly bound to wheat root (common soil, triticum aestivum, wheat, root, china)2017-07-02v4No1 / 1977
821sheryoCommon in soil of switchgrass field at 0-10cm depth, Michigan USA (common united states of america, soil, state of michigan, depth (soil) 0-10cm, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station)2021-08-02v4No1 / 2067
175amnoncommon in heavy metal contaminated soils in china (common soil, heavy metal, ph 7-9, china)2017-07-29v4No1 / 2133
296amnoncommon agricultural feature, soil, winter, wheat, north china plain, ph>6, ph<7, china, depth (soil) 0-20cm2018-02-11v4No1 / 2223
296amnoncommon in wheat field soil (common agricultural feature, soil, winter, depth 5cm, wheat, north china plain, china)2018-02-11v4No1 / 2341
155amnoncommon in soil loosely bound to wheat root (common soil, rhizosphere, triticum aestivum, wheat, china)2017-07-02v4No1 / 2425
748amnon high in feces compared to rumen ruminal fluid in united states of america research facility bos taurus cow female organism state of mississippi 2021-03-10v4No1 / 2467
155amnoncommon in bulk soil in wheat field (common soil, bulk soil, triticum aestivum, wheat, china)2017-07-02v4No1 / 2594
296amnoncommon agricultural feature, soil, winter, wheat, north china plain, ph>8, china, depth (soil) 0-20cm2018-02-11v4No1 / 2646
265amnon high in soil compared to water soilwater in canada province of quebec 2017-12-11v4No1 / 2715
271amnoncommon soil, china, depth (soil) 0-20cm2018-01-09v4No1 / 2856
84amnoncommon fen, soil, peat soil, temperate grassland biome, flooded grassland biome, depth 20cm, united kingdom2017-03-06v4No1 / 2866
84amnoncommon fen, soil, peat soil, temperate grassland biome, flooded grassland biome, depth 5cm, united kingdom2017-03-07v4No1 / 3434
296amnoncommon agricultural feature, soil, winter, wheat, north china plain, ph>5, ph<6, china, depth (soil) 0-20cm2018-02-11v4No1 / 3508
837sheryoHigher in soil after 10 years compared to 20 years of reforestation with Black locust trees, shaanxi, China ( high in 10 years compared to 20 years in soil silt loam reforestation china shaanxi province loess plateau robinia pseudoacacia )2021-09-27v4No1 / 3585
837sheryoHigher in soil after 10 years reforestation with Black locust trees compared to agricultural feild, shaanxi, China ( high in reforestation robinia pseudoacacia 10 years compared to zea mays wheat agricultural field in soil silt loam china shaanxi province loess plateau )2021-09-26v4No1 / 3932
837sheryoHigher in soil after 30 years compared to 20 years of reforestation with Black locust trees, shaanxi, China ( high in 30 years compared to 20 years in soil silt loam reforestation china shaanxi province loess plateau robinia pseudoacacia )2021-09-27v4No1 / 3936
271amnon high in soil compared to rhizosphere glycine max soybean in china depth (soil) 0-20cm 2018-01-09v4No1 / 4853
837sheryoHigher in soil after 30 years compared to 10 years of reforestation with Black locust trees, shaanxi, China ( high in 30 years compared to 10 years in soil silt loam reforestation china shaanxi province loess plateau robinia pseudoacacia )2021-09-27v4No1 / 5245
837sheryoHigher in soil after 30 years reforestation with Black locust trees compared to agricultural feild, shaanxi, China ( high in reforestation robinia pseudoacacia 30 years compared to zea mays triticum aestivum agricultural field in soil silt loam china shaanxi province loess plateau )2021-09-27v4No1 / 5596
837sheryoHigher in soil after 20 years reforestation with Black locust trees compared agricultural feild, shaanxi, China ( high in reforestation robinia pseudoacacia 20 years compared to zea mays triticum aestivum agricultural field in soil silt loam china shaanxi province loess plateau )2021-09-26v4No1 / 5661
171amnonlower in roots compared to rhizosphere soil in rice ( high in soil rhizosphere compared to root in united states of america oryza sativa state of california rice )2017-07-25v4No1 / 7628

Problems / suggestions? Please email info AT dbbact DOT org