Search result for sequence:
TACGGAGGGTGCAAGCGTTATCCGGATTCACTGGGTTTAAAGGGTGCGTAGGCGGGCAGGTAAGTCCGTGGTGAAATCTCTGAGCTTAACTCAGAAACTGCCATGGATACTATTTGTCTTGAATATTGTGGAGGTAAGCGGAATATGTCA
common ontology terms
term enrichment score
TermScore
soil0.530946
rhizosphere0.248583
triticum aestivum0.163934
agricultural field0.135021
china0.125251
zea mays0.125000
wheat0.123418
kellogg biological station0.112676
mesic type hapludalf0.112676
kalamazoo loam0.112676
depth (soil) 0-20cm0.111415
ph 60.107056
antarctica0.106667
germany0.105909
east antarctica0.104265
nunatak0.104265
depth (soil) 2cm0.104265
united states of america0.100163
yunwushan national natural grassland protection zone0.095694
ningxia province0.095694
calci-orthic aridisol0.095694
haplic calcisol0.095694
grazing exclusion0.095694
crop rotation0.095694
bernburg0.095694
glycine max0.094192
depth (soil) 0-10cm0.082474
ph 7.60.080321
ph 70.079077
state of new york0.078740
united states0.078049
nicollet soil series0.078049
des moines0.078049
state of michigan0.077670
state of idaho0.075117
iowa0.075117
permafrost0.068966
silt loam0.066667
root0.065041
coarse-loamy soil0.059701
restored prairie0.059701
panicum virgatum0.059701
robinia pseudoacacia0.059701
reforestation0.059701
shaanxi province0.059701
agricultural feature0.058824
desert0.058537
depth (soil) 0-5cm0.057971
depth (soil) 0-15cm0.057971
loess plateau0.057971
bulk soil0.057143
switzerland0.055556
north china plain0.050251
svalbard archipelago0.050251
lushan mountain0.050251
27-35 years of grazing exclusion0.050251
lettuce0.050251
luvisol0.050251
grand river watershed0.050251
rare charitable research reserve0.050251
state of california0.049383
depth (soil) 10-25cm0.049020
haplic luvisol0.049020
pot expreiment0.047847
mexico0.047281
forested area0.046729
cambridge0.046729
jiangxi province0.045662
province of ontario0.045662
kingdom of norway0.043668
canada0.043011
topsoil0.042735
merlot0.040609
grapevine0.040609
day 820.040609
miscanthus0.040609
0-9 years of grazing exclusion0.040609
glacier0.040201
vitis vinifera0.039801
corn0.039801
LOWER IN zea mays0.038278
kingdom of denmark0.035556
winter0.035211
LOWER IN rhizosphere0.031788
heilongjiang province0.031008
mollisol0.031008
myrtillocactus geometrizans0.030769
opuntia robusta0.030769
taxus0.030769
temperate0.030769
denali national park and preserve0.030769
boechera stricta0.030769
orchard0.030769
minas gerais state0.030769
campos rupestres0.030769
citrullus lanatus0.030769
co culture with wheat (triticum aestivum l.)0.030769
low sodicity0.030769
salic solonetz0.030769
da'an station0.030769
Fraction of dbbact annotations with this term covered by the query
TermScore
ph 5.60.666667
ph 60.666667
heilongjiang province0.666667
mollisol0.666667
wheat0.600000
ph 70.600000
maryland county0.500000
field soil0.500000
seleniferous0.500000
non-seleniferous0.500000
central park0.500000
merlot0.500000
grapevine0.500000
myrtillocactus geometrizans0.500000
opuntia robusta0.500000
ph 6-6.50.500000
root zone soil0.500000
taxus0.500000
taxus media0.500000
taxus cuspidata0.500000
temperate0.500000
LOWER IN taxus mairei0.500000
LOWER IN southeast china0.500000
tomato0.500000
slit loam soil0.500000
slit loam0.500000
denali national park and preserve0.500000
terminus of glacier0.500000
LOWER IN top of glacier0.500000
depth 2.5cm0.500000
quarry0.500000
greenschist0.500000
stratovolcano0.500000
arachis hypogaea0.500000
peanut0.500000
LOWER IN soilwater0.500000
ph 5.50.500000
boechera stricta0.500000
grassland0.500000
steppe0.500000
alpine soil0.500000
north china plain0.500000
ph>80.500000
ph>7, ph<80.500000
ph>6, ph<70.500000
ph>5, ph<60.500000
state of utah0.500000
depth 1cm0.500000
soil crust0.500000
red fescue grass0.500000
festuca rubra0.500000
LOWER IN other plants0.500000
LOWER IN meadow pea-vine0.500000
LOWER IN lathyrus pratensis0.500000
other plants0.500000
plantago lanceolata0.500000
ribwort plantain0.500000
LOWER IN germander speedwell0.500000
LOWER IN veronica chamaedrys0.500000
galium mollugo0.500000
hedge bedstraw0.500000
geranium pratense0.500000
meadow geranium0.500000
lathyrus pratensis0.500000
meadow pea-vine0.500000
onobrychis viciifolia0.500000
common sainfoin0.500000
prunella vulgaris0.500000
woundwort0.500000
veronica chamaedrys0.500000
germander speedwell0.500000
svalbard archipelago0.500000
permafrost0.500000
depth 100-150cm0.500000
depth 150-200cm0.500000
LOWER IN permafrost transition layer0.500000
LOWER IN depth 100-150cm0.500000
LOWER IN depth 150-200cm0.500000
agave0.500000
agave deserti0.500000
guanajuato0.500000
agave salmiana0.500000
orchard0.500000
LOWER IN mature soil0.500000
yellow brown soil0.500000
heteromeles arbutifolia0.500000
ceanothus jepsonii0.500000
sandstone0.500000
grand staircase-escalante national park0.500000
depth (soil) 0-1cm0.500000
nida basin0.500000
herbivorous beetle0.500000
crioceris duodecimpunctata0.500000
LOWER IN detritivorous beetle0.500000
LOWER IN bulgaria0.500000
carnivorous beetle0.500000
carabidae0.500000
LOWER IN staphylinidae0.500000
east antarctica0.500000
