Search result for sequence:
TACGGAGGGTGCAAGCGTTATCCGGAATCATTGGGTTTAAAGGGTCCGCAGGCGGTCAATTAAGTCAGAGGTGAAATCCCATAGCTTAACTATGGAACTGCCTTTGATACTGGTTGACTTGAGTTATACGGAAGTAGATAGAATAAGTAG
common ontology terms
term enrichment score
TermScore
sea water0.608048
pacific ocean0.510536
saline water0.326241
state of california0.320724
monterey bay0.320000
water0.319903
surface water0.252101
canada0.224299
ocean0.218878
beach0.188034
calvert island0.159292
province of british columbia0.147541
alga0.128440
atlantic ocean0.108108
hokkaido0.106195
depth 5m0.095238
depth 20m0.095238
north america0.095238
nan'ao island0.077670
depth 25cm0.077670
mangrove biome0.077670
marine sediment0.076923
japan0.074534
mangrove swamp0.072072
depth 0-20cm0.069565
city0.060914
depth 100m0.060302
size 1-80um0.059406
size < 1um0.059406
coast0.059406
pearl harbor0.059406
hydroides elegans0.059406
tubeworm0.059406
portuguese republic0.059406
estuary0.059406
estuary water0.059406
bilbao0.059406
aerosol0.059406
saanich inlet0.059406
san francisco bay0.059406
particle bound0.057692
spartina alterniflora0.057692
hawaii0.056075
zhejiang province0.056075
free floating0.054545
sand0.054545
skin0.051852
china0.048913
united states of america0.048878
kingdom of spain0.046875
air0.046875
starfish0.040404
depth 30m0.040404
physeter catodon0.040404
gulf of naples0.040404
delphinus delphis0.040404
LOWER IN atlantic ocean0.040404
guinea0.040404
depth 3m0.040404
biofilm material0.040404
metal0.040404
salinity >20 ppt0.040404
coastal water0.040404
LOWER IN starfish0.040404
LOWER IN coelomic fluid0.040404
depth 200m0.040404
santa cruz province0.040404
ximendao national marine reserve0.040404
coelomic fluid0.039604
depth 10m0.039604
depth 0-1 meter0.039604
marine water body0.039604
commonwealth of massachusetts0.039604
mediterranean sea0.038835
early time points0.038835
LOWER IN late time points0.038835
biofilm0.037383
LOWER IN wild0.036036
italy0.034783
wild0.033613
soil0.026403
asterias amurensis0.020619
globicephala macrorhynchus0.020619
short finned pilot whale0.020619
trichodesmium0.020619
sargasso sea0.020619
patiria pectinifera0.020619
balaenoptera borealis0.020619
sei whale0.020619
depth 1500.020619
depth 75m0.020619
balaenoptera physalus0.020619
fin whale0.020619
eunicella labiata0.020619
gorgonian coral0.020619
LOWER IN coral reef0.020619
LOWER IN coral0.020619
LOWER IN eunicella labiata0.020619
LOWER IN gorgonian coral0.020619
LOWER IN cape cod canal0.020619
Fraction of dbbact annotations with this term covered by the query
TermScore
canada1.000000
monterey bay0.666667
depth 100m0.666667
surface water0.625000
sea water0.586207
calvert island0.500000
starfish0.500000
asterias amurensis0.500000
size 1-80um0.500000
depth 5m0.500000
saline water0.500000
depth 30m0.500000
physeter catodon0.500000
nan'ao island0.500000
depth 20m0.500000
size < 1um0.500000
gulf of naples0.500000
coast0.500000
north america0.500000
depth 25cm0.500000
delphinus delphis0.500000
globicephala macrorhynchus0.500000
short finned pilot whale0.500000
trichodesmium0.500000
sargasso sea0.500000
patiria pectinifera0.500000
balaenoptera borealis0.500000
sei whale0.500000
pearl harbor0.500000
hydroides elegans0.500000
tubeworm0.500000
depth 1500.500000
depth 75m0.500000
balaenoptera physalus0.500000
fin whale0.500000
portuguese republic0.500000
eunicella labiata0.500000
gorgonian coral0.500000
LOWER IN coral reef0.500000
LOWER IN coral0.500000
LOWER IN eunicella labiata0.500000
LOWER IN gorgonian coral0.500000
LOWER IN atlantic ocean0.500000
LOWER IN cape cod canal0.500000
alga0.500000
pyropia0.500000
pyropia perforata0.500000
purple laver0.500000
shenzhen city prefecture0.500000
guinea0.500000
depth 3m0.500000
biofilm material0.500000
metal0.500000
outer biofilm0.500000
estuary0.500000
estuary water0.500000
salinity >20 ppt0.500000
bilbao0.500000
coastal water0.500000
chitin beads0.500000
odonthalia floccosa0.500000
odonthalia0.500000
LOWER IN starfish0.500000
LOWER IN coelomic fluid0.500000
LOWER IN patiria pectinifera0.500000
phylospadix0.500000
surfgrass0.500000
