Search result for sequence:
TACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGTTTGATAAGCGAGATGTGAAAGCCCCGGGCTTAACCTGGGAACGGCATTTCGAACTGTCAGGCTAGAGTGTGGTAGAGGGTAGTGGAATTTCCTG
common ontology terms
term enrichment score
TermScore
poland0.355556
beach0.355556
whole body0.321429
beetle0.301887
herbivorous beetle0.256410
nida basin0.216216
LOWER IN sea water0.208696
sand0.185185
portuguese republic0.171429
carnivorous beetle0.171429
pacific ocean0.170616
marine sediment0.156250
depth 20m0.146341
mangrove swamp0.146341
LOWER IN water0.131868
plant0.131148
eunicella labiata0.121212
gorgonian coral0.121212
aerosol0.121212
raba river0.121212
nan'ao island0.121212
santa cruz province0.121212
kandelia candel0.121212
ximendao national marine reserve0.121212
depth 0-20cm0.120000
coral reef0.114286
monterey bay0.114286
mangrove0.114286
atlantic ocean0.113208
sea water0.103448
coral0.102564
zhejiang province0.097561
river0.092308
state of california0.088398
air0.078431
LOWER IN marine water body0.064516
argoptochus quadrisignatus0.064516
ixodes ricinus0.064516
castor bean tick0.064516
aphthona venustula0.064516
centricnemus leucogrammus0.064516
crioceris duodecimpunctata0.064516
LOWER IN detritivorous beetle0.064516
LOWER IN bulgaria0.064516
pearl harbor0.064516
hydroides elegans0.064516
tubeworm0.064516
bembidion punctulatum0.064516
bembidion varicolor0.064516
tap water0.064516
LOWER IN stagnant water0.064516
depth 2000-4000m0.064516
carabidae0.064516
LOWER IN staphylinidae0.064516
santa cruz county0.064516
leizhou nature reserve0.064516
san francisco bay0.064516
LOWER IN air0.064516
LOWER IN saline water0.062500
marine water body0.062500
state of illinois0.062500
lytechinus variegatus0.062500
guangdong province0.062500
spartina alterniflora0.062500
hawaii0.060606
shelled egg0.058824
switzerland0.057143
drinking water0.057143
saline water0.054054
sediment0.053333
water0.050633
state of florida0.045455
ocean0.044444
fresh water0.041667
china0.034014
united states of america0.028749
soil0.027523
research facility0.014599
feces0.007782
Fraction of dbbact annotations with this term covered by the query
TermScore
portuguese republic0.500000
eunicella labiata0.500000
gorgonian coral0.500000
LOWER IN marine water body0.500000
poland0.500000
nida basin0.500000
herbivorous beetle0.500000
argoptochus quadrisignatus0.500000
ixodes ricinus0.500000
castor bean tick0.500000
aphthona venustula0.500000
centricnemus leucogrammus0.500000
crioceris duodecimpunctata0.500000
LOWER IN detritivorous beetle0.500000
LOWER IN bulgaria0.500000
pearl harbor0.500000
hydroides elegans0.500000
tubeworm0.500000
beach0.500000
aerosol0.500000
carnivorous beetle0.500000
raba river0.500000
bembidion punctulatum0.500000
bembidion varicolor0.500000
tap water0.500000
LOWER IN stagnant water0.500000
nan'ao island0.500000
santa cruz province0.500000
depth 2000-4000m0.500000
carabidae0.500000
LOWER IN staphylinidae0.500000
santa cruz county0.500000
leizhou nature reserve0.500000
kandelia candel0.500000
ximendao national marine reserve0.500000
san francisco bay0.500000
LOWER IN air0.500000
LOWER IN sea water0.428571
coral reef0.333333
LOWER IN saline water0.333333
whole body0.333333
beetle0.333333
marine water body0.333333
monterey bay0.333333
state of illinois0.333333
lytechinus variegatus0.333333
guangdong province0.333333
mangrove0.333333
spartina alterniflora0.333333
depth 20m0.250000
hawaii0.250000
mangrove swamp0.250000
coral0.200000
shelled egg0.200000
sand0.200000
LOWER IN water0.181818
switzerland0.166667
drinking water0.166667
zhejiang province0.166667
marine sediment0.142857
depth 0-20cm0.142857
atlantic ocean0.125000
plant0.125000
saline water0.125000
pacific ocean0.117647
sea water0.103448
air0.090909
river0.083333
state of florida0.066667
ocean0.062500
state of california0.052632
fresh water0.052632
sediment0.043478
water0.040000
china0.018868
soil0.015873
united states of america0.015000
research facility0.009259
feces0.004386
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.344828
whole body0.310345
pacific ocean0.310345
poland0.275862
beetle0.275862
state of california0.275862
beach0.275862
herbivorous beetle0.172414
marine sediment0.172414
china0.172414
sand0.172414
LOWER IN sea water0.137931
plant0.137931
nida basin0.137931
atlantic ocean0.103448
depth 20m0.103448
portuguese republic0.103448
sea water0.103448
carnivorous beetle0.103448
river0.103448
LOWER IN water0.103448
soil0.103448
mangrove swamp0.103448
depth 0-20cm0.103448
eunicella labiata0.068966
coral reef0.068966
gorgonian coral0.068966
coral0.068966
air0.068966
aerosol0.068966
monterey bay0.068966
raba river0.068966
water0.068966
nan'ao island0.068966
sediment0.068966
santa cruz province0.068966
mangrove0.068966
kandelia candel0.068966
ximendao national marine reserve0.068966
zhejiang province0.068966
LOWER IN saline water0.034483
LOWER IN marine water body0.034483
argoptochus quadrisignatus0.034483