nunatak0.500000
Fraction of annotations for the query sequences containing the term
TermScore
soil0.767196
china0.275132
united states of america0.264550
rhizosphere0.195767
germany0.121693
triticum aestivum0.105820
depth (soil) 0-20cm0.089947
agricultural field0.084656
zea mays0.074074
wheat0.068783
antarctica0.063492
state of michigan0.063492
kellogg biological station0.063492
mesic type hapludalf0.063492
kalamazoo loam0.063492
ph 60.058201
east antarctica0.058201
nunatak0.058201
depth (soil) 2cm0.058201
state of new york0.052910
glycine max0.052910
yunwushan national natural grassland protection zone0.052910
ningxia province0.052910
calci-orthic aridisol0.052910
haplic calcisol0.052910
grazing exclusion0.052910
crop rotation0.052910
ph 7.60.052910
bernburg0.052910
depth (soil) 0-10cm0.047619
ph 70.042328
state of idaho0.042328
united states0.042328
nicollet soil series0.042328
des moines0.042328
iowa0.042328
root0.037037
agricultural feature0.037037
permafrost0.037037
silt loam0.037037
bulk soil0.031746
canada0.031746
desert0.031746
state of california0.031746
depth (soil) 0-5cm0.031746
coarse-loamy soil0.031746
depth (soil) 0-15cm0.031746
restored prairie0.031746
panicum virgatum0.031746
robinia pseudoacacia0.031746
reforestation0.031746
loess plateau0.031746
shaanxi province0.031746
switzerland0.031746
mexico0.026455
north china plain0.026455
winter0.026455
kingdom of norway0.026455
svalbard archipelago0.026455
jiangxi province0.026455
lushan mountain0.026455
forested area0.026455
topsoil0.026455
depth (soil) 10-25cm0.026455
27-35 years of grazing exclusion0.026455
haplic luvisol0.026455
lettuce0.026455
pot expreiment0.026455
luvisol0.026455
grand river watershed0.026455
province of ontario0.026455
cambridge0.026455
rare charitable research reserve0.026455
merlot0.021164
vitis vinifera0.021164
grapevine0.021164
LOWER IN rhizosphere0.021164
glacier0.021164
plant0.021164
day 820.021164
corn0.021164
miscanthus0.021164
0-9 years of grazing exclusion0.021164
LOWER IN zea mays0.021164
kingdom of denmark0.021164
myrtillocactus geometrizans0.015873
opuntia robusta0.015873
cactus0.015873
semi-arid0.015873
tree0.015873
taxus0.015873
northeast china0.015873
temperate0.015873
alaska0.015873
denali national park and preserve0.015873
surface0.015873
debris0.015873
brassicaceae0.015873
boechera stricta0.015873
depth (soil) 20-30cm0.015873
Exp. ID User ID Description Date Region Flag Sequences
527amnondominant soil, antarctica, east antarctica, nunatak, depth (soil) 2cm, lorentzenpiggen2019-07-14v4No1 / 8
527amnondominant soil, antarctica, east antarctica, nunatak, depth (soil) 2cm, grunehogna2019-07-14v4No1 / 12
527amnondominant soil, antarctica, east antarctica, nunatak, depth (soil) 2cm, robertskollen2019-07-14v4No1 / 12
527amnondominant soil, antarctica, east antarctica, nunatak, depth (soil) 2cm, brugdedalen2019-07-14v4No1 / 12
527amnondominant soil, antarctica, east antarctica, nunatak, valterkulten, depth (soil) 2cm2019-07-14v4No1 / 15
174amnonhigh freq. in debris covered glacier (dominant alaska, united states of america, denali national park and preserve, glacier, surface, debris)2017-07-27v4No1 / 19
600sheryodecearses after 12 days of biochar ammendment in soil ( high in day 1 compared to day 12 in depth (soil) 0-5cm state of new york soil united states of america coarse-loamy soil ph 6 biochar )2020-03-27v4No1 / 30
764sheryoHigh in rapeseed pre-crop compared to maize pre-crop in leoss soil in wheat field grown under conservation tillage and crop rotation in germany ( high in brassica napus rapeseed pre-crop compared to maize pre-crop zea mays in ph 7.6 crop rotation cultivator tillage conservation tillage triticum aestivum soil germany bernburg )2021-04-12v3No1 / 30
764sheryoHigh in conventional tillage compared to conservation tillage in leoss soil in wheat field grown under crop rotation with maize pre-crop in germany ( high in conventional tillage mouldboard plough compared to conservation tillage cultivator tillage in maize pre-crop ph 7.6 crop rotation triticum aestivum soil germany bernburg )2021-04-12v3No1 / 72
426amnoncommon soil, tundra, permafrost, russia, nenets autonomous okrug2018-12-08v4No1 / 81
527amnoncommon soil, antarctica, east antarctica, nunatak, depth (soil) 2cm, robertskollen2019-07-14v4No1 / 91
527amnoncommon soil, antarctica, east antarctica, nunatak, depth (soil) 2cm, vassdalen2019-07-14v4No1 / 106
426amnon high in sand compared to mature soil in soil tundra permafrost russia nenets autonomous okrug 2018-12-08v4No1 / 125
347amnoncommon kingdom of norway, svalbard archipelago, permafrost, soil, depth 150-200cm2018-07-15v4No1 / 126
675sheryoHigher in watermelon rhizosphere soil inoculated with fusarium oxysporum f. sp. niveum compared to uninoculated watermelon rhizosphere soil ( high in inoculated with fusarium oxysporum f. sp. niveum compared to un-inoculated in co culture with wheat (triticum aestivum l.) ph 7 citrullus lanatus rhizosphere china )2028-02-22v4No1 / 136
