Search result for sequence:
TACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGCGGCTTGGTAAGTCGGATGTGAAAGCCCAGGGCTTAACCTTGGAATTGCATTCGATACTGCCTGGCTAGAGTATGGTAGAGGGAAGTGGAATTTCCGG
common ontology terms
Fraction of dbbact annotations with this term covered by the query
TermScore
mangrove swamp0.500000
leizhou nature reserve0.500000
kandelia candel0.500000
futian national nature reserve0.500000
mudflat0.500000
ximendao national marine reserve0.500000
east china sea0.500000
sanmen bay0.500000
LOWER IN other regions0.500000
nan'ao island0.500000
danzhou xinyinggang nature reserve0.500000
dongzhaigang national nature reserve0.500000
shenzhen futian national nature reserve0.500000
guangdong province0.333333
mangrove0.333333
spartina alterniflora0.333333
hainan autonomous prefecture0.333333
marine sediment0.214286
zhejiang province0.166667
depth 0-20cm0.142857
LOWER IN sea water0.142857
LOWER IN water0.090909
sediment0.086957
ocean0.062500
china0.038095
rhizosphere0.031250
soil0.016129
Fraction of annotations for the query sequences containing the term
TermScore
china1.000000
marine sediment0.952381
mangrove swamp0.809524
soil0.761905
depth 0-20cm0.761905
mangrove0.333333
kandelia candel0.333333
zhejiang province0.333333
guangdong province0.285714
spartina alterniflora0.238095
leizhou nature reserve0.190476
futian national nature reserve0.190476
mudflat0.190476
sediment0.190476
ximendao national marine reserve0.142857
hainan autonomous prefecture0.142857
ocean0.095238
east china sea0.095238
nan'ao island0.095238
dongzhaigang national nature reserve0.095238
shenzhen futian national nature reserve0.095238
sanmen bay0.047619
LOWER IN other regions0.047619
LOWER IN water0.047619
LOWER IN sea water0.047619
danzhou xinyinggang nature reserve0.047619
rhizosphere0.047619
Exp. ID User ID Description Date Region Flag Sequences
571amnondominant china, soil, mangrove swamp, marine sediment, depth 0-20cm, guangdong province, leizhou nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 3
571amnondominant china, soil, mangrove swamp, marine sediment, depth 0-20cm, guangdong province, leizhou nature reserve, spartina alterniflora2019-12-16v4No1 / 4
571amnondominant china, soil, mangrove swamp, marine sediment, depth 0-20cm, zhejiang province, futian national nature reserve, mudflat2019-12-16v4No1 / 4
571amnondominant china, soil, mangrove swamp, marine sediment, depth 0-20cm, mangrove, kandelia candel, ximendao national marine reserve, zhejiang province2019-12-16v4No1 / 6
223amnon high in sanmen bay compared to other regions in sediment marine sediment ocean east china sea china 2017-10-26v4No1 / 110
504amnon high in sediment marine sediment compared to water sea water in nan'ao island china 2019-03-14v4No1 / 395
504amnoncommon nan'ao island, sediment, marine sediment, china2019-03-14v4No1 / 437
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, spartina alterniflora, hainan autonomous prefecture, danzhou xinyinggang nature reserve2019-12-16v4No1 / 1169
223amnoncommon ocean, sediment, east china sea, marine sediment, china2017-10-26v4No1 / 1311
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, mangrove, kandelia candel, hainan autonomous prefecture, dongzhaigang national nature reserve2019-12-16v4No1 / 1351
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, hainan autonomous prefecture, dongzhaigang national nature reserve, mudflat2019-12-16v4No1 / 1422
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, zhejiang province, futian national nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 1435
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, guangdong province, leizhou nature reserve, spartina alterniflora2019-12-16v4No1 / 1437
34amnoncommon in mangrove rhizosphere (common mangrove swamp, rhizosphere, china)2016-12-06v4No1 / 1473
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, guangdong province, leizhou nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 1523
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, zhejiang province, futian national nature reserve, mudflat2019-12-16v4No1 / 1587
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, guangdong province, shenzhen futian national nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 1593
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, mangrove, kandelia candel, ximendao national marine reserve, zhejiang province2019-12-16v4No1 / 1636
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, mudflat, guangdong province, shenzhen futian national nature reserve2019-12-16v4No1 / 1649
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, ximendao national marine reserve, zhejiang province, spartina alterniflora2019-12-16v4No1 / 1668
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, zhejiang province, spartina alterniflora, futian national nature reserve2019-12-16v4No1 / 1747

Problems / suggestions? Please email info AT dbbact DOT org