depth 4m0.500000
respiratory airway0.500000
exhaled air condensate0.500000
whale blow0.500000
LOWER IN salinity <5 ppt0.500000
ptilota filicina0.500000
ptilota0.500000
endocladia0.500000
endocladia muricata0.500000
turfweed0.500000
beach0.500000
LOWER IN air0.500000
LOWER IN aerosol0.500000
aerosol0.500000
cryptosiphonia woodii0.500000
cryptosiphonia0.500000
saanich inlet0.500000
depth 200m0.500000
deth 5-100m0.500000
LOWER IN depth 200m0.500000
salinity <5 ppt0.500000
LOWER IN asterias amurensis0.500000
depth 60m0.500000
neogastroclonium subarticulatum0.500000
neogastroclonium0.500000
depth 80m0.500000
santa cruz province0.500000
LOWER IN depth 75m0.500000
san francisco bay0.500000
LOWER IN megaptera novaeangliae0.500000
LOWER IN humpback whale0.500000
LOWER IN respiratory airway0.500000
LOWER IN whale blow0.500000
Fraction of annotations for the query sequences containing the term
TermScore
sea water0.631579
pacific ocean0.557895
water0.505263
state of california0.410526
united states of america0.284211
saline water0.242105
monterey bay0.210526
ocean0.168421
surface water0.157895
canada0.126316
beach0.115789
province of british columbia0.094737
calvert island0.094737
china0.094737
skin0.073684
alga0.073684
city0.063158
hokkaido0.063158
japan0.063158
atlantic ocean0.063158
depth 5m0.052632
depth 20m0.052632
north america0.052632
marine sediment0.052632
nan'ao island0.042105
depth 25cm0.042105
mangrove biome0.042105
depth 0-20cm0.042105
mangrove swamp0.042105
soil0.042105
particle bound0.031579
size 1-80um0.031579
free floating0.031579
size < 1um0.031579
coast0.031579
hawaii0.031579
pearl harbor0.031579
research facility0.031579
hydroides elegans0.031579
tubeworm0.031579
portuguese republic0.031579
kingdom of spain0.031579
estuary0.031579
estuary water0.031579
bilbao0.031579
air0.031579
aerosol0.031579
saanich inlet0.031579
depth 100m0.031579
san francisco bay0.031579
sand0.031579
spartina alterniflora0.031579
zhejiang province0.031579
starfish0.021053
coelomic fluid0.021053
wild0.021053
depth 30m0.021053
physeter catodon0.021053
depth 10m0.021053
mediterranean sea0.021053
italy0.021053
gulf of naples0.021053
depth 0-1 meter0.021053
delphinus delphis0.021053
early time points0.021053
LOWER IN late time points0.021053
marine water body0.021053
LOWER IN atlantic ocean0.021053
guinea0.021053
depth 3m0.021053
biofilm0.021053
biofilm material0.021053
metal0.021053
salinity >20 ppt0.021053
coastal water0.021053
commonwealth of massachusetts0.021053
LOWER IN starfish0.021053
LOWER IN wild0.021053
LOWER IN coelomic fluid0.021053
depth 200m0.021053
santa cruz province0.021053
ximendao national marine reserve0.021053
asterias amurensis0.010526
globicephala macrorhynchus0.010526
short finned pilot whale0.010526
trichodesmium0.010526
sargasso sea0.010526
patiria pectinifera0.010526
balaenoptera borealis0.010526
sei whale0.010526
larval stage0.010526
depth 300m0.010526
depth 1500.010526
depth 75m0.010526
balaenoptera physalus0.010526
fin whale0.010526
eunicella labiata0.010526
gorgonian coral0.010526
coral0.010526
coral reef0.010526
Exp. ID User ID Description Date Region Flag Sequences
355amnonhighfreq canada, province of british columbia, calvert island, pacific ocean, ocean, surface water, sea water2018-08-01v4No1 / 11
550amnoncommon city, hokkaido, starfish, asterias amurensis, coelomic fluid, wild, japan2019-08-18v4No1 / 15
505amnonhighfreq water, pacific ocean, state of california, surface water, particle bound, size 1-80um, sea water2019-03-14v4No1 / 16
317amnonhighfreq water, united states of america, state of california, pacific ocean, surface water, depth 5m, sea water2018-04-15v4No1 / 17
473amnonhighfreq water, saline water, pacific ocean, state of california, monterey bay, depth 30m, sea water2019-01-16v4No1 / 17
79amnonhighfreq skin, united states of america, physeter catodon2017-03-03v4No1 / 18
473amnonhighfreq water, saline water, pacific ocean, state of california, monterey bay, depth 5m, sea water2019-01-16v4No1 / 18
504amnonhighfreq nan'ao island, water, sea water, china2019-03-14v4No1 / 18
