Search result for sequence:
TACGGAGGGTGCAAGCGTTATCCGGATTCACTGGGTTTAAAGGGTGCGTAGGCGGGCAGGTAAGTCAGTGGTGAAATCCTGGAGCTTAACTCCAGAACTGCCATTGATACTATCTGTCTTGAATATTGTGGAGGTAAGCGGAATATGTCA
common ontology terms
term enrichment score
TermScore
drinking water0.215686
river0.177215
cannabis sativa0.171429
water0.161435
rhizosphere0.160609
fresh water0.126697
root0.120482
wet season0.114286
state of idaho0.114286
jiulong river0.093750
boechera stricta0.093750
minas gerais state0.093750
campos rupestres0.093750
olympic national park0.093750
robinia pseudoacacia0.093750
reforestation0.093750
30 years0.093750
shaanxi province0.093750
fresh water aquarium0.093750
soil0.090473
site a0.089552
fujian province0.089552
LOWER IN dry season0.089552
loess plateau0.089552
depth (soil) 50cm0.085714
state of washington0.082192
whole body0.080537
silt loam0.078947
summer0.075472
brassicaceae0.070588
LOWER IN winter0.069364
geranium pratense0.064516
meadow geranium0.064516
LOWER IN other plants0.064516
lathyrus pratensis0.064516
meadow pea-vine0.064516
river nile0.064516
depth (water) 50cm0.064516
cairo0.064516
barbacenia macrantha0.064516
root endosphere0.064516
late flowering stage0.064516
LOWER IN cbd shark cannabis plant0.064516
flowering stage0.064516
epiphytic material0.064516
canopy soil0.064516
zebra mussel0.064516
dreissena polymorpha0.064516
united states of america0.064114
site e0.062500
site d0.062500
mussel0.062500
rice0.060606
egypt0.057143
oryza sativa0.055556
LOWER IN root0.054795
germany0.052910
brazil0.052174
canada0.050420
body proper0.048780
biofilm0.047619
LOWER IN biofilm0.047619
skin0.043478
farm0.042857
state of california0.035714
seleniferous0.033333
LOWER IN non-seleniferous0.033333
water treatment plant0.033333
LOWER IN distribution system0.033333
distribution system0.033333
LOWER IN water treatment plant0.033333
uganda0.033333
LOWER IN ceftriaxone0.033333
no ceftriaxone0.033333
negev desert0.033333
heat stressed soil0.033333
other plants0.033333
LOWER IN festuca rubra0.033333
LOWER IN red fescue grass0.033333
galium mollugo0.033333
hedge bedstraw0.033333
onobrychis viciifolia0.033333
common sainfoin0.033333
plantago lanceolata0.033333
ribwort plantain0.033333
prunella vulgaris0.033333
woundwort0.033333
veronica chamaedrys0.033333
germander speedwell0.033333
cambridgeshire0.033333
triturus cristatus0.033333
carnivorous beetle0.033333
raba river0.033333
bembidion varicolor0.033333
southern united states0.033333
aquatic snake0.033333
LOWER IN terrestrial snake0.033333
early flowering stage0.033333
cbd yummy cannabis plant0.033333
hash cannabis plant0.033333
Fraction of dbbact annotations with this term covered by the query
TermScore
seleniferous0.500000
LOWER IN non-seleniferous0.500000
water treatment plant0.500000
LOWER IN distribution system0.500000
distribution system0.500000
LOWER IN water treatment plant0.500000
jiulong river0.500000
uganda0.500000
LOWER IN ceftriaxone0.500000
no ceftriaxone0.500000
negev desert0.500000
heat stressed soil0.500000
boechera stricta0.500000
other plants0.500000
LOWER IN festuca rubra0.500000
LOWER IN red fescue grass0.500000
geranium pratense0.500000
meadow geranium0.500000
LOWER IN other plants0.500000
lathyrus pratensis0.500000
meadow pea-vine0.500000
galium mollugo0.500000
hedge bedstraw0.500000
onobrychis viciifolia0.500000
common sainfoin0.500000
plantago lanceolata0.500000
ribwort plantain0.500000
prunella vulgaris0.500000
woundwort0.500000
veronica chamaedrys0.500000
germander speedwell0.500000
cambridgeshire0.500000
triturus cristatus0.500000
river nile0.500000
depth (water) 50cm0.500000
cairo0.500000
carnivorous beetle0.500000
raba river0.500000
bembidion varicolor0.500000
southern united states0.500000
aquatic snake0.500000
LOWER IN terrestrial snake0.500000
minas gerais state0.500000
campos rupestres0.500000
barbacenia macrantha0.500000
root endosphere0.500000
late flowering stage0.500000
cannabis sativa0.500000
early flowering stage0.500000