514amnoncommon united states of america, state of utah, sandstone, grand staircase-escalante national park, desert, depth (soil) 0-1cm2019-03-25v4No1 / 139
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, crioceris duodecimpunctata2019-04-18v4No1 / 157
347amnoncommon kingdom of norway, svalbard archipelago, permafrost, soil, depth 100-150cm2018-07-15v4No1 / 173
527amnoncommon soil, antarctica, east antarctica, nunatak, depth (soil) 2cm, brugdedalen2019-07-14v4No1 / 200
224amnoncommon united states of america, state of oregon, snow field, glacier, stratovolcano, snow2017-10-26v4No1 / 204
515amnon high in herbivorous beetle poland compared to detritivorous beetle bulgaria in whole body beetle 2019-04-19v4No1 / 205
279amnoncommon grassland, steppe, mongolia, soil, china2018-01-24v4No1 / 235
279amnoncommon grassland, soil, alpine soil, tibetan plateau, china2018-01-24v4No1 / 253
259amnonhigher in fertilized soil (npk) compared to non-fertilized ( high in fertilized soil compared to non-fertilized soil in soil rhizosphere ph 5 arachis hypogaea peanut china )2017-12-02v4No1 / 280
527amnoncommon soil, antarctica, east antarctica, nunatak, depth (soil) 2cm, lorentzenpiggen2019-07-14v4No1 / 280
174amnoncommon in debris covered glacier (common alaska, united states of america, denali national park and preserve, glacier, surface, debris)2017-07-27v4No1 / 294
824sheryoHigher soil at 40-60cm depth after 27-35 years compared to after 0-9 years of grazing exclusion, Ningxia china ( high in 27-35 years of grazing exclusion compared to 0-9 years of grazing exclusion in yunwushan national natural grassland protection zone ningxia province calci-orthic aridisol haplic calcisol grazing exclusion china soil )2021-08-08v4No1 / 299
882amnoncommon antarctic hairgrass, deschampsia antarctica, king george island, antarctica, rhizosphere2022-03-20v3No1 / 299
174amnonlower farther away from glacier terminus ( high in terminus of glacier compared to top of glacier in alaska united states of america denali national park and preserve glacier surface debris )2017-07-27v4No1 / 310
309amnon high in other plants compared to meadow pea-vine lathyrus pratensis in rhizosphere germany 2018-04-05v4No1 / 316
129amnoncommon mexico, myrtillocactus geometrizans, opuntia robusta, cactus, rhizosphere, semi-arid2017-04-15v4No1 / 338
762sheryoHigher in bulk soil of a pot experiment with lettuce planted in npk fertilized compared to organic fertilized haplic luvisol Switzerland ( high in npk fertilization mineral fertilization compared to organic fertilization bio-dynamic fertilizer manure fertilization manured soil in therwil switzerland haplic luvisol soil bulk soil lettuce pot expreiment )2021-04-07v3No1 / 347
527amnoncommon soil, antarctica, east antarctica, nunatak, valterkulten, depth (soil) 2cm2019-07-14v4No1 / 364
527amnoncommon soil, antarctica, east antarctica, nunatak, depth (soil) 2cm, grunehogna2019-07-14v4No1 / 367
29amnon high in seed compared to seedling in brassica oleracea french republic 2016-12-05v4No1 / 379
583amnoncommon soil, mountain, switzerland, depth (soil) 0-10cm, elevation 2000-3000m, canton of graubunden, calcareous parent material, ph 7-82020-01-28v3No2 / 830
309amnon high in other plants compared to germander speedwell veronica chamaedrys in rhizosphere germany 2018-04-05v4No1 / 404
360amnoncommon desert, soil, mexico, guanajuato2018-08-21v4No1 / 437
360amnoncommon desert, soil, rhizosphere, agave, agave salmiana, mexico, guanajuato2018-08-21v4No1 / 484
205amnonlower in depth 15cm compared to 2.5cm in Ely Greenstone rock piles ( high in depth 2.5cm compared to depth depth (soil) 15cm in rock united states of america quarry state of minnesota ph 7 greenschist )2017-10-03v4No1 / 499
801sheryoHigher at depth 0-15cm compared to depth 60-90cm in corn agriculture fields, Iowa USA ( high in depth (soil) 0-15cm compared to depth (soil) 60-90cm in kanawha nicollet soil series des moines united states agricultural field iowa zea mays soil )2021-06-15v4No1 / 501
764sheryocommon in leoss soil in wheat field grown under crop rotation with rapeseed pre-crop in germany (common bernburg, germany, soil, triticum aestivum, crop rotation, ph 7.6, brassica napus, rapeseed pre-crop)2021-04-12v3No2 / 1129
764sheryoCommon in leoss soil in wheat field grown under conservation tillage and crop rotation in germany (common ph 7.6, crop rotation, cultivator tillage, conservation tillage, triticum aestivum, soil, germany, bernburg)2021-04-12v3No2 / 1140
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, root endosphere, root2019-08-17v4No1 / 575
667amnoncommon depth (soil) 0-20cm, ph 4.5, elevation 500-600m, jiangxi province, lushan mountain, china, forested area, topsoil, soil2020-09-25v4No1 / 575
762sheryoHigh in bulk soil comparedc to rhizosphere of a pot experiment with lettuce planted in haplic luvisol Switzerland ( high in bulk soil compared to rhizosphere in thyrow switzerland haplic luvisol pot expreiment lettuce soil )2021-04-08v3No1 / 577