ixodes ricinus0.034483
castor bean tick0.034483
switzerland0.034483
aphthona venustula0.034483
centricnemus leucogrammus0.034483
crioceris duodecimpunctata0.034483
LOWER IN detritivorous beetle0.034483
LOWER IN bulgaria0.034483
hawaii0.034483
pearl harbor0.034483
research facility0.034483
hydroides elegans0.034483
tubeworm0.034483
shelled egg0.034483
saline water0.034483
marine water body0.034483
bembidion punctulatum0.034483
bembidion varicolor0.034483
drinking water0.034483
tap water0.034483
state of illinois0.034483
fresh water0.034483
LOWER IN stagnant water0.034483
feces0.034483
lytechinus variegatus0.034483
state of florida0.034483
ocean0.034483
depth 2000-4000m0.034483
carabidae0.034483
LOWER IN staphylinidae0.034483
santa cruz county0.034483
guangdong province0.034483
leizhou nature reserve0.034483
spartina alterniflora0.034483
san francisco bay0.034483
LOWER IN air0.034483
Exp. ID User ID Description Date Region Flag Sequences
280amnon high in eunicella labiata coral reef gorgonian coral coral compared to saline water sea water marine water body in atlantic ocean depth 20m portuguese republic 2018-01-25v4No1 / 19
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, argoptochus quadrisignatus2019-04-18v4No1 / 22
595amnoncommon ixodes ricinus, castor bean tick, whole body, switzerland2020-03-16v4No1 / 42
515amnoncommon poland, whole body, beetle, aphthona venustula, plant, nida basin, herbivorous beetle2019-04-18v4No1 / 54
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, centricnemus leucogrammus2019-04-18v4No1 / 84
280amnoncommon atlantic ocean, depth 20m, portuguese republic, eunicella labiata, gorgonian coral, coral, coral reef2018-01-25v4No1 / 128
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, crioceris duodecimpunctata2019-04-18v4No1 / 157
515amnon high in herbivorous beetle poland compared to detritivorous beetle bulgaria in whole body beetle 2019-04-19v4No1 / 205
483amnoncommon hawaii, pearl harbor, research facility, hydroides elegans, tubeworm, united states of america, shelled egg2019-02-13v4No1 / 243
280amnoncommon atlantic ocean, saline water, sea water, marine water body, depth 20m, portuguese republic2018-01-25v4No1 / 259
304amnoncommon united states of america, state of california, beach, pacific ocean, air, aerosol, monterey bay2018-03-12v4No1 / 263
515amnoncommon carnivorous beetle, river, poland, raba river, whole body, beetle, bembidion punctulatum2019-04-18v4No1 / 305
515amnoncommon carnivorous beetle, river, poland, raba river, whole body, beetle, bembidion varicolor2019-04-18v4No1 / 308
341amnonhigher in fresh drinking water compared to week old water ( high in fresh water compared to stagnant water in water drinking water united states of america tap water state of illinois )2018-05-28v4No1 / 365
65amnoncommon feces, lytechinus variegatus, state of florida2017-02-17v4No1 / 376
504amnon high in sediment marine sediment compared to water sea water in nan'ao island china 2019-03-14v4No1 / 395
504amnoncommon nan'ao island, sediment, marine sediment, china2019-03-14v4No1 / 437
304amnoncommon united states of america, state of california, beach, pacific ocean, air, aerosol, santa cruz province2018-03-12v4No1 / 518
138amnoncommon in ocean water depth 2000-4000m (common sea water, ocean, pacific ocean, depth 2000-4000m)2017-04-18v4No1 / 674
304amnoncommon united states of america, state of california, beach, pacific ocean, sand, monterey bay2018-03-12v4No1 / 1038
515amnon high in carabidae compared to staphylinidae in whole body beetle carnivorous beetle river poland 2019-04-19v4No1 / 1130
304amnoncommon united states of america, state of california, beach, pacific ocean, water, sea water, santa cruz county2018-03-12v4No1 / 1425
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, guangdong province, leizhou nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 1523
304amnonlower in seawater compared to beach sand ( high in sand compared to water sea water in united states of america state of california beach pacific ocean )2018-03-12v4No1 / 1599
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, mangrove, kandelia candel, ximendao national marine reserve, zhejiang province2019-12-16v4No1 / 1636
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, ximendao national marine reserve, zhejiang province, spartina alterniflora2019-12-16v4No1 / 1668
304amnoncommon united states of america, state of california, beach, pacific ocean, sand, san francisco bay2018-03-12v4No1 / 1799
304amnoncommon united states of america, state of california, beach, pacific ocean, sand, santa cruz province2018-03-12v4No1 / 1838
304amnonhigher in beach sand compared to sea water and sea spray ( high in sand compared to air water sea water in united states of america beach state of california pacific ocean )2018-03-12v4No1 / 2070

Problems / suggestions? Please email info AT dbbact DOT org