473amnonhighfreq water, saline water, pacific ocean, state of california, monterey bay, depth 20m, sea water2019-01-16v4No1 / 19
550amnonhighfreq sea water, hokkaido, city, japan2019-08-18v4No1 / 20
473amnonhighfreq water, saline water, pacific ocean, state of california, monterey bay, depth 10m, sea water2019-01-16v4No1 / 21
505amnonhighfreq water, pacific ocean, state of california, surface water, free floating, size < 1um, sea water2019-03-14v4No1 / 21
485amnonhighfreq water, saline water, mediterranean sea, italy, gulf of naples, surface water, depth 0-1 meter, coast, sea water2019-02-19v4No1 / 23
209amnonhighfreq sea water, ocean, north america, depth 25cm2017-10-15v4No1 / 26
79amnoncommon skin, united states of america, physeter catodon2017-03-03v4No1 / 30
79amnonhighfreq skin, united states of america, delphinus delphis2017-03-03v4No1 / 36
79amnoncommon skin, united states of america, globicephala macrorhynchus, short finned pilot whale2017-03-03v4No1 / 42
317amnoncommon water, united states of america, state of california, pacific ocean, surface water, depth 5m, sea water2018-04-15v4No1 / 62
136amnoncommon sea water, trichodesmium, ocean, sargasso sea, atlantic ocean2017-04-17v4No1 / 81
550amnoncommon city, hokkaido, starfish, coelomic fluid, wild, patiria pectinifera, japan2019-08-18v4No1 / 85
79amnoncommon skin, united states of america, balaenoptera borealis, sei whale2017-03-03v4No1 / 90
505amnon high in early time points compared to late time points in water pacific ocean state of california surface water size < 1um free floating sea water 2019-03-16v4No1 / 96
483amnoncommon larval stage, hawaii, pearl harbor, research facility, hydroides elegans, tubeworm, united states of america2019-02-13v4No1 / 100
317amnoncommon water, united states of america, state of california, pacific ocean, depth 300m, depth 150, depth 75m, sea water2018-04-15v4No1 / 101
79amnoncommon skin, united states of america, balaenoptera physalus, fin whale2017-03-03v4No1 / 105
79amnoncommon skin, united states of america, delphinus delphis2017-03-03v4No1 / 113
280amnoncommon atlantic ocean, depth 20m, portuguese republic, eunicella labiata, gorgonian coral, coral, coral reef2018-01-25v4No1 / 128
280amnon high in marine water body sea water saline water compared to coral reef coral eunicella labiata gorgonian coral in atlantic ocean depth 20m portuguese republic 2018-01-25v4No1 / 132
209amnon high in pacific ocean vancouver compared to atlantic ocean cape cod canal in sea water ocean north america depth 25cm 2017-10-15v4No1 / 144
355amnoncommon canada, province of british columbia, calvert island, pacific ocean, ocean, alga, pyropia, pyropia perforata, purple laver2018-08-01v4No1 / 145
85amnoncommon litopenaeus vannamei, pacific white shrimp, shenzhen city prefecture, digestive system, china, sea water2017-03-06v4No1 / 147
222amnoncommon on outer biofilm on metal plate in ocean water (common water, sea water, guinea, depth 3m, biofilm, biofilm material, metal, outer biofilm)2017-10-26v4No1 / 147
510amnoncommon kingdom of spain, water, estuary, estuary water, saline water, salinity >20 ppt, bilbao2019-03-20v4No1 / 158
461amnonhigher in early compared to late timepoints in chitin beads incubated in ocean water ( high in early timepoints compared to late timepoints in water atlantic ocean surface water coastal water united states of america commonwealth of massachusetts chitin beads sea water )2019-01-12v4No1 / 160
222amnoncommon on inner biofilm on metal plate in ocean water (common water, sea water, guinea, depth 3m, biofilm, biofilm material, metal)2017-10-26v4No1 / 177
355amnoncommon canada, province of british columbia, calvert island, pacific ocean, ocean, alga, odonthalia floccosa, odonthalia2018-08-01v4No1 / 178
550amnon high in sea water compared to starfish wild coelomic fluid patiria pectinifera in city hokkaido japan 2019-08-18v4No1 / 185
355amnoncommon canada, province of british columbia, calvert island, pacific ocean, ocean, alga, phylospadix, surfgrass2018-08-01v4No1 / 191
