Search result for sequence:
TACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTTGGATGTGAAATCCCCGGGCTTAACCTGGGAACTGCATCCAAGACTGGCAAGCTAGAGTCTCGTAGAGGGAGGTAGAATTCCAGG
common ontology terms
term enrichment score
TermScore
snake farm0.538462
adula0.538462
snake0.424242
bird0.266667
hunan province0.259259
elaphe carinata0.250000
king ratsnake0.250000
isla de salvora0.250000
age 8 days0.250000
larus michahellis0.250000
gull0.250000
naja atra0.250000
chinese cobra0.250000
ptyas mucosa0.250000
oriental ratsnake0.250000
california condor0.250000
gymnogyps californianus0.250000
state of idaho0.222222
cloaca0.166667
deinagkistrodon acutus0.142857
pit viper0.142857
maojian district0.142857
age 3 years0.142857
chinese giant salamander0.142857
andrias davidianus0.142857
farm0.125000
captive0.117647
kingdom of spain0.080000
LOWER IN feces0.064516
intestine0.060606
china0.032000
feces0.014724
Fraction of dbbact annotations with this term covered by the query
TermScore
snake farm0.500000
adula0.500000
elaphe carinata0.500000
king ratsnake0.500000
isla de salvora0.500000
age 8 days0.500000
larus michahellis0.500000
gull0.500000
naja atra0.500000
chinese cobra0.500000
ptyas mucosa0.500000
oriental ratsnake0.500000
california condor0.500000
gymnogyps californianus0.500000
deinagkistrodon acutus0.500000
pit viper0.500000
maojian district0.500000
age 3 years0.500000
chinese giant salamander0.500000
andrias davidianus0.500000
snake0.333333
state of idaho0.333333
bird0.222222
hunan province0.166667
cloaca0.166667
captive0.090909
farm0.068966
kingdom of spain0.052632
LOWER IN feces0.052632
intestine0.047619
china0.016393
feces0.007435
Fraction of annotations for the query sequences containing the term
TermScore
feces0.750000
farm0.666667
china0.666667
snake0.583333
snake farm0.583333
adula0.583333
hunan province0.583333
bird0.333333
elaphe carinata0.166667
king ratsnake0.166667
isla de salvora0.166667
kingdom of spain0.166667
age 8 days0.166667
larus michahellis0.166667
gull0.166667
naja atra0.166667
chinese cobra0.166667
ptyas mucosa0.166667
oriental ratsnake0.166667
cloaca0.166667
state of idaho0.166667
captive0.166667
california condor0.166667
gymnogyps californianus0.166667
LOWER IN feces0.083333
deinagkistrodon acutus0.083333
pit viper0.083333
maojian district0.083333
age 3 years0.083333
chinese giant salamander0.083333
andrias davidianus0.083333
intestine0.083333
Exp. ID User ID Description Date Region Flag Sequences
530amnondominant snake, feces, snake farm, farm, adula, hunan province, elaphe carinata, king ratsnake, china2019-07-21v4No1 / 2
381amnoncommon bird, isla de salvora, kingdom of spain, age 8 days, feces, larus michahellis, gull2018-10-22v4No1 / 4
530amnondominant snake, feces, snake farm, farm, adula, hunan province, naja atra, chinese cobra, china2019-07-21v4No1 / 5
530amnondominant snake, feces, snake farm, farm, adula, hunan province, ptyas mucosa, oriental ratsnake, china2019-07-21v4No1 / 6
381amnondominant bird, isla de salvora, kingdom of spain, age 8 days, feces, larus michahellis, gull2018-10-22v4No1 / 9
530amnoncommon snake, feces, snake farm, farm, adula, hunan province, elaphe carinata, king ratsnake, china2019-07-21v4No1 / 55
645amnon high in cloaca compared to feces in state of idaho captive california condor gymnogyps californianus bird 2020-09-03v4No1 / 63
530amnoncommon snake, feces, snake farm, farm, adula, hunan province, ptyas mucosa, oriental ratsnake, china2019-07-21v4No1 / 78
530amnoncommon snake, feces, snake farm, farm, adula, hunan province, naja atra, chinese cobra, china2019-07-21v4No1 / 82
645amnoncommon cloaca, state of idaho, captive, california condor, gymnogyps californianus, bird2020-09-03v4No1 / 91
530amnoncommon snake, deinagkistrodon acutus, pit viper, feces, snake farm, farm, adula, hunan province, china2019-07-21v4No1 / 170
661amnoncommon farm, maojian district, age 3 years, china, chinese giant salamander, andrias davidianus, intestine2020-09-20v4No1 / 178

Problems / suggestions? Please email info AT dbbact DOT org