762sheryoHigh in bulk soil compared to rhizosphere of a pot experiment with lettuce planted in albic luvisol Germany ( high in bulk soil compared to rhizosphere in thyrow albic luvisol germany haplic luvisol pot expreiment lettuce soil )2021-04-08v3No1 / 578
764sheryoCommon in leoss soil in wheat field grown under conventional tillage and crop rotation in germany (common crop rotation, triticum aestivum, ph 7.6, mouldboard plough, conventional tillage, loess chernozem, bernburg, germany, soil)2021-04-12v3No2 / 1213
764sheryoCommon in leoss soil in wheat field grown under crop rotation with maize pre-crop in germany (common maize pre-crop, ph 7.6, crop rotation, triticum aestivum, soil, germany, bernburg)2021-04-12v3No2 / 1225
415amnoncommon rhizosphere, soil, citrus, orchard, south africa, cultivated environment2018-11-27v4No1 / 600
762sheryoCommon in bulk soil of a pot experiment with lettuce planted in organic fertilized haplic luvisol Switzerland (common ph 6.6, manured soil, manure fertilization, organic fertilization, bio-dynamic fertilizer, therwil, switzerland, haplic luvisol, soil, bulk soil, lettuce, pot expreiment)2021-04-07v3No1 / 602
667amnoncommon depth (soil) 0-20cm, jiangxi province, lushan mountain, china, forested area, ph 4.5, elevation 200-300m, topsoil, soil2020-09-25v4No1 / 613
786sheryoHigher at 0-30cm depth compared to 30-60cm depth in flood plain soil near cosumnes river, california ( high in depth (soil) 0-30 cm depth (soil) 0-20cm compared to depth 30-60cm in flood plain soil united states of america state of california sacramento cosumnes river preserve )2021-09-13v3No1 / 627
667amnoncommon depth (soil) 0-20cm, coniferous forest biome, ph 4-4.5, elevation 1000-1100m, jiangxi province, lushan mountain, china, forested area, topsoil, soil2020-09-25v4No1 / 630
813amnoncommon severed branch, epiphytic material, united states of america, state of washington, olympic national park, canopy soil, soil2021-06-22v4No1 / 633
360amnoncommon desert, soil, state of california2018-08-21v4No1 / 637
762sheryoCommon in bulk soil of a pot experiment with lettuce planted in npk fertilized haplic luvisol Switzerland (common npk fertilization, mineral fertilization, ph 5.6, therwil, switzerland, haplic luvisol, soil, bulk soil, lettuce, pot expreiment)2021-04-07v3No1 / 648
360amnoncommon agave, desert, state of california, agave deserti, leaf, leaf surface2018-08-21v4No1 / 649
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, rhizosphere2019-08-17v4No1 / 651
842sheryoCommon in soil depth of 30-45cm in a zea mays agricultural field in Ontario, Canada (common depth 30-45cm, zea mays, preston flats, agricultural field, soil, luvisol, grand river watershed, canada, province of ontario, cambridge, rare charitable research reserve)2021-11-14v3No1 / 676
100amnoncommon soil, urban biome, park, new york city, central park2017-04-03v4No1 / 685
667amnoncommon depth (soil) 0-20cm, elevation 800-900m, ph 4.5, jiangxi province, lushan mountain, china, forested area, topsoil, soil2020-09-25v4No1 / 694
347amnoncommon kingdom of norway, svalbard archipelago, permafrost, soil, depth (soil) 20-30cm2018-07-15v4No1 / 698
134amnon high in taxus media taxus cuspidata northeast china temperate compared to taxus mairei southeast china subtropical in rhizosphere tree taxus china 2017-04-16v4No1 / 734
829sheryoCommon in soil depth of 0-12m in Alfisol soil, Dekalb, Illinois, united states of america (common depth 0-12cm, sandy loam, sandy loam soil, hapludalf, alfisol, united states of america, soil, state of illinois, illinois, dekalb county)2021-08-26v3No1 / 737
415amnoncommon rhizosphere, soil, citrus, australia, orchard, cultivated environment2018-11-27v4No1 / 743
600sheryoDecreases after 12 days of stover ammendment in soil ( high in day 1 compared to day 12 in depth (soil) 0-5cm state of new york soil united states of america coarse-loamy soil ph 6 stover ammendment soil )2020-03-27v4No1 / 747
829sheryoCommon in soil depth of 44-108cm in Alfisol soil, Dekalb, Illinois, united states of america (common depth 44-108cm, sandy loam, sandy loam soil, hapludalf, alfisol, united states of america, soil, state of illinois, illinois, dekalb county)2021-08-26v3No1 / 751
667amnoncommon depth (soil) 0-20cm, ph 4, elevation 1300-1400m, coniferous forest biome, jiangxi province, lushan mountain, china, forested area, topsoil, soil2020-09-25v4No1 / 777
309amnon high in red fescue grass festuca rubra compared to other plants in rhizosphere germany 2018-04-05v4No1 / 781
662amnon high in dry compared to irrigated in neve yaar depth (soil) 0-10cm soil agricultural field israel 2020-09-21v3No1 / 782
821sheryoHigher at 25-50cm depth compared to 50-100cm depth in soil in Michigan USA ( high in depth (soil) 25-50cm compared to depth 50-100m in restored prairie corn miscanthus panicum virgatum kellogg biological station mesic type hapludalf kalamazoo loam state of michigan soil united states of america )2021-08-05v4No1 / 784
347amnon high in depth (soil) 20-30cm compared to depth (soil) 0-20cm permafrost transition layer in kingdom of norway svalbard archipelago permafrost soil 2018-07-15v4No1 / 788