473amnoncommon water, saline water, pacific ocean, state of california, monterey bay, depth 10m, sea water2019-01-16v4No1 / 213
433amnoncommon sea water, ocean, depth 4m, south china sea, coast2018-12-19v4No1 / 215
209amnon high in pacific ocean compared to atlantic ocean in north america megaptera novaeangliae humpback whale respiratory airway exhaled air condensate whale blow 2017-10-15v4No1 / 219
473amnoncommon water, saline water, pacific ocean, state of california, monterey bay, depth 5m, sea water2019-01-16v4No1 / 220
505amnon high in early time points compared to late time points in water pacific ocean state of california surface water particle bound size 1-80um sea water 2019-03-16v4No1 / 223
510amnon high in saline water salinity >20 ppt compared to fresh water salinity <5 ppt in kingdom of spain water estuary estuary water bilbao 2019-03-20v4No1 / 223
473amnoncommon water, saline water, pacific ocean, state of california, monterey bay, depth 20m, sea water2019-01-16v4No1 / 225
505amnoncommon water, pacific ocean, state of california, surface water, free floating, size < 1um, sea water2019-03-14v4No1 / 225
355amnoncommon canada, province of british columbia, calvert island, pacific ocean, ocean, alga, ptilota filicina, ptilota2018-08-01v4No1 / 230
355amnoncommon canada, province of british columbia, calvert island, pacific ocean, ocean, alga, endocladia, endocladia muricata, turfweed2018-08-01v4No1 / 237
483amnoncommon hawaii, pearl harbor, research facility, hydroides elegans, tubeworm, united states of america, shelled egg2019-02-13v4No1 / 243
485amnoncommon water, saline water, mediterranean sea, italy, gulf of naples, surface water, depth 0-1 meter, coast, sea water2019-02-19v4No1 / 244
280amnoncommon atlantic ocean, saline water, sea water, marine water body, depth 20m, portuguese republic2018-01-25v4No1 / 259
304amnonhigher in seawater compared sea spray aerosol ( high in water sea water compared to air aerosol in united states of america state of california beach pacific ocean )2018-03-12v4No1 / 260
304amnoncommon united states of america, state of california, beach, pacific ocean, air, aerosol, monterey bay2018-03-12v4No1 / 263
355amnoncommon canada, province of british columbia, calvert island, pacific ocean, ocean, surface water, sea water2018-08-01v4No1 / 280
355amnoncommon canada, province of british columbia, calvert island, pacific ocean, ocean, alga, cryptosiphonia woodii, cryptosiphonia2018-08-01v4No1 / 281
496amnoncommon water, canada, saanich inlet, pacific ocean, depth 200m, sea water2019-03-03v4No1 / 287
550amnoncommon city, hokkaido, sea water, japan2019-08-18v4No1 / 291
473amnon high in summer compared to winter in water saline water pacific ocean state of california monterey bay deth 5-100m sea water 2019-01-16v4No1 / 293
473amnoncommon water, saline water, pacific ocean, state of california, monterey bay, depth 30m, sea water2019-01-16v4No1 / 293
496amnon high in depth 100m compared to depth 200m in water canada saanich inlet pacific ocean sea water 2019-03-03v4No1 / 310
510amnoncommon kingdom of spain, water, estuary, estuary water, fresh water, salinity <5 ppt, bilbao2019-03-20v4No1 / 317
461amnoncommon water, atlantic ocean, surface water, coastal water, united states of america, commonwealth of massachusetts, sea water2019-01-12v4No1 / 322
473amnoncommon water, saline water, pacific ocean, state of california, monterey bay, depth 40m, sea water2019-01-16v4No1 / 340
550amnon high in sea water compared to starfish asterias amurensis coelomic fluid wild in city hokkaido japan 2019-08-18v4No1 / 389
473amnoncommon water, saline water, pacific ocean, state of california, monterey bay, depth 60m, sea water2019-01-16v4No1 / 390
505amnoncommon water, pacific ocean, state of california, surface water, particle bound, size 1-80um, sea water2019-03-14v4No1 / 397
355amnoncommon canada, province of british columbia, calvert island, pacific ocean, ocean, alga, neogastroclonium subarticulatum, neogastroclonium2018-08-01v4No1 / 419
