Search result for sequence:
TACGGAGGGTGCAAGCGTTATCCGGATTCACTGGGTTTAAAGGGTGCGTAGGTGGGCAGGTAAGTCAGTGGTGAAATCTCCGGGCTTAACCCGGAAACTGCCGTTGATACTATCTGTCTTGAATGTAGTGGAGGTGAGCGGAATATGTCA
common ontology terms
term enrichment score
TermScore
soil0.399429
rhizosphere0.266898
topsoil0.251969
depth (soil) 0-10cm0.241327
forest ecosystem0.216216
woodland area0.177778
brazil0.144404
root0.139130
ph 4-50.138462
depth (soil) 0-20cm0.132397
citrus0.129032
mature barley plants0.116505
days 1800.116505
quzhou county0.116505
zhejiang province0.115108
cultivated environment0.112150
hordeum vulgare0.110092
china0.104950
depth (soil) 15cm0.104348
dekalb county0.099010
illinois0.099010
greenhouse0.094340
campinas0.080808
lushan mountain0.080808
mesocosm0.080808
kellogg biological station0.080808
mesic type hapludalf0.080808
kalamazoo loam0.080808
canada0.079470
ph 50.079208
saccharum0.077670
sugarcane0.077670
state of illinois0.076336
bulk soil0.076190
orchard0.074766
forested area0.072072
jiangxi province0.069565
state of georgia0.065041
ph 4.50.062827
peatland0.061856
bon portage island0.061856
burrow0.061856
ph<50.061856
minas gerais state0.061856
campos rupestres0.061856
restored prairie0.061856
lower saxony0.061856
sandy soil0.061856
hapludalf0.061856
alfisol0.061856
state of michigan0.061069
corn0.060000
sandy loam0.060000
sandy loam soil0.060000
maize field0.058252
farm0.057007
zea mays0.056604
united states of america0.047222
plant0.044444
atlantic rainforest0.043011
parque estadual serra do mar-núcleo picinguaba0.043011
sao paulo state0.043011
cinnamomum camphora0.043011
anxi county0.043011
sphagnum bog0.042553
park0.042553
ft. pierce, fl0.042105
ph 40.042105
oceanodroma leucorhoa0.042105
seabird0.042105
north china plain0.042105
permafrost0.042105
temperate woodland biome0.042105
temperate deciduos forest0.042105
LOWER IN ph&gt;50.042105
southern temperate forest0.042105
temperate broadleaf and mixed forest biome0.042105
red soil0.042105
yellow brown soil0.042105
barbacenia macrantha0.042105
unamended with biochar0.042105
miscanthus0.042105
panicum virgatum0.042105
tropical moist broadleaf forest biome0.042105
elevation 2000-3000m0.042105
siliceous parent material0.042105
depth 0-12cm0.042105
tundra0.041667
state of florida0.041379
siberia0.041237
province of quebec0.041237
cambisol0.041237
paddy field soil0.041237
coniferous forest biome0.041237
LOWER IN depth (soil) 10-25cm0.041237
ant0.041237
mountain0.041237
mollisol0.041237
nanjing city prefecture0.040404
endosphere0.040404
Fraction of dbbact annotations with this term covered by the query
TermScore
cuticle1.000000
chitin-based cuticle1.000000
atlantic rainforest1.000000
parque estadual serra do mar-núcleo picinguaba1.000000
odontomachus hastatus1.000000
sao paulo state1.000000
LOWER IN reserva biológica de mogi-guaçu1.000000
odontomachus chelifer1.000000
volcan sumaco1.000000
cinnamomum camphora1.000000
anxi county1.000000
sphagnum bog0.666667
park0.666667
ph 4.50.666667
non-seleniferous0.500000
LOWER IN seleniferous0.500000
peatland0.500000
temperate grassland biome0.500000
quincy, fl0.500000
ft. pierce, fl0.500000
central park0.500000
ph<5.50.500000
LOWER IN ph&gt;5.50.500000
merlot0.500000
grapevine0.500000
alpine bog0.500000
plant surface0.500000
pinus sibirica0.500000
pine forest0.500000
ph 40.500000
lichen0.500000
moss0.500000
kakadu national park0.500000
LOWER IN uranium0.500000
LOWER IN high uranium0.500000
oceanodroma leucorhoa0.500000
seabird0.500000
bon portage island0.500000
burrow0.500000
surface burrow0.500000
LOWER IN deep burrow0.500000
LOWER IN seabird0.500000
LOWER IN oceanodroma leucorhoa0.500000
arachis hypogaea0.500000
peanut0.500000
LOWER IN soilwater0.500000
boechera stricta0.500000
north china plain0.500000
ph>5, ph<60.500000
ph>4, ph<50.500000
