Search result for sequence:
TACGGAGGGTGCAAGCGTTATCCGGATTCACTGGGTTTAAAGGGTGCGTAGGTGGGTTGGTAAGTCAGTGGTGAAATCTCCAGGCTTAACTTGGAAACTGCCATTGATACTATCAATCTTGAATACCGTGGAGGTCAGCGGAATATGTCA
common ontology terms
term enrichment score
TermScore
soil0.434106
rhizosphere0.270561
zea mays0.196721
kellogg biological station0.196721
mesic type hapludalf0.196721
kalamazoo loam0.196721
cultivated environment0.175439
china0.143928
glycine max0.142857
ph 60.140351
agricultural field0.134328
triticum aestivum0.133333
topsoil0.131148
depth (soil) 0-10cm0.129032
oryza sativa0.114286
state of michigan0.110092
nicollet soil series0.109091
des moines0.109091
united states0.109091
hunan province0.107143
depth (soil) 0-20cm0.104389
iowa0.103448
depth (soil) 0-15cm0.094787
farm0.093023
lushan mountain0.092593
restored prairie0.092593
shaanxi province0.092593
loess plateau0.088496
brazil0.082136
forested area0.081301
jiangxi province0.078125
silt loam0.078125
heilongjiang province0.076923
ph 5.90.076923
coarse-loamy soil0.075472
day 820.075472
mesocosm0.075472
panicum virgatum0.075472
robinia pseudoacacia0.075472
reforestation0.075472
united states of america0.075165
wheat0.074074
paddy field soil0.072727
depth (soil) 0-5cm0.072727
ph 6-70.064865
state of georgia0.061538
soybean0.058537
depth (soil) 15-30cm0.058537
tomato0.057692
yellow brown soil0.057692
greenhouse0.057692
qiyang county0.057692
quaternary red clay0.057692
kanawha0.057692
subsurface drainage0.057692
kelley0.057692
continuous corn0.057692
miscanthus0.057692
LOWER IN 10 years0.057692
citrus0.056872
ph 50.056872
ph 4.50.056075
corn0.056075
depth (soil) 10-25cm0.056075
depth (soil) 25-50cm0.056075
bulk soil0.055300
nanjing city prefecture0.054545
forest ecosystem0.053812
state of new york0.053333
tree0.053097
LOWER IN root0.053097
woodland area0.052402
jiangsu province0.051064
solanum lycopersicum0.050420
agricultural feature0.050420
state of california0.043321
taxus0.039216
taxus mairei0.039216
slit loam soil0.039216
ph 5.50.039216
svalbard archipelago0.039216
red soil0.039216
fragaria x ananassa0.039216
strawberry0.039216
shrimp farm0.039216
minas gerais state0.039216
campos rupestres0.039216
LOWER IN depth (soil) 60-90cm0.039216
depth 50-100m0.039216
gleysol0.039216
sihong county0.039216
chenwei forest0.039216
poplar plantation0.039216
poplar0.039216
20 years0.039216
30 years0.039216
lower saxony0.039216
sandy soil0.039216
flood plain0.039216
sacramento0.039216
Fraction of dbbact annotations with this term covered by the query
TermScore
soybean0.666667
heilongjiang province0.666667
ph 5.90.666667
depth (soil) 0-15cm0.666667
depth (soil) 15-30cm0.666667
cultivated environment0.625000
glycine max0.571429
field soil0.500000
non-seleniferous0.500000
LOWER IN seleniferous0.500000
vero beach, fl0.500000
ph 6-6.50.500000
myrtillocactus geometrizans0.500000
opuntia robusta0.500000
root zone soil0.500000
taxus0.500000
taxus mairei0.500000
southeast china0.500000
LOWER IN taxus media0.500000
LOWER IN taxus cuspidata0.500000
LOWER IN temperate0.500000
temperate0.500000
tomato0.500000
slit loam soil0.500000
ph 60.500000
slit loam0.500000
ph 5.50.500000
north china plain0.500000
ph>6, ph<70.500000
svalbard archipelago0.500000
LOWER IN permafrost transition layer0.500000
LOWER IN depth 100-150cm0.500000
LOWER IN depth 150-200cm0.500000
moist tropical forest0.500000
ph>4.50.500000
LOWER IN ph&lt;4.50.500000
savanna0.500000
red soil0.500000
zea mays0.500000
reunion island0.500000
fragaria x ananassa0.500000
strawberry0.500000
yellow brown soil0.500000
LOWER IN age 10 years0.500000
LOWER IN continuous cropping0.500000
populus0.500000
ceanothus jepsonii0.500000
shrimp farm0.500000
minas gerais state0.500000
campos rupestres0.500000
barbacenia macrantha0.500000
coarse-loamy soil0.500000
day 820.500000
stover ammendment 0.500000
LOWER IN stover amended0.500000
campinas0.500000
greenhouse0.500000
lushan mountain0.500000
elevation 200-300m0.500000
elevation 500-600m0.500000
elevation 800-900m0.500000
elevation 1000-1100m0.500000
elevation 1300-1400m0.500000
