Search result for sequence:
TACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGTTTGGTAAGCGAGATGTGAAAGCCCCGGGCTTAACCTGGGAACGGCATTTCGAACTGTCAGACTAGAGTGTGGTAGAGGGTAGTGGAATTTCCTG
common ontology terms
term enrichment score
TermScore
south florida0.320000
shark0.320000
philippine sea0.320000
pacific ocean0.313725
ocean water0.235294
ocean0.208696
state of florida0.195122
north east pacific ocean0.190476
depth 1000-2000m0.190476
oil seep0.173913
atlantic ocean0.163265
zebra fish0.148148
danio rerio0.137931
surface water0.121212
water0.112150
anal canal0.105263
trichodesmium0.105263
south pacific ocean0.105263
bodega bay0.105263
field soil0.105263
nicotiana tabacum0.105263
LOWER IN depth 2000-3000m0.105263
LOWER IN depth 500-1000m0.105263
gill0.100000
depth 2000-3000m0.100000
LOWER IN depth 150m0.100000
LOWER IN depth 300m0.100000
depth 300m0.100000
mediterranean sea0.095238
LOWER IN depth 0m0.095238
LOWER IN late time points0.095238
early time points0.095238
depth 150m0.095238
larval stage0.093023
marine sediment0.093023
intestine0.078431
pair of nares0.076923
bos taurus0.074074
sea water0.064516
sediment0.063492
skin0.061538
LOWER IN adult0.058824
state of california0.055556
farm0.051282
rhizosphere0.045455
united states of america0.031866
soil0.029412
china0.019802
research facility0.018957
LOWER IN control0.014925
homo sapiens0.011976
Fraction of dbbact annotations with this term covered by the query
TermScore
south florida0.500000
shark0.500000
anal canal0.500000
trichodesmium0.500000
south pacific ocean0.500000
philippine sea0.500000
bodega bay0.500000
field soil0.500000
nicotiana tabacum0.500000
north east pacific ocean0.500000
depth 1000-2000m0.500000
LOWER IN depth 2000-3000m0.500000
LOWER IN depth 500-1000m0.500000
gill0.333333
depth 2000-3000m0.333333
LOWER IN depth 150m0.333333
LOWER IN depth 300m0.333333
depth 300m0.333333
oil seep0.333333
mediterranean sea0.250000
LOWER IN depth 0m0.250000
LOWER IN late time points0.250000
early time points0.250000
depth 150m0.250000
pacific ocean0.235294
zebra fish0.200000
ocean0.187500
ocean water0.176471
state of florida0.166667
danio rerio0.166667
atlantic ocean0.125000
surface water0.125000
pair of nares0.111111
bos taurus0.100000
larval stage0.076923
marine sediment0.076923
sea water0.071429
water0.066667
intestine0.058824
LOWER IN adult0.058824
state of california0.052632
farm0.045455
sediment0.043478
skin0.041667
rhizosphere0.037037
soil0.019608
united states of america0.016575
china0.011905
research facility0.010309
LOWER IN control0.008547
homo sapiens0.006667
Fraction of annotations for the query sequences containing the term
TermScore
pacific ocean0.470588
united states of america0.411765
water0.352941
ocean water0.352941
atlantic ocean0.235294
south florida0.235294
state of florida0.235294
shark0.235294
ocean0.235294
philippine sea0.235294
skin0.117647
danio rerio0.117647
zebra fish0.117647
research facility0.117647
intestine0.117647
larval stage0.117647
surface water0.117647
sediment0.117647
oil seep0.117647
marine sediment0.117647
north east pacific ocean0.117647
depth 1000-2000m0.117647
anal canal0.058824
gill0.058824
sea water0.058824
trichodesmium0.058824
south pacific ocean0.058824
LOWER IN adult0.058824
mediterranean sea0.058824
LOWER IN depth 0m0.058824
LOWER IN late time points0.058824
depth 2000-3000m0.058824
early time points0.058824
LOWER IN depth 150m0.058824
LOWER IN depth 300m0.058824
depth 300m0.058824
depth 150m0.058824
homo sapiens0.058824
pair of nares0.058824
bos taurus0.058824
farm0.058824
LOWER IN control0.058824
state of california0.058824
bodega bay0.058824
soil0.058824
china0.058824
field soil0.058824
nicotiana tabacum0.058824
rhizosphere0.058824
LOWER IN depth 2000-3000m0.058824
LOWER IN depth 500-1000m0.058824
Exp. ID User ID Description Date Region Flag Sequences
323amnonhigh freq. in shark cloaca (highfreq atlantic ocean, south florida, state of florida, united states of america, shark, anal canal)2018-04-24v4No1 / 12
323amnonhigh freq. in shark skin (highfreq atlantic ocean, south florida, state of florida, united states of america, shark, skin)2018-04-24v4No1 / 13
323amnonhigh freq. in shark gills (highfreq atlantic ocean, south florida, state of florida, united states of america, shark, gill)2018-04-24v4No1 / 15
113amnoncommon danio rerio, zebra fish, research facility, united states of america, intestine, larval stage2017-04-10v4No1 / 45
136amnoncommon sea water, trichodesmium, ocean, pacific ocean, south pacific ocean2017-04-17v4No1 / 125
113amnon high in larval stage compared to adult in danio rerio zebra fish research facility united states of america intestine 2017-04-10v4No1 / 128
500amnondecreases when incubating water sample from depth 2100m at depth 0m for one year ( high in early time points compared to depth 0m late time points in water ocean water mediterranean sea depth 2000-3000m )2019-03-05v4No1 / 132
342amnon high in surface water compared to depth 150m depth 300m in water ocean water pacific ocean philippine sea 2018-05-28v4No1 / 161
323amnoncommon in shark skin (common atlantic ocean, south florida, state of florida, united states of america, shark, skin)2018-04-24v4No1 / 213
342amnoncommon water, ocean water, pacific ocean, philippine sea, surface water2018-05-28v4No1 / 236
342amnoncommon water, ocean water, pacific ocean, philippine sea, depth 300m2018-05-28v4No1 / 323
342amnoncommon water, ocean water, pacific ocean, philippine sea, depth 150m2018-05-28v4No1 / 397
193amnonhigher in nares of people working in dairy farms ( high in bos taurus farm compared to control in homo sapiens united states of america pair of nares )2017-09-05v4No1 / 992
236amnoncommon ocean, ocean water, state of california, pacific ocean, bodega bay, water2017-11-07v4No1 / 1156
40amnoncommon soil, china, field soil, nicotiana tabacum, rhizosphere2016-12-09v4No1 / 1420
472amnon high in depth 1000-2000m compared to depth 2000-3000m in ocean sediment oil seep marine sediment north east pacific ocean pacific ocean 2019-01-16v4No1 / 2593
472amnon high in depth 1000-2000m compared to depth 500-1000m in ocean sediment oil seep marine sediment north east pacific ocean pacific ocean 2019-01-16v4No1 / 3000

Problems / suggestions? Please email info AT dbbact DOT org