Search result for sequence:
TACGGAGGGTGCAAGCGTTATCCGGATTTACTGGGTTTAAAGGGTGCGTAGGCGGGTAGGTAAGTCAGTGGTGAAATCTCCGAGCTTAACTCGGAAACTGCCTTTGATACTATCTATCTTGAATATTGTGGAGGTAAGCGGAATATGTCA
common ontology terms
term enrichment score
TermScore
minas gerais state0.545455
campos rupestres0.545455
hedera hibernica0.444444
ivy0.444444
barbacenia macrantha0.375000
moor0.285714
vellozia epidendroides0.285714
belgium0.190476
scrubland0.166667
leaf0.164384
root endosphere0.142857
forest ecosystem0.142857
leaf surface0.133333
LOWER IN dense settlement biome0.125000
dense settlement biome0.125000
stem0.117647
rock0.111111
brazil0.096774
root0.080000
LOWER IN city0.062500
city0.062500
rhizosphere0.035088
Fraction of dbbact annotations with this term covered by the query
TermScore
hedera hibernica0.500000
ivy0.500000
moor0.500000
scrubland0.500000
minas gerais state0.500000
campos rupestres0.500000
vellozia epidendroides0.500000
barbacenia macrantha0.500000
root endosphere0.250000
leaf surface0.200000
LOWER IN dense settlement biome0.166667
dense settlement biome0.166667
stem0.142857
belgium0.125000
rock0.125000
forest ecosystem0.111111
leaf0.095238
root0.066667
brazil0.052632
LOWER IN city0.045455
city0.045455
rhizosphere0.021277
Fraction of annotations for the query sequences containing the term
TermScore
leaf0.600000
minas gerais state0.600000
campos rupestres0.600000
brazil0.600000
hedera hibernica0.400000
belgium0.400000
ivy0.400000
barbacenia macrantha0.300000
moor0.200000
forest ecosystem0.200000
vellozia epidendroides0.200000
LOWER IN city0.100000
LOWER IN dense settlement biome0.100000
city0.100000
dense settlement biome0.100000
scrubland0.100000
stem0.100000
rock0.100000
root endosphere0.100000
root0.100000
rhizosphere0.100000
leaf surface0.100000

Problems / suggestions? Please email info AT dbbact DOT org