svalbard archipelago0.500000
permafrost0.500000
permafrost transition layer0.500000
ph 5.40.500000
moist tropical forest0.500000
temperate woodland biome0.500000
temperate deciduos forest0.500000
ph<50.500000
LOWER IN ph&gt;50.500000
subpolar coniferous forest biome0.500000
boreal forest0.500000
southern temperate forest0.500000
temperate broadleaf and mixed forest biome0.500000
ph<40.500000
LOWER IN ph&gt;40.500000
montane forest0.500000
mediterranean forest biome0.500000
savanna0.500000
subtropical broadleaf forest biome0.500000
red soil0.500000
LOWER IN mediterranean0.500000
copper0.500000
bank vole0.500000
myodes glareolus0.500000
ukraine0.500000
no human contact0.500000
chernobyl exclusion zone0.500000
mature soil0.500000
fragaria x ananassa0.500000
strawberry0.500000
yellow brown soil0.500000
LOWER IN age 10 years0.500000
LOWER IN continuous cropping0.500000
populus0.500000
minas gerais state0.500000
campos rupestres0.500000
vellozia epidendroides0.500000
barbacenia macrantha0.500000
campinas0.500000
LOWER IN cbd yummy cannabis plant0.500000
hash cannabis plant0.500000
flowering stage0.500000
cannabis sativa0.500000
mature barley plants0.500000
days 1800.500000
quzhou county0.500000
unamended with biochar0.500000
lushan mountain0.500000
elevation 200-300m0.500000
elevation 800-900m0.500000
Fraction of annotations for the query sequences containing the term
TermScore
soil0.714286
china0.274725
rhizosphere0.241758
united states of america0.186813
depth (soil) 0-10cm0.175824
topsoil0.175824
forest ecosystem0.142857
woodland area0.131868
depth (soil) 0-20cm0.120879
brazil0.109890
ph 4-50.098901
root0.087912
zhejiang province0.087912
citrus0.076923
canada0.065934
cultivated environment0.065934
mature barley plants0.065934
days 1800.065934
hordeum vulgare0.065934
depth (soil) 15cm0.065934
quzhou county0.065934
greenhouse0.054945
dekalb county0.054945
illinois0.054945
state of illinois0.054945
ph 50.043956
orchard0.043956
farm0.043956
saccharum0.043956
sugarcane0.043956
campinas0.043956
bulk soil0.043956
jiangxi province0.043956
lushan mountain0.043956
forested area0.043956
mesocosm0.043956
state of georgia0.043956
state of michigan0.043956
kellogg biological station0.043956
mesic type hapludalf0.043956
kalamazoo loam0.043956
peatland0.032967
state of florida0.032967
plant0.032967
ph 4.50.032967
bon portage island0.032967
burrow0.032967
ph<50.032967
zea mays0.032967
research facility0.032967
minas gerais state0.032967
campos rupestres0.032967
corn0.032967
restored prairie0.032967
lower saxony0.032967
sandy soil0.032967
germany0.032967
maize field0.032967
sandy loam0.032967
sandy loam soil0.032967
hapludalf0.032967
alfisol0.032967
sphagnum bog0.021978
ft. pierce, fl0.021978
leaf0.021978
park0.021978
LOWER IN rhizosphere0.021978
tundra0.021978
ph 40.021978
siberia0.021978
bird0.021978
oceanodroma leucorhoa0.021978
seabird0.021978
province of quebec0.021978
LOWER IN root0.021978
north china plain0.021978
agricultural feature0.021978
wheat0.021978
winter0.021978
permafrost0.021978
temperate woodland biome0.021978
temperate deciduos forest0.021978
LOWER IN ph&gt;50.021978
southern temperate forest0.021978
temperate broadleaf and mixed forest biome0.021978
hunan province0.021978
red soil0.021978
cambisol0.021978
triticum aestivum0.021978
paddy field soil0.021978
yellow brown soil0.021978
nanjing city prefecture0.021978
barbacenia macrantha0.021978
endosphere0.021978
biochar0.021978
LOWER IN biochar0.021978
unamended with biochar0.021978
coniferous forest biome0.021978
miscanthus0.021978
LOWER IN depth (soil) 10-25cm0.021978
Exp. ID User ID Description Date Region Flag Sequences
932amnon high in atlantic rainforest parque estadual serra do mar-núcleo picinguaba compared to savanna reserva biológica de mogi-guaçu in stomach gaster odontomachus chelifer sao paulo state ant brazil tropical moist broadleaf forest biome 2022-08-30v4No1 / 51