LOWER IN cbd shark cannabis plant0.500000
cbd yummy cannabis plant0.500000
flowering stage0.500000
hash cannabis plant0.500000
intact branch0.500000
epiphytic material0.500000
olympic national park0.500000
canopy soil0.500000
severed branch0.500000
temperate rainforest0.500000
robinia pseudoacacia0.500000
reforestation0.500000
30 years0.500000
shaanxi province0.500000
LOWER IN 10 years0.500000
LOWER IN 20 years0.500000
fresh water aquarium0.500000
zebra mussel0.500000
dreissena polymorpha0.500000
LOWER IN dead0.500000
alive0.500000
LOWER IN zebra mussel0.500000
LOWER IN dreissena polymorpha0.500000
aquarium water0.500000
selenium0.333333
site e0.333333
site d0.333333
site b0.333333
site a0.333333
LOWER IN drought environment0.333333
river0.333333
fujian province0.333333
LOWER IN dry season0.333333
wet season0.333333
pneumonia0.333333
sandy loam soil0.333333
state of idaho0.333333
newt0.333333
particles0.333333
beetle0.333333
snake0.333333
loess plateau0.333333
mussel0.333333
LOWER IN mussel0.333333
drinking water0.250000
rice0.250000
depth (soil) 50cm0.250000
irrigated0.250000
depth (water) 1m0.250000
mississippi river0.250000
filtered 2.7um0.250000
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.413793
rhizosphere0.327586
water0.310345
soil0.189655
drinking water0.189655
germany0.172414
river0.120690
fresh water0.120690
china0.103448
canada0.103448
farm0.103448
cannabis sativa0.103448
root0.086207
summer0.068966
wet season0.068966
research facility0.068966
state of idaho0.068966
site a0.051724
depth (soil) 50cm0.051724
jiulong river0.051724
fujian province0.051724
LOWER IN winter0.051724
LOWER IN dry season0.051724
brassicaceae0.051724
boechera stricta0.051724
plant0.051724
whole body0.051724
minas gerais state0.051724
campos rupestres0.051724
brazil0.051724
state of washington0.051724
olympic national park0.051724
robinia pseudoacacia0.051724
reforestation0.051724
30 years0.051724
silt loam0.051724
loess plateau0.051724
shaanxi province0.051724
fresh water aquarium0.051724
site e0.034483
site d0.034483
state of california0.034483
oryza sativa0.034483
rice0.034483
LOWER IN root0.034483
biofilm0.034483
LOWER IN biofilm0.034483
geranium pratense0.034483
meadow geranium0.034483
LOWER IN other plants0.034483
lathyrus pratensis0.034483
meadow pea-vine0.034483
skin0.034483
river nile0.034483
depth (water) 50cm0.034483
cairo0.034483
egypt0.034483
barbacenia macrantha0.034483
root endosphere0.034483
late flowering stage0.034483
LOWER IN cbd shark cannabis plant0.034483
flowering stage0.034483
epiphytic material0.034483
canopy soil0.034483
body proper0.034483
zebra mussel0.034483
dreissena polymorpha0.034483
mussel0.034483
selenium0.017241
seleniferous0.017241
LOWER IN non-seleniferous0.017241
woodland area0.017241
water treatment plant0.017241
LOWER IN distribution system0.017241
site b0.017241
distribution system0.017241
LOWER IN water treatment plant0.017241
control0.017241
LOWER IN drought environment0.017241
autumn0.017241
LOWER IN autumn0.017241
homo sapiens0.017241
hiv infection0.017241
uganda0.017241
bronchoalveolar lavage0.017241
bronchial epithelium0.017241
lung0.017241
LOWER IN ceftriaxone0.017241
no ceftriaxone0.017241
pneumonia0.017241
israel0.017241
sandy loam soil0.017241
negev desert0.017241
ph 7-80.017241
irrigated0.017241
heat stressed soil0.017241
LOWER IN control0.017241
ph 60.017241
LOWER IN leaf0.017241
other plants0.017241
Exp. ID User ID Description Date Region Flag Sequences
109amnondominant united states of america, water, drinking water, site a2017-04-08v4No1 / 17
109amnondominant water, drinking water, united states of america, site d2017-04-08v4No1 / 19
109amnoncommon water, drinking water, united states of america, site b2017-04-08v4No1 / 31
109amnon high in distribution system compared to water treatment plant in united states of america water drinking water site a 2017-04-08v4No1 / 41