qiyang county0.500000
quaternary red clay0.500000
no fertilization0.500000
LOWER IN cherokia georgiana georgiana0.500000
LOWER IN millipede0.500000
mesocosm0.500000
cherokia georgiana georgiana0.500000
millipede0.500000
kanawha0.500000
ph 7.10.500000
nicollet soil series0.500000
des moines0.500000
united states0.500000
LOWER IN depth (soil) 60-90cm0.500000
subsurface drainage0.500000
ph 6.20.500000
kelley0.500000
dendrobium huoshanense0.500000
lu'an city prefecture0.500000
flowerpot0.500000
kellogg biological station0.500000
mesic type hapludalf0.500000
kalamazoo loam0.500000
continuous corn0.500000
restored prairie0.500000
miscanthus0.500000
depth 50-100m0.500000
panicum virgatum0.500000
gleysol0.500000
sihong county0.500000
chenwei forest0.500000
poplar plantation0.500000
poplar0.500000
LOWER IN 10 years0.500000
LOWER IN reforestation0.500000
LOWER IN robinia pseudoacacia0.500000
shaanxi province0.500000
Fraction of annotations for the query sequences containing the term
TermScore
soil0.806122
china0.428571
united states of america0.326531
rhizosphere0.224490
zea mays0.122449
state of michigan0.122449
kellogg biological station0.122449
mesic type hapludalf0.122449
kalamazoo loam0.122449
depth (soil) 0-20cm0.112245
cultivated environment0.102041
agricultural field0.091837
ph 60.081633
triticum aestivum0.081633
glycine max0.081633
topsoil0.081633
depth (soil) 0-10cm0.081633
farm0.081633
oryza sativa0.071429
hunan province0.061224
nicollet soil series0.061224
des moines0.061224
united states0.061224
iowa0.061224
brazil0.051020
jiangxi province0.051020
lushan mountain0.051020
forested area0.051020
depth (soil) 0-15cm0.051020
restored prairie0.051020
silt loam0.051020
loess plateau0.051020
shaanxi province0.051020
wheat0.040816
heilongjiang province0.040816
paddy field soil0.040816
ph 6-70.040816
depth (soil) 0-5cm0.040816
state of new york0.040816
coarse-loamy soil0.040816
day 820.040816
ph 5.90.040816
mesocosm0.040816
state of georgia0.040816
panicum virgatum0.040816
robinia pseudoacacia0.040816
reforestation0.040816
woodland area0.030612
citrus0.030612
tree0.030612
solanum lycopersicum0.030612
tomato0.030612
bulk soil0.030612
LOWER IN root0.030612
soybean0.030612
agricultural feature0.030612
ph 50.030612
forest ecosystem0.030612
jiangsu province0.030612
yellow brown soil0.030612
nanjing city prefecture0.030612
state of california0.030612
greenhouse0.030612
ph 4.50.030612
qiyang county0.030612
quaternary red clay0.030612
kanawha0.030612
depth (soil) 15-30cm0.030612
subsurface drainage0.030612
kelley0.030612
continuous corn0.030612
corn0.030612
depth (soil) 10-25cm0.030612
depth (soil) 25-50cm0.030612
miscanthus0.030612
LOWER IN 10 years0.030612
root0.020408
taxus0.020408
taxus mairei0.020408
slit loam soil0.020408
LOWER IN rhizosphere0.020408
state of idaho0.020408
ph 5.50.020408
kingdom of norway0.020408
svalbard archipelago0.020408
permafrost0.020408
depth (soil) 20-30cm0.020408
red soil0.020408
cambisol0.020408
manured soil0.020408
black soil0.020408
mollisol0.020408
ph>60.020408
orchard0.020408
fragaria x ananassa0.020408
strawberry0.020408
greenhouse soil0.020408
age 1 year0.020408
pasture0.020408
shrimp farm0.020408
Exp. ID User ID Description Date Region Flag Sequences
316amnoncommon united states of america, soil, topsoil, state of ohio, depth (soil) 0-10cm, ph 5, forest ecosystem2018-04-10v4No1 / 199
412amnonhigh in pig manured soil with wheat-maize rotation compared to non-manured soil ( high in manured soil compared to non-manured soil in soil hunan province red soil cambisol zea mays triticum aestivum china )2018-11-26v4No1 / 395
801sheryoHigher at depth 0-15cm compared to depth 60-90cm in corn agriculture fields, Iowa USA ( high in depth (soil) 0-15cm compared to depth (soil) 60-90cm in kanawha nicollet soil series des moines united states agricultural field iowa zea mays soil )2021-06-15v4No1 / 501
98amnoncommon citrus, rhizosphere, vero beach, fl, root, state of florida2017-04-01v4No1 / 544