130amnoncommon peatland, leaf, austria, plant, alpine bog, plant surface, sphagnum bog2017-04-15v4No1 / 65
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, stem, stem endosphere2019-08-17v4No1 / 123
98amnoncommon citrus, leaf, ft. pierce, fl, state of florida2017-04-01v4No1 / 126
357amnoncommon in moist tropical forest topsoil around the world (common soil, topsoil, depth (soil) 0-10cm, moist tropical forest, woodland area, forest ecosystem)2018-08-18v4No1 / 171
628sheryoHigher in rhizosphere of barley roots after 180 days in treatments unamended with biochar ( high in unamended with biochar compared to biochar in china zhejiang province quzhou county soil depth (soil) 15cm ph 4-5 hordeum vulgare rhizosphere days 180 mature barley plants )2020-05-18v4No1 / 190
761sheryoHigher in maize rhizosphere compared to bulk soil in sandy soil maize field in Germany ( high in rhizosphere compared to bulk soil in ph 5 lower saxony sandy soil germany maize field )2021-04-06v3No1 / 200
583amnoncommon soil, mountain, switzerland, ph 4-6, depth (soil) 0-10cm, elevation 2000-3000m, siliceous parent material, rhone river valley2020-01-27v3No1 / 234
357amnon high in ph<4 compared to ph>4 in soil topsoil depth (soil) 0-10cm southern temperate forest temperate broadleaf and mixed forest biome woodland area forest ecosystem 2018-08-19v4No1 / 282
628sheryoHigher in bulk soil with barley plants after 180 days in treatments unamended with biochar ( high in unamended with biochar compared to biochar in bulk soil china zhejiang province quzhou county soil depth (soil) 15cm ph 4-5 hordeum vulgare days 180 mature barley plants )2020-05-18v4No1 / 327
932amnon high in cuticle chitin-based cuticle compared to stomach gaster in atlantic rainforest parque estadual serra do mar-núcleo picinguaba odontomachus hastatus sao paulo state ant brazil tropical moist broadleaf forest biome 2022-08-30v4No1 / 334
583amnoncommon soil, mountain, switzerland, depth (soil) 0-10cm, elevation 2000-3000m, siliceous parent material, ph 4.5-7, canton of graubunden2020-01-27v3No1 / 359
426amnon high in mature soil compared to sand in soil tundra permafrost russia nenets autonomous okrug 2018-12-08v4No1 / 377
147amnoncommon soil, siberia, peatland, ph 4.5, lichen, moss2017-04-20v4No1 / 396
147amnoncommon pinus sibirica, tundra, soil, pine forest, ph 4, siberia, forest ecosystem2017-04-20v4No1 / 416
618amnon high in hash cannabis plant compared to cbd yummy cannabis plant in flowering stage rhizosphere canada farm cannabis sativa 2020-05-04v4No1 / 416
415amnonhigher in citrus from humid subtropical compared to mediterranean and semi-arid climate ( high in subtropical compared to mediterranean semi-arid in rhizosphere soil citrus orchard cultivated environment )2018-11-27v4No1 / 458
964amnoncommon stratovolcano, ph 4-5, soil, depth (soil) 10-25cm, ecuador, volcan sumaco2022-12-21v3No1 / 472
357amnoncommon soil, topsoil, depth (soil) 0-10cm, woodland area, forest ecosystem2018-08-19v4No1 / 474
989amnoncommon rhizosphere, depth (soil) 0-20cm, cinnamomum camphora, anxi county, ph 4-5, farm, china2022-12-26v3No1 / 476
347amnon high in depth (soil) 0-20cm permafrost transition layer compared to depth (soil) 20-30cm in kingdom of norway svalbard archipelago permafrost soil 2018-07-15v4No1 / 477
829sheryoCommon in soil depth of 56-116cm in Mollisol soil, Dekalb, Illinois, united states of america (common depth 56-116cm, dekalb county, illinois, state of illinois, mollisol, silt loam, soil, united states of america)2021-08-26v3No1 / 491
357amnoncommon soil, topsoil, depth (soil) 0-10cm, southern temperate forest, temperate broadleaf and mixed forest biome, woodland area, forest ecosystem2018-08-19v4No1 / 499
