Search result for sequence:
TACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGTTTGATAAGCGAGATGTGAAAGCCCCGGGCTTAACCTGGGAACGGCATTTCGAACTGTCAGGCTAGAGTGTGGTAGAGGGTAGTGGAATTTCCTG
common ontology terms
term enrichment score
TermScore
beach0.363636
poland0.307692
beetle0.307692
whole body0.266667
herbivorous beetle0.263158
nida basin0.222222
LOWER IN sea water0.214286
sand0.188679
portuguese republic0.176471
carnivorous beetle0.176471
mangrove biome0.176471
pacific ocean0.172249
marine sediment0.158730
depth 20m0.150000
mangrove swamp0.150000
depth 0-20cm0.139535
LOWER IN water0.134831
plant0.133333
eunicella labiata0.125000
gorgonian coral0.125000
aerosol0.125000
raba river0.125000
nan'ao island0.125000
santa cruz province0.125000
kandelia candel0.125000
ximendao national marine reserve0.125000
coral reef0.117647
monterey bay0.117647
mangrove0.117647
atlantic ocean0.115385
zhejiang province0.111111
sea water0.105263
coral0.105263
river0.093750
state of california0.088889
air0.080000
LOWER IN marine water body0.066667
argoptochus quadrisignatus0.066667
aphthona venustula0.066667
centricnemus leucogrammus0.066667
crioceris duodecimpunctata0.066667
LOWER IN detritivorous beetle0.066667
LOWER IN bulgaria0.066667
pearl harbor0.066667
hydroides elegans0.066667
tubeworm0.066667
bembidion punctulatum0.066667
bembidion varicolor0.066667
tap water0.066667
LOWER IN stagnant water0.066667
depth 2000-4000m0.066667
carabidae0.066667
LOWER IN staphylinidae0.066667
santa cruz county0.066667
leizhou nature reserve0.066667
san francisco bay0.066667
LOWER IN air0.066667
LOWER IN saline water0.064516
marine water body0.064516
state of illinois0.064516
lytechinus variegatus0.064516
guangdong province0.064516
spartina alterniflora0.064516
hawaii0.062500
shelled egg0.060606
drinking water0.058824
saline water0.055556
sediment0.054054
water0.053333
state of florida0.048780
ocean0.045455
fresh water0.043478
china0.039139
soil0.032609
united states of america0.030706
research facility0.016000
feces0.008439
Fraction of dbbact annotations with this term covered by the query
TermScore
portuguese republic0.500000
eunicella labiata0.500000
gorgonian coral0.500000
LOWER IN marine water body0.500000
nida basin0.500000
herbivorous beetle0.500000
argoptochus quadrisignatus0.500000
aphthona venustula0.500000
centricnemus leucogrammus0.500000
crioceris duodecimpunctata0.500000
LOWER IN detritivorous beetle0.500000
LOWER IN bulgaria0.500000
pearl harbor0.500000
hydroides elegans0.500000
tubeworm0.500000
beach0.500000
aerosol0.500000
carnivorous beetle0.500000
raba river0.500000
bembidion punctulatum0.500000
bembidion varicolor0.500000
tap water0.500000
LOWER IN stagnant water0.500000
nan'ao island0.500000
santa cruz province0.500000
depth 2000-4000m0.500000
carabidae0.500000
LOWER IN staphylinidae0.500000
santa cruz county0.500000
kandelia candel0.500000
leizhou nature reserve0.500000
mangrove biome0.500000
ximendao national marine reserve0.500000
san francisco bay0.500000
LOWER IN air0.500000
LOWER IN sea water0.428571
coral reef0.333333
LOWER IN saline water0.333333
poland0.333333
beetle0.333333
marine water body0.333333
monterey bay0.333333
state of illinois0.333333
lytechinus variegatus0.333333
mangrove0.333333
guangdong province0.333333
spartina alterniflora0.333333
depth 20m0.250000
whole body0.250000
hawaii0.250000
mangrove swamp0.250000
zhejiang province0.250000
coral0.200000
shelled egg0.200000
sand0.200000
depth 0-20cm0.200000
LOWER IN water0.181818
drinking water0.166667
marine sediment0.142857
atlantic ocean0.125000
plant0.125000
saline water0.125000
pacific ocean0.117647
sea water0.103448
air0.090909
river0.083333
state of florida0.076923
ocean0.062500
fresh water0.055556
state of california0.052632
sediment0.043478
water0.042553
china0.021978
soil0.019231
united states of america0.016043
research facility0.010309
feces0.004785
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.357143
pacific ocean0.321429
poland0.285714
whole body0.285714
beetle0.285714
state of california0.285714
beach0.285714
herbivorous beetle0.178571
marine sediment0.178571
china0.178571
sand0.178571
LOWER IN sea water0.142857
plant0.142857
nida basin0.142857
atlantic ocean0.107143
depth 20m0.107143
portuguese republic0.107143
sea water0.107143
carnivorous beetle0.107143
river0.107143
LOWER IN water0.107143
mangrove biome0.107143
depth 0-20cm0.107143
mangrove swamp0.107143
soil0.107143
eunicella labiata0.071429
coral reef0.071429
gorgonian coral0.071429
coral0.071429
air0.071429
aerosol0.071429
monterey bay0.071429
raba river0.071429
water0.071429
nan'ao island0.071429
sediment0.071429
santa cruz province0.071429
kandelia candel0.071429
mangrove0.071429
zhejiang province0.071429
ximendao national marine reserve0.071429
LOWER IN saline water0.035714
LOWER IN marine water body0.035714
argoptochus quadrisignatus0.035714