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, root endosphere, root2019-08-17v4No1 / 575
667amnoncommon depth (soil) 0-20cm, ph 4.5, elevation 500-600m, jiangxi province, lushan mountain, china, forested area, topsoil, soil2020-09-25v4No1 / 575
801sheryoCommon at depth 15-30cm in corn agriculture fields, Iowa USA (common kanawha, depth (soil) 15-30cm, nicollet soil series, ph 7.7, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 598
893amnon high in silty clay loam compared to sandy loam in research facility greenhouse raphanus sativus radish fertilized soil commonwealth of virginia united states of america rhizosphere 2022-04-11v4No1 / 605
788amnoncommon cherokia georgiana georgiana, millipede, feces, mesocosm, state of georgia, united states of america2021-05-31v4No1 / 607
667amnoncommon depth (soil) 0-20cm, jiangxi province, lushan mountain, china, forested area, ph 4.5, elevation 200-300m, topsoil, soil2020-09-25v4No1 / 613
357amnoncommon soil, topsoil, depth (soil) 0-10cm, savanna, forest ecosystem, woodland area2018-08-19v4No1 / 614
667amnoncommon depth (soil) 0-20cm, coniferous forest biome, ph 4-4.5, elevation 1000-1100m, jiangxi province, lushan mountain, china, forested area, topsoil, soil2020-09-25v4No1 / 630
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, ph 6-7, cultivated environment, china2018-12-04v4No1 / 682
134amnon high in taxus mairei southeast china subtropical compared to taxus media taxus cuspidata northeast china temperate in rhizosphere tree taxus china 2017-04-16v4No1 / 694
667amnoncommon depth (soil) 0-20cm, elevation 800-900m, ph 4.5, jiangxi province, lushan mountain, china, forested area, topsoil, soil2020-09-25v4No1 / 694
415amnoncommon rhizosphere, soil, citrus, orchard, reunion island, cultivated environment2018-11-27v4No1 / 721
821sheryoComoon in soil of miscanthus field at 50-100cm depth, Michigan USA (common depth 50-100m, miscanthus, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-08-02v4No1 / 726
761sheryoCommon in maize rhizosphere sandy soil maize field in Germany (common zea mays, rhizosphere, ph 5, lower saxony, sandy soil, germany, maize field)2021-04-06v3No1 / 742
667amnoncommon depth (soil) 0-20cm, ph 4, elevation 1300-1400m, coniferous forest biome, jiangxi province, lushan mountain, china, forested area, topsoil, soil2020-09-25v4No1 / 777
615amnoncommon in control soil with no sugarcane (common campinas, brazil, greenhouse, soil)2020-04-27v4No1 / 780
347amnon high in depth (soil) 20-30cm compared to depth (soil) 0-20cm permafrost transition layer in kingdom of norway svalbard archipelago permafrost soil 2018-07-15v4No1 / 788
478amnoncommon farm, litopenaeus vannamei, pacific white shrimp, intestine, china2019-02-19v4No1 / 795
478amnoncommon farm, shrimp farm, water, saline water, china2019-02-19v4No1 / 799
480amnoncommon soil, pasture, farm, ireland2019-02-05v4No1 / 816
761sheryoCommon in bulk sandy soil maize field in Germany (common ph 5, lower saxony, sandy soil, germany, maize field, bulk soil)2021-04-06v3No1 / 835
801sheryoCommon at depth 15-30cm in corn and soybean agriculture fields, Iowa USA (common ph 6, depth (soil) 15-30cm, subsurface drainage, glycine max, kelley, nicollet soil series, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 841
801sheryoCommon at depth 0-15cm in corn agriculture fields, Iowa USA (common kanawha, ph 7.1, nicollet soil series, depth (soil) 0-15cm, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 862
821sheryoCommon in soil of switchgrass field at 50-100cm depth, Michigan USA (common depth 50-100m, panicum virgatum, kellogg biological station, mesic type hapludalf, kalamazoo loam, state of michigan, soil, united states of america)2021-08-03v4No1 / 872
146amnoncommon united states of america, solanum lycopersicum, tomato, slit loam soil, ph 6, rhizosphere2017-04-20v4No1 / 894
788amnoncommon soil, mesocosm, state of georgia, united states of america2021-05-31v4No1 / 897
479amnoncommon rhizosphere, united states of america, state of california, ph 6-7, ceanothus jepsonii2019-02-05v4No1 / 900