829sheryoCommon in soil depth of 116-140cm in Mollisol soil, Dekalb, Illinois, united states of america (common depth 116-140cm, dekalb county, illinois, state of illinois, mollisol, silt loam, soil, united states of america)2021-08-26v3No1 / 516
615amnon high in endosphere root compared to rhizosphere in saccharum sugarcane campinas brazil greenhouse 2020-04-27v4No1 / 529
357amnoncommon soil, topsoil, depth (soil) 0-10cm, subpolar coniferous forest biome, boreal forest, woodland area, forest ecosystem2018-08-19v4No1 / 538
357amnoncommon soil, topsoil, depth (soil) 0-10cm, mediterranean forest biome, forest ecosystem, woodland area2018-08-19v4No1 / 564
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, root endosphere, root2019-08-17v4No1 / 575
357amnoncommon soil, topsoil, depth (soil) 0-10cm, montane forest, woodland area, forest ecosystem2018-08-19v4No1 / 592
415amnoncommon rhizosphere, soil, citrus, orchard, south africa, cultivated environment2018-11-27v4No1 / 600
788amnoncommon cherokia georgiana georgiana, millipede, feces, mesocosm, state of georgia, united states of america2021-05-31v4No1 / 607
667amnoncommon depth (soil) 0-20cm, jiangxi province, lushan mountain, china, forested area, ph 4.5, elevation 200-300m, topsoil, soil2020-09-25v4No1 / 613
357amnoncommon soil, topsoil, depth (soil) 0-10cm, savanna, forest ecosystem, woodland area2018-08-19v4No1 / 614
667amnoncommon depth (soil) 0-20cm, coniferous forest biome, ph 4-4.5, elevation 1000-1100m, jiangxi province, lushan mountain, china, forested area, topsoil, soil2020-09-25v4No1 / 630
237amnoncommon in burrow soil of seabird (common bird, oceanodroma leucorhoa, seabird, canada, bon portage island, burrow, soil)2017-11-07v4No1 / 638
357amnoncommon in temperate deciduous forests around the world (common soil, topsoil, depth (soil) 0-10cm, temperate woodland biome, temperate deciduos forest, woodland area, forest ecosystem)2018-08-18v4No1 / 681
829sheryohigher soil depth of 0-12cm compared to 12-44cm in Alfisol soil, Dekalb, Illinois, united states of america ( high in depth 0-12cm compared to depth 12-44cm in sandy loam sandy loam soil hapludalf alfisol united states of america soil state of illinois illinois dekalb county )2021-08-26v3No1 / 685
667amnoncommon depth (soil) 0-20cm, elevation 800-900m, ph 4.5, jiangxi province, lushan mountain, china, forested area, topsoil, soil2020-09-25v4No1 / 694
412amnon high in ph<5 compared to ph>5 in soil hunan province red soil cambisol zea mays triticum aestivum china 2018-11-26v4No1 / 706
829sheryoCommon in soil depth of 0-12m in Alfisol soil, Dekalb, Illinois, united states of america (common depth 0-12cm, sandy loam, sandy loam soil, hapludalf, alfisol, united states of america, soil, state of illinois, illinois, dekalb county)2021-08-26v3No1 / 737
989amnoncommon depth (soil) 0-20cm, cinnamomum camphora, anxi county, ph 4-5, farm, china, soil2022-12-26v3No1 / 738
421amnoncommon in paddy field soil incubated with copper (common soil, research facility, zhejiang province, paddy field soil, copper, china)2018-12-02v4No1 / 740
761sheryoCommon in maize rhizosphere sandy soil maize field in Germany (common zea mays, rhizosphere, ph 5, lower saxony, sandy soil, germany, maize field)2021-04-06v3No1 / 742
821sheryoCommon in soil of restored prairie at 50-100cm depth, Michigan USA (common depth 50-100m, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-07-28v4No1 / 744
709sheryoCommon in potting mix soil from the Netherlands, substraat arabidopsis, Lentse Potgrond (common substraat arabidopsis, lentse potgrond, soil, potting mix, kingdom of the netherlands)2028-05-16v4No1 / 752
615amnoncommon endosphere, root, saccharum, sugarcane, campinas, brazil, greenhouse2020-04-27v4No1 / 776
