Search result for sequence:
TACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGCGGCTTGGTCAGTCGGATGTGAAAGCCCCGGGCTCAACCTGGGAATTGCATTCGATACTGCCGAACTAGAGTATGGGAGAGGGAAGTGGAATTTCCGG
common ontology terms
term enrichment score
TermScore
nan'ao island0.444444
leizhou nature reserve0.444444
mangrove biome0.444444
guangdong province0.363636
marine sediment0.352941
mangrove swamp0.307692
east china sea0.285714
yushan islands0.285714
LOWER IN other regions0.285714
kandelia candel0.285714
depth 0-20cm0.266667
spartina alterniflora0.250000
mangrove0.250000
LOWER IN sea water0.166667
sediment0.151899
LOWER IN water0.125000
ocean0.095238
china0.060606
soil0.035398
Fraction of dbbact annotations with this term covered by the query
TermScore
nan'ao island0.500000
east china sea0.500000
yushan islands0.500000
LOWER IN other regions0.500000
leizhou nature reserve0.500000
mangrove biome0.500000
kandelia candel0.500000
spartina alterniflora0.333333
guangdong province0.333333
mangrove0.333333
mangrove swamp0.250000
marine sediment0.214286
depth 0-20cm0.200000
LOWER IN sea water0.142857
LOWER IN water0.090909
sediment0.086957
ocean0.062500
china0.031250
soil0.018519
Fraction of annotations for the query sequences containing the term
TermScore
marine sediment1.000000
china1.000000
sediment0.600000
nan'ao island0.400000
leizhou nature reserve0.400000
guangdong province0.400000
mangrove biome0.400000
depth 0-20cm0.400000
mangrove swamp0.400000
soil0.400000
LOWER IN water0.200000
LOWER IN sea water0.200000
ocean0.200000
east china sea0.200000
yushan islands0.200000
LOWER IN other regions0.200000
spartina alterniflora0.200000
kandelia candel0.200000
mangrove0.200000

Problems / suggestions? Please email info AT dbbact DOT org