Search result for sequence:
TACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTTGGATGTGAAATCCCCGGGCTTAACCTGGGAACTGCATCCAAGACTGGCAAGCTAGAGTCTCGTAGAGGGAGGTAGAATTCCAGG
common ontology terms
term enrichment score
TermScore
snake farm0.608696
adula0.608696
snake0.466667
elaphe carinata0.307692
king ratsnake0.307692
isla de salvora0.307692
age 8 days0.307692
larus michahellis0.307692
gull0.307692
naja atra0.307692
chinese cobra0.307692
ptyas mucosa0.307692
oriental ratsnake0.307692
hunan province0.274510
deinagkistrodon acutus0.181818
pit viper0.181818
bird0.173913
kingdom of spain0.129032
farm0.082353
china0.021672
feces0.018957
Fraction of dbbact annotations with this term covered by the query
TermScore
snake farm0.500000
adula0.500000
elaphe carinata0.500000
king ratsnake0.500000
isla de salvora0.500000
age 8 days0.500000
larus michahellis0.500000
gull0.500000
naja atra0.500000
chinese cobra0.500000
ptyas mucosa0.500000
oriental ratsnake0.500000
deinagkistrodon acutus0.500000
pit viper0.500000
snake0.333333
hunan province0.166667
bird0.142857
kingdom of spain0.090909
farm0.043478
china0.010989
feces0.009569
Fraction of annotations for the query sequences containing the term
TermScore
feces1.000000
snake0.777778
snake farm0.777778
farm0.777778
adula0.777778
hunan province0.777778
china0.777778
elaphe carinata0.222222
king ratsnake0.222222
bird0.222222
isla de salvora0.222222
kingdom of spain0.222222
age 8 days0.222222
larus michahellis0.222222
gull0.222222
naja atra0.222222
chinese cobra0.222222
ptyas mucosa0.222222
oriental ratsnake0.222222
deinagkistrodon acutus0.111111
pit viper0.111111

Problems / suggestions? Please email info AT dbbact DOT org