667amnoncommon depth (soil) 0-20cm, ph 4, elevation 1300-1400m, coniferous forest biome, jiangxi province, lushan mountain, china, forested area, topsoil, soil2020-09-25v4No1 / 777
548amnoncommon in endopytic roots of Vellozia epidendroides (common minas gerais state, campos rupestres, brazil, vellozia epidendroides, plant, root)2019-08-15v4No1 / 800
821sheryoHigher at 25-50cm depth compared to 10-25cm depth in soil in Michigan USA ( high in depth (soil) 25-50cm compared to depth (soil) 10-25cm in restored prairie corn miscanthus panicum virgatum kellogg biological station mesic type hapludalf kalamazoo loam state of michigan soil united states of america )2021-08-05v4No1 / 812
412amnoncommon soil, hunan province, red soil, cambisol, zea mays, triticum aestivum, ph<5, china2018-11-26v4No1 / 823
421amnoncommon in paddy field soil incubated without copper (common research facility, soil, paddy field soil, zhejiang province, china)2018-12-02v4No1 / 824
415amnoncommon rhizosphere, soil, citrus, orchard, china, cultivated environment2018-11-27v4No1 / 830
356amnoncommon in deciduous broad leaved forest top soil in japan (common soil, depth (soil) 0-10cm, hokkaido, topsoil, ph 5.4, japan, forest ecosystem)2018-08-15v4No1 / 834
761sheryoCommon in bulk sandy soil maize field in Germany (common ph 5, lower saxony, sandy soil, germany, maize field, bulk soil)2021-04-06v3No1 / 835
698amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, ph 5-6, disease, plant disease, acute oak decline, park, united kingdom, oak, quercus, rhizosphere2028-04-01v3No1 / 848
829sheryoCommon in soil depth of 108-140cm in Alfisol soil, Dekalb, Illinois, united states of america (common depth 108-140cm, sandy loam, sandy loam soil, hapludalf, alfisol, united states of america, soil, state of illinois, illinois, dekalb county)2021-08-26v3No1 / 871
788amnoncommon soil, mesocosm, state of georgia, united states of america2021-05-31v4No1 / 897
359amnoncommon soil, topsoil, depth (soil) 0-10cm, guangdong province, subtropical broadleaf forest biome, china, forest ecosystem, woodland area2018-08-19v4No1 / 935
444amnoncommon in uncultivated soil plot (common yellow brown soil, nanjing city prefecture, soil, china)2019-01-07v4No1 / 946
98amnoncommon citrus, rhizosphere, quincy, fl, root, state of florida2017-04-01v4No1 / 950
615amnoncommon saccharum, sugarcane, rhizosphere, campinas, brazil, greenhouse2020-04-27v4No1 / 974
809amnoncommon dendrobium moniliforme, lu'an city prefecture, flowerpot, research facility, greenhouse, rhizosphere, china2021-06-20v4No1 / 1002
628sheryocommon in bulk soil with barley plants after 180 days in treatments amended with biochar (common biochar, bulk soil, china, zhejiang province, quzhou county, soil, depth (soil) 15cm, ph 4-5, hordeum vulgare, days 180, mature barley plants)2020-05-18v4No1 / 1023
265amnoncommon canada, province of quebec, soil2017-12-11v4No1 / 1090
415amnoncommon rhizosphere, soil, citrus, orchard, brazil, cultivated environment2018-11-27v4No1 / 1091
84amnoncommon soil, peatland, peat soil, sphagnum bog, temperate grassland biome, depth 5cm, wetland area2017-03-06v4No1 / 1103
357amnon high in ph<5 compared to ph>5 in soil topsoil depth (soil) 0-10cm temperate woodland biome temperate deciduos forest woodland area forest ecosystem 2018-08-18v4No1 / 1104
628sheryocommon in bulk soil with barley plants after 180 days in treatments unamended with biochar (common bulk soil, china, zhejiang province, quzhou county, soil, depth (soil) 15cm, ph 4-5, hordeum vulgare, days 180, mature barley plants)2020-05-18v4No1 / 1136
615amnon high in rhizosphere compared to soil in saccharum sugarcane campinas brazil greenhouse 2020-04-27v4No1 / 1181