548amnoncommon minas gerais state, campos rupestres, brazil, rock2019-08-17v4No1 / 924
444amnoncommon in uncultivated soil plot (common yellow brown soil, nanjing city prefecture, soil, china)2019-01-07v4No1 / 946
422amnoncommon soil, paddy field soil, jiangsu province, oryza sativa, china, cultivated environment2018-12-02v4No1 / 957
821sheryoCommon in soil of continuous corn field at 25-50cm depth, Michigan USA (common depth (soil) 25-50cm, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, continuous corn, corn, soil)2021-07-28v4No1 / 963
129amnoncommon ph 6-6.5, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, soil, root zone soil2017-04-15v4No1 / 968
480amnoncommon soil, pasture, farm, new zealand2019-02-05v4No1 / 970
134amnoncommon rhizosphere, tree, taxus, northeast china, temperate, taxus mairei, china2017-04-16v4No1 / 973
474amnoncommon soil, farm, glycine max, soybean, ph 4-6, brazil, cultivated environment2019-01-16v4No1 / 974
821sheryoCommon in soil of switchgrass field at 25-50cm depth, Michigan USA (common depth (soil) 25-50cm, kellogg biological station, mesic type hapludalf, kalamazoo loam, panicum virgatum, state of michigan, soil, united states of america)2021-08-03v4No1 / 974
821sheryoCommon in soil of switchgrass field at 25-50cm depth, Michigan USA (common panicum virgatum, depth (soil) 25-50cm, kellogg biological station, mesic type hapludalf, kalamazoo loam, state of michigan, soil, united states of america)2021-08-03v4No1 / 974
412amnon high in ph>5 compared to ph<5 in soil hunan province red soil cambisol zea mays triticum aestivum china 2018-11-26v4No1 / 1005
266amnoncommon in soil from PAR garden (common soil, united states of america, state of idaho, ph 5.5)2017-12-18v4No1 / 1032
801sheryoHigher at depth 0-15cm compared to depth 60-90cm in corn and soybean agriculture fields, Iowa USA ( high in depth (soil) 0-15cm compared to depth (soil) 60-90cm in subsurface drainage glycine max kelley nicollet soil series des moines united states agricultural field iowa zea mays soil )2021-06-16v4No1 / 1036
786sheryocommon in flood plain soil near cosumnes river, california, at 0-30cm depth (common depth (soil) 0-30 cm, depth (soil) 0-20cm, flood plain, soil, united states of america, state of california, sacramento, cosumnes river preserve)2021-05-18v3No1 / 1048
828sheryoCommon in gleysol soil of poplar plantation at 0-10cm depth, sihong, china (common depth (soil) 0-10cm, ph 6-7, clay loam, gleysol, china, jiangsu province, sihong county, chenwei forest, soil, poplar plantation, poplar)2021-08-25v4No1 / 1069
347amnon high in depth (soil) 20-30cm compared to depth 100-150cm depth 150-200cm in kingdom of norway svalbard archipelago permafrost soil 2018-07-15v4No1 / 1080
478amnoncommon farm, shrimp farm, sediment, china2019-02-19v4No1 / 1085
415amnoncommon rhizosphere, soil, citrus, orchard, brazil, cultivated environment2018-11-27v4No1 / 1091
828sheryoCommon in gleysol soil of poplar plantation at 10-20cm depth, sihong, china (common depth 10-20cm, ph 6-7, clay loam, gleysol, china, jiangsu province, sihong county, chenwei forest, soil, poplar plantation, poplar)2021-08-25v4No1 / 1123
146amnon high in soil compared to rhizosphere in united states of america solanum lycopersicum tomato slit loam ph 6 2017-04-20v4No1 / 1135
146amnoncommon united states of america, solanum lycopersicum, tomato, soil, slit loam soil, ph 62017-04-20v4No1 / 1144
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, ph 7-8, cultivated environment, china2018-12-04v4No1 / 1169
786sheryoCommon in flood plain soil near cosumnes river, california, at 30-60cm depth (common depth (soil) 30-60cm, cosumnes river preserve, sacramento, state of california, united states of america, soil, flood plain)2021-05-18v3No1 / 1180
823sheryoCommon at 0-15cm depth in foot slope ultisol soil in auburn, alabama (common foot slope , depth (soil) 0-15cm, alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 1199