504amnoncommon nan'ao island, sediment, marine sediment, china2019-03-14v4No1 / 437
209amnoncommon sea water, ocean, north america, depth 25cm2017-10-15v4No1 / 445
504amnoncommon nan'ao island, water, sea water, china2019-03-14v4No1 / 452
473amnoncommon water, saline water, pacific ocean, state of california, monterey bay, depth 80m, sea water2019-01-16v4No1 / 454
504amnon high in water sea water compared to sediment marine sediment in nan'ao island china 2019-03-14v4No1 / 462
496amnoncommon water, canada, saanich inlet, pacific ocean, depth 100m, sea water2019-03-03v4No1 / 469
473amnoncommon water, saline water, pacific ocean, state of california, monterey bay, depth 100m, sea water2019-01-16v4No1 / 486
473amnoncommon water, saline water, pacific ocean, state of california, monterey bay, depth 200m, sea water2019-01-16v4No1 / 492
304amnoncommon united states of america, state of california, beach, pacific ocean, air, aerosol, santa cruz province2018-03-12v4No1 / 518
317amnonlower in depth>75m compared to depth >5m in ocean water ( high in surface water depth 5m compared to depth 300m depth 150m depth 75m in water united states of america state of california pacific ocean sea water )2018-04-15v4No1 / 544
304amnonhigher in seawater compared to beach sand ( high in sea water water compared to sand in united states of america state of california beach pacific ocean )2018-03-12v4No1 / 547
304amnoncommon united states of america, state of california, beach, pacific ocean, air, aerosol, san francisco bay2018-03-12v4No1 / 558
209amnonlower in whale blow condensate compared to ocean water ( high in sea water ocean depth 25cm compared to megaptera novaeangliae humpback whale respiratory airway whale blow exhaled air condensate in north america )2017-10-15v4No1 / 560
473amnoncommon water, saline water, pacific ocean, state of california, monterey bay, depth 500m, sea water2019-01-16v4No1 / 587
304amnoncommon united states of america, state of california, beach, pacific ocean, water, sea water, monterey bay2018-03-12v4No1 / 667
483amnoncommon hawaii, pearl harbor, research facility, hydroides elegans, tubeworm, united states of america, tubeworm tube2019-02-13v4No1 / 683
473amnon high in depth 5-50m compared to depth 50-100m in water saline water pacific ocean state of california monterey bay sea water 2019-01-16v4No1 / 919
304amnoncommon united states of america, state of california, beach, pacific ocean, sand, monterey bay2018-03-12v4No1 / 1038
473amnon high in depth 50-100m compared to depth 150-500m in water saline water pacific ocean state of california monterey bay sea water 2019-01-16v4No1 / 1072
236amnoncommon ocean, state of california, pacific ocean, bodega bay, water, sea water2017-11-07v4No1 / 1156
304amnoncommon united states of america, state of california, beach, pacific ocean, water, sea water, san francisco bay2018-03-12v4No1 / 1166
304amnoncommon united states of america, state of california, beach, pacific ocean, water, sea water, santa cruz county2018-03-12v4No1 / 1425
571amnoncommon spartina alterniflora, leizhou nature reserve, guangdong province, mangrove biome, depth 0-20cm, marine sediment, mangrove swamp, soil, china2019-12-16v4No1 / 1437
571amnoncommon zhejiang province, ximendao national marine reserve, kandelia candel, mangrove, mangrove biome, depth 0-20cm, marine sediment, mangrove swamp, soil, china2019-12-16v4No1 / 1636
571amnoncommon spartina alterniflora, zhejiang province, ximendao national marine reserve, mangrove biome, depth 0-20cm, marine sediment, mangrove swamp, soil, china2019-12-16v4No1 / 1668
571amnoncommon futian national nature reserve, spartina alterniflora, zhejiang province, mangrove biome, depth 0-20cm, marine sediment, mangrove swamp, soil, china2019-12-16v4No1 / 1747
304amnoncommon united states of america, state of california, beach, pacific ocean, sand, san francisco bay2018-03-12v4No1 / 1799
304amnoncommon united states of america, state of california, beach, pacific ocean, sand, santa cruz province2018-03-12v4No1 / 1838

Problems / suggestions? Please email info AT dbbact DOT org