628sheryocommon in rhizosphere of barley roots after 180 days in treatments amended with biochar (common mature barley plants, days 180, rhizosphere, hordeum vulgare, biochar, ph 4-5, depth (soil) 15cm, china, quzhou county, zhejiang province, soil)2020-05-18v4No1 / 1192
628sheryocommon in rhizosphere of barley roots after 180 days in treatments unamended with biochar (common china, zhejiang province, quzhou county, soil, depth (soil) 15cm, ph 4-5, hordeum vulgare, rhizosphere, days 180, mature barley plants)2020-05-18v4No1 / 1209
444amnonlower in continuously cropped strawberry soil ( high in age 1 year compared to age 5 years age 10 years continuous cropping in rhizosphere fragaria x ananassa strawberry greenhouse soil farm yellow brown soil nanjing city prefecture china cultivated environment )2019-01-07v4No1 / 1221
423amnon high in no human contact chernobyl exclusion zone compared to human contact in bank vole myodes glareolus ukraine skin 2018-12-05v4No1 / 1229
237amnonlower deep in burrow compared to burrow entrance ( high in surface burrow compared to deep burrow in bird oceanodroma leucorhoa seabird canada bon portage island burrow soil )2017-11-07v4No1 / 1247
788amnon high in soil compared to plant litter in mesocosm state of georgia united states of america 2021-05-31v4No1 / 1280
259amnoncommon in soil and rhizpsphere of peanut plants (common soil, rhizosphere, ph 5, arachis hypogaea, peanut, china)2017-12-02v4No1 / 1334
98amnoncommon citrus, rhizosphere, ft. pierce, fl, root, state of florida2017-04-01v4No1 / 1340
821sheryoCommon in soil of continuous corn field at 0-10cm depth, Michigan USA (common united states of america, state of michigan, kellogg biological station, ph 5.9, mesic type hapludalf, kalamazoo loam, depth (soil) 0-10cm, continuous corn, corn, soil)2021-07-28v4No1 / 1380
821sheryoHigher at 0-10cm depth compared to 10-25cm depth in soil in Michigan USA ( high in depth (soil) 0-10cm compared to depth (soil) 10-25cm in restored prairie corn miscanthus panicum virgatum kellogg biological station mesic type hapludalf kalamazoo loam state of michigan soil united states of america )2021-08-05v4No1 / 1383
788amnon high in soil compared to cherokia georgiana georgiana millipede feces in mesocosm state of georgia united states of america 2021-05-31v4No1 / 1395
76amnonhigher in non-seleniferous soil compared to seleniferous soil ( high in non-seleniferous compared to selenium seleniferous in soil united states of america rhizosphere woodland area )2017-02-28v4No1 / 1621
154amnon high in control compared to uranium high uranium in soil australia kakadu national park sediment 2017-06-29v4No1 / 1663
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>4, ph<5, china2018-02-11v4No1 / 1886
101amnon high in root compared to rhizosphere in state of new york vitis vinifera united states of america merlot grapevine 2017-04-03v4No1 / 2075
265amnon high in soil compared to soilwater water in canada province of quebec 2017-12-11v4No1 / 2715
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>5, ph<6, china2018-02-11v4No1 / 3508
237amnonhigher in burrow soil compared to bird ( high in soil burrow compared to bird seabird oceanodroma leucorhoa in canada bon portage island )2017-11-07v4No1 / 3656
100amnon high in ph ph<5.5 compared to ph>5.5 in soil urban biome park new york city central park 2017-04-03v4No1 / 4262
462amnon high in rhizosphere compared to root in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 4630
266amnon high in root compared to leaf in brassicaceae boechera stricta plant united states of america state of idaho 2017-12-19v4No1 / 5886
271amnon high in soil rhizosphere compared to root structure root in depth (soil) 0-20cm glycine max soybean china 2018-01-09v4No1 / 7954

Problems / suggestions? Please email info AT dbbact DOT org