829sheryoCommon in soil depth of 0-27cm in Mollisol soil, Dekalb, Illinois, united states of america (common depth 0-27cm, dekalb county, illinois, state of illinois, mollisol, silt loam, soil, united states of america)2021-08-26v3No1 / 798
309amnon high in plantago lanceolata ribwort plantain compared to other plants in rhizosphere germany 2018-04-05v4No1 / 800
801sheryoCommon at depth 15-30cm in corn and soybean agriculture fields, Iowa USA (common ph 6, depth (soil) 15-30cm, subsurface drainage, glycine max, kelley, nicollet soil series, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 841
266amnoncommon in roots in JAM garden (common brassicaceae, boechera stricta, plant, united states of america, state of idaho, root)2017-12-19v4No1 / 843
801sheryoCommon at depth 0-15cm in corn agriculture fields, Iowa USA (common kanawha, ph 7.1, nicollet soil series, depth (soil) 0-15cm, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 862
129amnoncommon ph 6-6.5, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, soil2017-04-15v4No1 / 884
479amnoncommon rhizosphere, united states of america, state of california, ph 6-7, ceanothus jepsonii2019-02-05v4No1 / 900
801sheryoCommon in soybean and corn agriculture fields at depth 15-30cm, Iowa USA (common ph 7.4, depth (soil) 15-30cm, united states, nicollet soil series, glycine max, zea mays, ames, des moines, iowa, agricultural field, soil)2021-06-15v4No1 / 905
548amnoncommon minas gerais state, campos rupestres, brazil, rock2019-08-17v4No1 / 924
842sheryoCommon in soil depth of 15-30cm in a zea mays agricultural field in Ontario, Canada (common depth 15-30cm, zea mays, preston flats, agricultural field, soil, luvisol, grand river watershed, canada, province of ontario, cambridge, rare charitable research reserve)2021-11-14v3No1 / 944
444amnoncommon in uncultivated soil plot (common yellow brown soil, nanjing city prefecture, soil, china)2019-01-07v4No1 / 946
37amnonlower in tomato plant leaves compared to plastic control ( high in control compared to solanum lycopersicum in maryland county leaf )2016-12-09v4No1 / 950
129amnoncommon ph 6-6.5, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, soil, root zone soil2017-04-15v4No1 / 968
842sheryoCommon in soil depth of 30-45cm in a Decomissioned Agricultural Field in Ontario, Canada (common depth 30-45cm, luvisol, dipsacus fullonum, solidago, apocynum, daucus carota, decomissioned agricultural field, meadow ecosystem, grand river watershed, rare charitable research reserve, cambridge, province of ontario, canada, soil)2021-11-14v3No1 / 970
821sheryoCommon in soil of switchgrass field at 25-50cm depth, Michigan USA (common depth (soil) 25-50cm, kellogg biological station, mesic type hapludalf, kalamazoo loam, panicum virgatum, state of michigan, soil, united states of america)2021-08-03v4No1 / 974
821sheryoCommon in soil of switchgrass field at 25-50cm depth, Michigan USA (common panicum virgatum, depth (soil) 25-50cm, kellogg biological station, mesic type hapludalf, kalamazoo loam, state of michigan, soil, united states of america)2021-08-03v4No1 / 974
266amnoncommon in soil from MIL garden (common soil, united states of america, state of idaho, ph 6.5)2017-12-18v4No1 / 980
675sheryoCommon in watermelon rhizosphere soil (common co culture with wheat (triticum aestivum l.), un-inoculated, ph 7, citrullus lanatus, rhizosphere, china)2028-02-22v4No1 / 980
610sheryoCommon in agricultural field soil amended with straw (common straw, triticum aestivum, ph 7, wheat, kingdom of denmark, agricultural field, soil)2020-04-21v3No1 / 998
479amnoncommon rhizosphere, united states of america, state of california, heteromeles arbutifolia, ph 6-72019-02-05v4No1 / 1006
610sheryoCommon in agricultural field soil amended with low biochar (common low biochar, triticum aestivum, ph 7, wheat, kingdom of denmark, agricultural field, soil)2020-04-21v3No1 / 1009
824sheryoHigher at 20-40cm depth compared to 40-60cm depth in soil after grazing exclusion, Ningxia china ( high in depth 20-40cm compared to depth 40-60cm in yunwushan national natural grassland protection zone ningxia province calci-orthic aridisol haplic calcisol grazing exclusion china soil )2021-08-08v4No1 / 1025
266amnoncommon in soil from PAR garden (common soil, united states of america, state of idaho, ph 5.5)2017-12-18v4No1 / 1032
768sheryoCommon in maize fields in Brittany, France (common zea mays, maize field, cambisol, bretagne region, french republic, soil)2021-04-18v3No1 / 1034
791sheryoCommon at 0cm depth in low saline low sodicity soil in China (common depth (soil) 0-20cm, ph 8.5, depth 0cm, low salinity, low sodicity, soil, salic solonetz, da'an station, china, songnen plain)2021-06-07v4No1 / 1035
801sheryoHigher at depth 0-15cm compared to depth 60-90cm in corn and soybean agriculture fields, Iowa USA ( high in depth (soil) 0-15cm compared to depth (soil) 60-90cm in subsurface drainage glycine max kelley nicollet soil series des moines united states agricultural field iowa zea mays soil )2021-06-16v4No1 / 1036