801sheryoCommon at depth 0-15cm in corn and soybean agriculture fields, Iowa USA (common subsurface drainage, ph 6.2, depth (soil) 0-15cm, glycine max, kelley, nicollet soil series, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 1202
823sheryoCommon at 15-30cm depth in foot slope ultisol soil in auburn, alabama (common depth (soil) 15-30cm, foot slope , alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 1218
444amnonlower in continuously cropped strawberry soil ( high in age 1 year compared to age 5 years age 10 years continuous cropping in rhizosphere fragaria x ananassa strawberry greenhouse soil farm yellow brown soil nanjing city prefecture china cultivated environment )2019-01-07v4No1 / 1221
821sheryoCommon in soil of restored prairie at 10-25cm depth, Michigan USA (common depth (soil) 10-25cm, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-07-28v4No1 / 1241
788amnon high in soil compared to plant litter in mesocosm state of georgia united states of america 2021-05-31v4No1 / 1280
414amnoncommon soil, heilongjiang province, agricultural feature, triticum aestivum, glycine max, zea mays, black soil, mollisol, ph>6, china2018-11-26v4No1 / 1282
821sheryoCommon in soil of restored prairie at 0-10cm depth, Michigan USA (common ph 6.5, depth (soil) 0-10cm, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-07-28v4No1 / 1291
600sheryoCommon in biochar ammended soil after 82 days (common depth (soil) 0-5cm, state of new york, soil, biochar, united states of america, coarse-loamy soil, ph 6, day 82)2020-03-27v4No1 / 1326
600sheryoCommon in stover ammended soil after 82 days (common depth (soil) 0-5cm, state of new york, soil, united states of america, coarse-loamy soil, ph 6, day 82, stover ammendment )2020-03-27v4No1 / 1327
809amnoncommon dendrobium huoshanense, lu'an city prefecture, flowerpot, research facility, greenhouse, rhizosphere, china2021-06-20v4No1 / 1356
821sheryoCommon in soil of miscanthus field at 10-25cm depth, Michigan USA (common depth (soil) 10-25cm, miscanthus, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-08-02v4No1 / 1377
821sheryoCommon in soil of continuous corn field at 0-10cm depth, Michigan USA (common united states of america, state of michigan, kellogg biological station, ph 5.9, mesic type hapludalf, kalamazoo loam, depth (soil) 0-10cm, continuous corn, corn, soil)2021-07-28v4No1 / 1380
600sheryoCommon in unammended soil after 82 days (common depth (soil) 0-5cm, state of new york, soil, united states of america, coarse-loamy soil, ph 6, day 82)2020-03-27v4No1 / 1395
788amnon high in soil compared to cherokia georgiana georgiana millipede feces in mesocosm state of georgia united states of america 2021-05-31v4No1 / 1395
422amnoncommon soil, paddy field soil, oryza sativa, hunan province, hubei province, china, cultivated environment2018-12-02v4No1 / 1399
40amnoncommon soil, field soil, nicotiana tabacum, rhizosphere, china2016-12-09v4No1 / 1420
444amnoncommon rhizosphere, fragaria x ananassa, strawberry, greenhouse soil, farm, yellow brown soil, nanjing city prefecture, age 1 year, china, cultivated environment2019-01-07v4No1 / 1439
821sheryoCommon in soil of miscanthus field at 0-10cm depth, Michigan USA (common depth (soil) 0-10cm, miscanthus, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-07-28v4No1 / 1447
414amnon high in ph>6 compared to ph<6 npk fertilizer in soil heilongjiang province agricultural feature triticum aestivum glycine max zea mays black soil mollisol china 2018-11-26v4No1 / 1451
266amnoncommon in soil from JAM garden (common soil, united states of america, state of idaho, ph 5.5)2017-12-18v4No1 / 1456
271amnoncommon depth (soil) 0-20cm, rhizosphere, glycine max, soybean, china2018-01-09v4No1 / 1459
760sheryoCommon in rhizosphere soil of rice plants with NPK fertilization in a long term fertilization experiment (common npk fertilization, npk fertilizer, ph 5.9, china, soil, qiyang county, hunan province, quaternary red clay, oryza sativa, rhizosphere)2021-04-06v4No1 / 1491