aphthona venustula0.035714
centricnemus leucogrammus0.035714
crioceris duodecimpunctata0.035714
LOWER IN detritivorous beetle0.035714
LOWER IN bulgaria0.035714
hawaii0.035714
pearl harbor0.035714
research facility0.035714
hydroides elegans0.035714
tubeworm0.035714
shelled egg0.035714
saline water0.035714
marine water body0.035714
bembidion punctulatum0.035714
bembidion varicolor0.035714
drinking water0.035714
tap water0.035714
state of illinois0.035714
fresh water0.035714
LOWER IN stagnant water0.035714
feces0.035714
lytechinus variegatus0.035714
state of florida0.035714
ocean0.035714
depth 2000-4000m0.035714
carabidae0.035714
LOWER IN staphylinidae0.035714
santa cruz county0.035714
leizhou nature reserve0.035714
guangdong province0.035714
spartina alterniflora0.035714
san francisco bay0.035714
LOWER IN air0.035714
Exp. ID User ID Description Date Region Flag Sequences
280amnon high in eunicella labiata coral reef gorgonian coral coral compared to saline water sea water marine water body in atlantic ocean depth 20m portuguese republic 2018-01-25v4No1 / 19
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, argoptochus quadrisignatus2019-04-18v4No1 / 22
515amnoncommon poland, whole body, beetle, aphthona venustula, plant, nida basin, herbivorous beetle2019-04-18v4No1 / 54
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, centricnemus leucogrammus2019-04-18v4No1 / 84
280amnoncommon atlantic ocean, depth 20m, portuguese republic, eunicella labiata, gorgonian coral, coral, coral reef2018-01-25v4No1 / 128
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, crioceris duodecimpunctata2019-04-18v4No1 / 157
515amnon high in herbivorous beetle poland compared to detritivorous beetle bulgaria in whole body beetle 2019-04-19v4No1 / 205
483amnoncommon hawaii, pearl harbor, research facility, hydroides elegans, tubeworm, united states of america, shelled egg2019-02-13v4No1 / 243
280amnoncommon atlantic ocean, saline water, sea water, marine water body, depth 20m, portuguese republic2018-01-25v4No1 / 259
304amnoncommon united states of america, state of california, beach, pacific ocean, air, aerosol, monterey bay2018-03-12v4No1 / 263
515amnoncommon carnivorous beetle, river, poland, raba river, whole body, beetle, bembidion punctulatum2019-04-18v4No1 / 305
515amnoncommon carnivorous beetle, river, poland, raba river, whole body, beetle, bembidion varicolor2019-04-18v4No1 / 308
341amnonhigher in fresh drinking water compared to week old water ( high in fresh water compared to stagnant water in water drinking water united states of america tap water state of illinois )2018-05-28v4No1 / 365
65amnoncommon feces, lytechinus variegatus, state of florida2017-02-17v4No1 / 376
504amnon high in sediment marine sediment compared to water sea water in nan'ao island china 2019-03-14v4No1 / 395
504amnoncommon nan'ao island, sediment, marine sediment, china2019-03-14v4No1 / 437
304amnoncommon united states of america, state of california, beach, pacific ocean, air, aerosol, santa cruz province2018-03-12v4No1 / 518
138amnoncommon in ocean water depth 2000-4000m (common sea water, ocean, pacific ocean, depth 2000-4000m)2017-04-18v4No1 / 674
304amnoncommon united states of america, state of california, beach, pacific ocean, sand, monterey bay2018-03-12v4No1 / 1038
515amnon high in carabidae compared to staphylinidae in whole body beetle carnivorous beetle river poland 2019-04-19v4No1 / 1130
304amnoncommon united states of america, state of california, beach, pacific ocean, water, sea water, santa cruz county2018-03-12v4No1 / 1425
571amnoncommon kandelia candel, mangrove, leizhou nature reserve, guangdong province, mangrove biome, depth 0-20cm, marine sediment, mangrove swamp, soil, china2019-12-16v4No1 / 1523
304amnonlower in seawater compared to beach sand ( high in sand compared to water sea water in united states of america state of california beach pacific ocean )2018-03-12v4No1 / 1599
571amnoncommon zhejiang province, ximendao national marine reserve, kandelia candel, mangrove, mangrove biome, depth 0-20cm, marine sediment, mangrove swamp, soil, china2019-12-16v4No1 / 1636
571amnoncommon spartina alterniflora, zhejiang province, ximendao national marine reserve, mangrove biome, depth 0-20cm, marine sediment, mangrove swamp, soil, china2019-12-16v4No1 / 1668
304amnoncommon united states of america, state of california, beach, pacific ocean, sand, san francisco bay2018-03-12v4No1 / 1799
304amnoncommon united states of america, state of california, beach, pacific ocean, sand, santa cruz province2018-03-12v4No1 / 1838
304amnonhigher in beach sand compared to sea water and sea spray ( high in sand compared to air water sea water in united states of america beach state of california pacific ocean )2018-03-12v4No1 / 2070

Problems / suggestions? Please email info AT dbbact DOT org