842sheryoHigher in soil depth of 15-30cm compared to soil depth of 0-15cm in a Decomissioned Agricultural Field in Ontario, Canada ( high in depth 15-30cm compared to depth 0-15cm in luvisol dipsacus fullonum solidago apocynum daucus carota decomissioned agricultural field meadow ecosystem grand river watershed rare charitable research reserve cambridge province of ontario canada soil )2021-11-14v3No1 / 1044
786sheryocommon in flood plain soil near cosumnes river, california, at 0-30cm depth (common depth (soil) 0-30 cm, depth (soil) 0-20cm, flood plain, soil, united states of america, state of california, sacramento, cosumnes river preserve)2021-05-18v3No1 / 1048
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, china, cultivated environment2018-12-02v4No1 / 1049
610sheryoCommon in agricultural field soil (common triticum aestivum, ph 7, wheat, kingdom of denmark, agricultural field, soil)2020-04-21v3No1 / 1053
610sheryoCommon in agricultural field soil amended with high biochar (common soil, agricultural field, kingdom of denmark, wheat, ph 7, high biochar, triticum aestivum)2020-04-21v3No1 / 1079
347amnon high in depth (soil) 20-30cm compared to depth 100-150cm depth 150-200cm in kingdom of norway svalbard archipelago permafrost soil 2018-07-15v4No1 / 1080
791sheryoCommon at 40cm depth in low saline low sodicity soil in China (common depth (soil) 40cm, ph 9, low salinity, low sodicity, soil, salic solonetz, da'an station, china, songnen plain)2021-06-08v4No1 / 1085
801sheryoHigher at depth 0-15cm compared to depth 60-90cm in soybean and corn agriculture fields , Iowa USA ( high in depth (soil) 0-15cm compared to depth (soil) 60-90cm in united states nicollet soil series glycine max zea mays ames des moines iowa agricultural field soil )2021-06-15v4No1 / 1102
414amnoncommon soil, heilongjiang province, agricultural feature, triticum aestivum, glycine max, zea mays, black soil, mollisol, npk fertilizer, ph<6, china2018-11-26v4No1 / 1105
101amnoncommon state of new york, merlot, vitis vinifera, grapevine, united states of america, root2017-04-03v4No1 / 1106
824sheryocommon in soil after 0-9 years of grazing exclusion at 40-60cm depth, Ningxia china (common 0-9 years of grazing exclusion, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, depth 40-60cm, china, soil)2021-08-08v4No1 / 1113
515amnon high in carabidae compared to staphylinidae in whole body beetle carnivorous beetle river poland 2019-04-19v4No1 / 1130
146amnon high in soil compared to rhizosphere in united states of america solanum lycopersicum tomato slit loam ph 6 2017-04-20v4No1 / 1135
134amnoncommon rhizosphere, tree, taxus, northeast china, temperate, taxus cuspidata, china2017-04-16v4No1 / 1141
146amnoncommon united states of america, solanum lycopersicum, tomato, soil, slit loam soil, ph 62017-04-20v4No1 / 1144
842sheryoCommon in soil depth of 0-15cm in a zea mays agricultural field in Ontario, Canada (common depth 0-15cm, zea mays, preston flats, agricultural field, soil, luvisol, grand river watershed, canada, province of ontario, cambridge, rare charitable research reserve)2021-11-14v3No1 / 1147
791sheryoCommon at 20cm depth in low saline low sodicity soil in China (common ph 9, depth 20cm, ph 8.5, low salinity, low sodicity, soil, salic solonetz, da'an station, china, songnen plain)2021-06-08v4No1 / 1155
801sheryoCommon at depth 0-15cm in corn and soybean agriculture fields, Iowa USA (common subsurface drainage, ph 6.2, depth (soil) 0-15cm, glycine max, kelley, nicollet soil series, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 1202
309amnoncommon rhizosphere, germany, prunella vulgaris, woundwort2018-04-05v4No1 / 1217
801sheryoCommon in soybean and corn agriculture fields at depth 0-15cm, Iowa USA (common united states, ph 7.5, nicollet soil series, depth (soil) 0-15cm, glycine max, zea mays, ames, des moines, iowa, agricultural field, soil)2021-06-15v4No1 / 1226
824sheryoCommon in soil after 27-35 years of grazing exclusion at 40-60cm depth, Ningxia china (common 27-35 years of grazing exclusion, depth 40-60cm, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, china, soil)2021-08-08v4No1 / 1232
821sheryoCommon in soil of restored prairie at 10-25cm depth, Michigan USA (common depth (soil) 10-25cm, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-07-28v4No1 / 1241
134amnoncommon rhizosphere, tree, taxus, taxus media, northeast china, temperate, china2017-04-16v4No1 / 1251
298amnoncommon soil, desert, united states of america, state of utah, depth 1cm, soil crust2018-02-20v4No1 / 1265
675sheryoCommon in watermelon rhizosphere soil inoculated with Fusarium oxysporum f. sp. niveum (common china, rhizosphere, citrullus lanatus, co culture with wheat (triticum aestivum l.), ph 7, inoculated with fusarium oxysporum f. sp. niveum)2028-02-22v4No1 / 1271
824sheryoCommoon in soil after 0-9 years of grazing exclusion at 20-40cm depth, Ningxia china (common depth 20-40cm, 0-9 years of grazing exclusion, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, china, soil)2021-08-08v4No1 / 1274