258amnonhigher lungs of hiv pneumonia patients not treated with ceftriaxone ( high in no ceftriaxone compared to ceftriaxone in homo sapiens hiv infection uganda bronchoalveolar lavage bronchial epithelium lung pneumonia )2017-11-27v4No1 / 47
109amnoncommon united states of america, water, drinking water, site a2017-04-08v4No1 / 54
109amnon high in water treatment plant compared to distribution system in water drinking water united states of america site e 2017-04-08v4No1 / 58
109amnoncommon water, drinking water, united states of america, site d2017-04-08v4No1 / 67
109amnoncommon water, drinking water, united states of america, site e2017-04-08v4No1 / 80
618amnon high in cbd yummy cannabis plant compared to cbd shark cannabis plant in flowering stage rhizosphere canada farm cannabis sativa 2020-05-04v4No1 / 83
912amnoncommon fresh water aquarium, research facility, whole body, body proper, zebra mussel, dreissena polymorpha, mussel2022-05-27v4No1 / 112
196amnoncommon in biofilm in tap water (common biofilm, water, drinking water, united states of america, biofilm)2017-09-12v4No1 / 121
500amnondecreases when incubating water sample from depth 2100m at depth 0m for one year ( high in early time points compared to depth (water) 0cm late time points in depth (water) 2000-5000m water mediterranean sea depth (water) 2000-3000m sea water )2019-03-05v4No1 / 132
366amnon high in summer wet season compared to winter dry season in river nile water river fresh water depth (water) 50cm cairo egypt 2018-08-31v4No1 / 148
618amnon high in hash cannabis plant compared to cbd shark cannabis plant in flowering stage rhizosphere canada farm cannabis sativa 2020-05-04v4No1 / 152
912amnon high in aquarium water fresh water compared to body proper whole body mussel zebra mussel dreissena polymorpha in fresh water aquarium state of minnesota research facility united states of america 2022-05-27v4No1 / 154
196amnoncommon water, drinking water, united states of america2017-09-12v4No1 / 178
196amnonhigher in water compared to biofilm ( high in water compared to biofilm biofilm in drinking water united states of america )2017-09-12v4No1 / 223
515amnoncommon carnivorous beetle, river, poland, raba river, whole body, beetle, bembidion varicolor2019-04-18v4No1 / 308
254amnoncommon river, water, fresh water, depth (soil) 50cm, jiulong river, fujian province, china2017-11-23v4No1 / 347
618amnoncommon late flowering stage, canada, farm, root, root endosphere, cannabis sativa2020-05-04v4No1 / 352
309amnon high in other plants compared to festuca rubra red fescue grass in rhizosphere germany 2018-04-05v4No1 / 383
912amnon high in alive compared to dead in zebra mussel dreissena polymorpha fresh water aquarium mussel whole body body proper research facility 2022-05-27v4No1 / 398
263amnonhigher in heat stressed soil (65C) compared to control ( high in heat stressed soil compared to control in soil israel sandy loam soil negev desert ph 7-8 irrigated research facility )2017-12-11v4No1 / 402
366amnoncommon river nile, water, river, fresh water, depth (water) 50cm, cairo, egypt, summer, wet season2018-08-31v4No1 / 474
813amnoncommon intact branch, epiphytic material, united states of america, state of washington, olympic national park, canopy soil, soil2021-06-22v4No1 / 475
254amnon high in summer wet season autumn compared to winter dry season in river water fresh water depth (soil) 50cm jiulong river fujian province china 2017-11-23v4No1 / 571
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, root endosphere, root2019-08-17v4No1 / 575
254amnon high in summer wet season compared to winter dry season autumn in river water fresh water depth (soil) 50cm jiulong river fujian province china 2017-11-23v4No1 / 581
813amnoncommon severed branch, epiphytic material, united states of america, state of washington, olympic national park, canopy soil, soil2021-06-22v4No1 / 633
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, rhizosphere2019-08-17v4No1 / 651