760sheryoCommon in rhizosphere soil of rice plants without fertilization in a long term fertilization experiment (common ph 5.9, china, soil, qiyang county, hunan province, quaternary red clay, no fertilization, oryza sativa, rhizosphere)2021-04-06v4No1 / 1506
600sheryolower in stover ammendment soil ( high in unamended soil compared to stover amended in depth (soil) 0-5cm state of new york soil united states of america coarse-loamy soil ph 6 day 82 )2020-03-27v4No1 / 1612
76amnonhigher in non-seleniferous soil compared to seleniferous soil ( high in non-seleniferous compared to selenium seleniferous in soil united states of america rhizosphere woodland area )2017-02-28v4No1 / 1621
821sheryoCommon in soil of continuous corn field at 10-25cm depth, Michigan USA (common depth (soil) 10-25cm, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, continuous corn, corn, soil)2021-07-28v4No1 / 1649
760sheryoCommon in rhizosphere soil of rice plants with manure fertilization in a long term fertilization experiment (common manure fertilization, manured soil, ph 5.9, china, soil, qiyang county, hunan province, quaternary red clay, oryza sativa, rhizosphere)2021-04-06v4No1 / 1670
156amnoncommon soil, rhizosphere, brassica, brassica oleracea, china2017-07-27v4No1 / 1885
821sheryoCommon in soil of switchgrass field at 0-10cm depth, Michigan USA (common kellogg biological station, mesic type hapludalf, kalamazoo loam, panicum virgatum, depth (soil) 0-10cm, state of michigan, soil, united states of america)2021-08-02v4No1 / 2067
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>6, ph<7, china2018-02-11v4No1 / 2223
155amnoncommon in soil loosely bound to wheat root (common triticum aestivum, wheat, soil, rhizosphere, china)2017-07-02v4No1 / 2425
155amnoncommon in bulk soil in wheat field (common triticum aestivum, wheat, soil, bulk soil, china)2017-07-02v4No1 / 2594
357amnon high in ph>4.5 compared to ph<4.5 in soil topsoil depth (soil) 0-10cm moist tropical forest woodland area forest ecosystem 2018-08-18v4No1 / 2773
271amnoncommon depth (soil) 0-20cm, soil, china2018-01-09v4No1 / 2856
155amnonlower in tightly bound root soil compared to loose soil and bulk soil ( high in bulk soil compared to root in triticum aestivum wheat soil china )2017-07-02v4No1 / 2933
837sheryoHigher in soil in agricultural feild compared after 10 years reforestation with Black locust trees, shaanxi, China ( high in triticum aestivum zea mays agricultural field compared to 10 years reforestation robinia pseudoacacia in silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 2994
462amnon high in rhizosphere compared to root in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 4630
271amnon high in soil compared to rhizosphere glycine max soybean in depth (soil) 0-20cm china 2018-01-09v4No1 / 4853
837sheryoHigher in soil after 30 years compared to 10 years of reforestation with Black locust trees, shaanxi, China ( high in 30 years compared to 10 years in robinia pseudoacacia reforestation silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 5245
837sheryoHigher in soil after 20 years compared to 10 years of reforestation with Black locust trees, shaanxi, China ( high in 20 years compared to 10 years in robinia pseudoacacia reforestation silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 5270
837sheryoHigher in soil after 30 years reforestation with Black locust trees compared to agricultural feild, shaanxi, China ( high in robinia pseudoacacia reforestation 30 years compared to zea mays triticum aestivum agricultural field in silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 5596
837sheryoHigher in soil after 20 years reforestation with Black locust trees compared agricultural feild, shaanxi, China ( high in robinia pseudoacacia reforestation 20 years compared to triticum aestivum zea mays agricultural field in silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 5661
271amnon high in soil rhizosphere compared to root structure root in depth (soil) 0-20cm glycine max soybean china 2018-01-09v4No1 / 7954

Problems / suggestions? Please email info AT dbbact DOT org