414amnoncommon soil, heilongjiang province, agricultural feature, triticum aestivum, glycine max, zea mays, black soil, mollisol, ph>6, china2018-11-26v4No1 / 1282
798amnon high in ph 7-8 soil compared to hay plant litter litter bag in depth (soil) 10 cm depth (soil) 0-20cm orchard apricot prunus armeniaca apennine mountains italy 2021-06-13v3No1 / 1285
821sheryoCommon in soil of restored prairie at 0-10cm depth, Michigan USA (common ph 6.5, depth (soil) 0-10cm, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-07-28v4No1 / 1291
309amnoncommon lathyrus pratensis, rhizosphere, germany, meadow pea-vine2018-04-05v4No1 / 1296
266amnonCommon in soil from MAH garden (common soil, united states of america, state of idaho, ph 6)2017-12-18v4No1 / 1299
101amnon high in rhizosphere compared to root in state of new york vitis vinifera united states of america merlot grapevine 2017-04-03v4No1 / 1315
309amnoncommon rhizosphere, germany, onobrychis viciifolia, common sainfoin2018-04-05v4No1 / 1323
600sheryoCommon in biochar ammended soil after 82 days (common depth (soil) 0-5cm, state of new york, soil, biochar, united states of america, coarse-loamy soil, ph 6, day 82)2020-03-27v4No1 / 1326
600sheryoCommon in stover ammended soil after 82 days (common depth (soil) 0-5cm, state of new york, soil, united states of america, coarse-loamy soil, ph 6, day 82, stover ammendment )2020-03-27v4No1 / 1327
259amnoncommon in soil and rhizpsphere of peanut plants (common soil, rhizosphere, ph 5, arachis hypogaea, peanut, china)2017-12-02v4No1 / 1334
824sheryoCommon in soil after 27-35 years of grazing exclusion at 20-40cm depth, Ningxia china (common depth 20-40cm, 27-35 years of grazing exclusion, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, china, soil)2021-08-08v4No1 / 1369
821sheryoCommon in soil of miscanthus field at 10-25cm depth, Michigan USA (common depth (soil) 10-25cm, miscanthus, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-08-02v4No1 / 1377
821sheryoCommon in soil of continuous corn field at 0-10cm depth, Michigan USA (common united states of america, state of michigan, kellogg biological station, ph 5.9, mesic type hapludalf, kalamazoo loam, depth (soil) 0-10cm, continuous corn, corn, soil)2021-07-28v4No1 / 1380
309amnoncommon rhizosphere, germany, plantago lanceolata, ribwort plantain2018-04-05v4No1 / 1386
821sheryoCommon in soil of switchgrass field at 10-25cm depth, Michigan USA (common depth (soil) 10-25cm, kellogg biological station, mesic type hapludalf, kalamazoo loam, panicum virgatum, state of michigan, soil, united states of america)2021-08-02v4No1 / 1387
266amnoncommon in soil from SIL garden (common soil, united states of america, state of idaho, ph 6)2017-12-18v4No1 / 1389
600sheryoCommon in unammended soil after 82 days (common depth (soil) 0-5cm, state of new york, soil, united states of america, coarse-loamy soil, ph 6, day 82)2020-03-27v4No1 / 1395
824sheryoCommon in soil after 0-9 years of grazing exclusion at 10-20cm depth, Ningxia china (common depth 10-20cm, 0-9 years of grazing exclusion, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, china, soil)2021-08-08v4No1 / 1397
266amnoncoomon in roots in SIL garden (common brassicaceae, boechera stricta, plant, united states of america, state of idaho, root)2017-12-19v4No1 / 1399
76amnoncommon in non-seleniferous soil (common soil, rhizosphere, united states of america, non-seleniferous, state of florida)2017-02-28v4No1 / 1414
40amnoncommon soil, field soil, nicotiana tabacum, rhizosphere, china2016-12-09v4No1 / 1420
309amnoncommon rhizosphere, germany, geranium pratense, meadow geranium2018-04-05v4No1 / 1434
76amnoncommon in seleniferous soil (common soil, rhizosphere, united states of america, selenium, seleniferous, woodland area)2017-02-28v4No1 / 1438
821sheryoCommon in soil of miscanthus field at 0-10cm depth, Michigan USA (common depth (soil) 0-10cm, miscanthus, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-07-28v4No1 / 1447
266amnoncommon in soil from JAM garden (common soil, united states of america, state of idaho, ph 5.5)2017-12-18v4No1 / 1456
271amnoncommon depth (soil) 0-20cm, rhizosphere, glycine max, soybean, china2018-01-09v4No1 / 1459
824sheryoCommon in soil after 27-35 years of grazing exclusion at 10-20cm depth, Ningxia china (common depth 10-20cm, 27-35 years of grazing exclusion, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, china, soil)2021-08-08v4No1 / 1477
309amnoncommon rhizosphere, germany, festuca rubra, red fescue grass2018-04-05v4No1 / 1510
145amnoncommon soil, rhizosphere, oryza sativa, rice, united states of america, ph 5.62017-04-19v4No1 / 1515
309amnoncommon rhizosphere, germany, galium mollugo, hedge bedstraw2018-04-05v4No1 / 1599
600sheryolower in stover ammendment soil ( high in unamended soil compared to stover amended in depth (soil) 0-5cm state of new york soil united states of america coarse-loamy soil ph 6 day 82 )2020-03-27v4No1 / 1612