309amnon high in lathyrus pratensis meadow pea-vine compared to other plants in rhizosphere germany 2018-04-05v4No1 / 680
309amnon high in geranium pratense meadow geranium compared to other plants in rhizosphere germany 2018-04-05v4No1 / 688
813amnoncommon forested area, temperate rainforest, united states of america, state of washington, olympic national park, soil2021-06-22v4No1 / 740
618amnoncommon late flowering stage, rhizosphere, canada, farm, cannabis sativa2020-05-04v4No1 / 819
266amnoncommon in roots in JAM garden (common brassicaceae, boechera stricta, plant, united states of america, state of idaho, root)2017-12-19v4No1 / 843
618amnoncommon early flowering stage, rhizosphere, canada, farm, cannabis sativa2020-05-04v4No1 / 873
548amnoncommon minas gerais state, campos rupestres, brazil, rock2019-08-17v4No1 / 924
266amnoncommon in roots in MAH garden (common brassicaceae, boechera stricta, plant, united states of america, state of idaho, root)2017-12-19v4No1 / 1110
171amnon high in control compared to drought environment in soil united states of america state of california rhizosphere oryza sativa rice 2017-07-25v4No1 / 1164
309amnoncommon rhizosphere, germany, prunella vulgaris, woundwort2018-04-05v4No1 / 1217
309amnoncommon lathyrus pratensis, rhizosphere, germany, meadow pea-vine2018-04-05v4No1 / 1296
266amnonCommon in soil from MAH garden (common soil, united states of america, state of idaho, ph 6)2017-12-18v4No1 / 1299
309amnoncommon rhizosphere, germany, onobrychis viciifolia, common sainfoin2018-04-05v4No1 / 1323
309amnoncommon rhizosphere, germany, plantago lanceolata, ribwort plantain2018-04-05v4No1 / 1386
309amnoncommon rhizosphere, germany, geranium pratense, meadow geranium2018-04-05v4No1 / 1434
309amnoncommon rhizosphere, germany, galium mollugo, hedge bedstraw2018-04-05v4No1 / 1599
536amnon high in aquatic snake compared to terrestrial snake in snake skin united states of america southern united states 2019-07-28v4No1 / 1772
309amnoncommon rhizosphere, germany, veronica chamaedrys, germander speedwell2018-04-05v4No1 / 1788
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in newt adult skin cambridgeshire triturus cristatus united kingdom )2018-07-30v4No1 / 1834
76amnonhigher in seleniferous soil compared to non-seleniferous soil ( high in selenium seleniferous compared to non-seleniferous in soil rhizosphere united states of america woodland area )2017-02-28v4No1 / 2259
443amnon high in particles filtered 2.7um compared to free floating filtered 0.2um in water river fresh water depth (water) 1m united states of america mississippi river 2019-01-07v4No1 / 2266
618amnon high in rhizosphere compared to root endosphere root in canada farm cannabis sativa 2020-05-04v4No1 / 3134
837sheryoHigher in soil after 30 years compared to 20 years of reforestation with Black locust trees, shaanxi, China ( high in 30 years compared to 20 years in robinia pseudoacacia reforestation silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 3936
837sheryoHigher in soil after 30 years compared to 10 years of reforestation with Black locust trees, shaanxi, China ( high in 30 years compared to 10 years in robinia pseudoacacia reforestation silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 5245
837sheryoHigher in soil after 30 years reforestation with Black locust trees compared to agricultural feild, shaanxi, China ( high in robinia pseudoacacia reforestation 30 years compared to zea mays triticum aestivum agricultural field in silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 5596
266amnon high in root compared to leaf in brassicaceae boechera stricta plant united states of america state of idaho 2017-12-19v4No1 / 5886
171amnonlower in roots compared to rhizosphere soil in rice ( high in rhizosphere soil compared to root in united states of america state of california oryza sativa rice )2017-07-25v4No1 / 7628

Problems / suggestions? Please email info AT dbbact DOT org