821sheryoCommon in soil of continuous corn field at 10-25cm depth, Michigan USA (common depth (soil) 10-25cm, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, continuous corn, corn, soil)2021-07-28v4No1 / 1649
824sheryoCommon in soil after 27-35 years of grazing exclusion at 0-10cm depth, Ningxia china (common yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, 27-35 years of grazing exclusion, grazing exclusion, china, depth (soil) 0-10cm, soil)2021-08-08v4No1 / 1659
821sheryoHigher at 10-25cm depth compared to 25-50cm depth in soil in Michigan USA ( high in depth (soil) 10-25cm compared to depth (soil) 25-50cm in restored prairie corn miscanthus panicum virgatum kellogg biological station mesic type hapludalf kalamazoo loam state of michigan soil united states of america )2021-08-05v4No1 / 1704
155amnonhigher in tightly bound root soil compared to loose soil and bulk soil ( high in root compared to bulk soil in triticum aestivum wheat soil china )2017-07-02v4No1 / 1714
309amnoncommon rhizosphere, germany, veronica chamaedrys, germander speedwell2018-04-05v4No1 / 1788
824sheryoCommon in soil after 0-9 years of grazing exclusion at 0-10cm depth, Ningxia china (common depth (soil) 0-10cm, 0-9 years of grazing exclusion, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, china, soil)2021-08-08v4No1 / 1903
155amnoncommon in soil tightly bound to wheat root (common triticum aestivum, wheat, soil, root, china)2017-07-02v4No1 / 1977
101amnoncommon state of new york, vitis vinifera, united states of america, merlot, grapevine, rhizosphere2017-04-03v4No1 / 1980
821sheryoCommon in soil of switchgrass field at 0-10cm depth, Michigan USA (common kellogg biological station, mesic type hapludalf, kalamazoo loam, panicum virgatum, depth (soil) 0-10cm, state of michigan, soil, united states of america)2021-08-02v4No1 / 2067
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>7, ph<8, china2018-02-11v4No1 / 2160
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>6, ph<7, china2018-02-11v4No1 / 2223
296amnoncommon in wheat field soil (common soil, north china plain, depth 5cm, agricultural feature, wheat, winter, china)2018-02-11v4No1 / 2341
155amnoncommon in soil loosely bound to wheat root (common triticum aestivum, wheat, soil, rhizosphere, china)2017-07-02v4No1 / 2425
101amnoncommon state of new york, vitis vinifera, united states of america, merlot, grapevine, soil2017-04-03v4No1 / 2537
155amnoncommon in bulk soil in wheat field (common triticum aestivum, wheat, soil, bulk soil, china)2017-07-02v4No1 / 2594
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>8, china2018-02-11v4No1 / 2646
265amnon high in soil compared to soilwater water in canada province of quebec 2017-12-11v4No1 / 2715
271amnoncommon depth (soil) 0-20cm, soil, china2018-01-09v4No1 / 2856
837sheryoHigher in soil after 10 years compared to 30 years of reforestation with Black locust trees, shaanxi, China ( high in 10 years compared to 30 years in robinia pseudoacacia reforestation silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 3368
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>5, ph<6, china2018-02-11v4No1 / 3508
837sheryoHigher in soil after 20 years compared to 30 years of reforestation with Black locust trees, shaanxi, China ( high in 20 years compared to 30 years in robinia pseudoacacia reforestation silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 3893
837sheryoHigher in soil after 10 years reforestation with Black locust trees compared to agricultural feild, shaanxi, China ( high in robinia pseudoacacia reforestation 10 years compared to agricultural field wheat zea mays in silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 3932
271amnon high in soil compared to rhizosphere glycine max soybean in depth (soil) 0-20cm china 2018-01-09v4No1 / 4853
837sheryoHigher in soil after 20 years compared to 10 years of reforestation with Black locust trees, shaanxi, China ( high in 20 years compared to 10 years in robinia pseudoacacia reforestation silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 5270
837sheryoHigher in soil after 30 years reforestation with Black locust trees compared to agricultural feild, shaanxi, China ( high in robinia pseudoacacia reforestation 30 years compared to zea mays triticum aestivum agricultural field in silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 5596
837sheryoHigher in soil after 20 years reforestation with Black locust trees compared agricultural feild, shaanxi, China ( high in robinia pseudoacacia reforestation 20 years compared to triticum aestivum zea mays agricultural field in silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 5661
266amnon high in root compared to leaf in brassicaceae boechera stricta plant united states of america state of idaho 2017-12-19v4No1 / 5886
271amnon high in soil rhizosphere compared to root structure root in depth (soil) 0-20cm glycine max soybean china 2018-01-09v4No1 / 7954

Problems / suggestions? Please email info AT dbbact DOT org