Search result for sequence:
TACGGAGGGTGCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGTCCGTAGGCGGACTTATAAGTCAGTGGTGAAAGCCTGTCGCTTAACGATAGAACTGCCATTGATACTGTAAGTCTTGAGTATATTTGAGGTAGCTGGAATAAGTAG
common ontology terms
term enrichment score
TermScore
river0.246914
fresh water0.232558
water0.204651
costa rica0.169492
united states of america0.168285
air0.129870
nectar0.123457
flower0.109890
desert0.109589
leaf0.103004
homo sapiens0.092395
free floating0.084507
mexico0.084507
mississippi river0.083333
LOWER IN feces0.081633
bird0.078431
china0.076433
japan0.072727
duodenum0.069808
state of california0.063492
kingdom of spain0.062696
skin0.061256
wastewater treatment plant0.058252
filtered 0.2um0.057971
mountain0.057143
herbivorous beetle0.057143
koshi river0.057143
agave0.057143
butterfly0.055556
poland0.055556
beetle0.055556
nepal0.055556
leaf surface0.055556
sea water0.055453
hawaii0.054054
snow field0.054054
whole body0.054054
depth 10 cm0.054054
larval stage0.053571
united kingdom0.053333
intestine0.051724
city0.051724
infant0.051282
digestive system0.050125
research facility0.046396
soil0.045732
filtered 2.7um0.043956
coastal water0.043478
biopsy site0.043478
sea urchin0.043478
nida basin0.043478
canada0.043478
bon portage island0.043478
oceanodroma leucorhoa0.043478
seabird0.043478
centrocercus urophasianus0.043478
greater sage-grouse0.043478
state of wyoming0.043478
estuary0.043478
estuary water0.043478
bilbao0.043478
guanajuato0.043478
jiulong river0.043478
fujian province0.043478
depth 1m0.043478
lower mississippi river0.043478
effluent0.043478
aquatic biome0.043478
foodon product type0.043011
zebra fish0.043011
rhizosphere0.043011
whole plant0.042553
danio rerio0.042553
commonwealth of massachusetts0.042553
biopsy0.042553
lytechinus variegatus0.042553
hunan province0.042553
wet season0.042553
depth 0.5m0.042553
pair of nares0.042254
downstream0.041667
LOWER IN caecum0.040816
atlantic ocean0.038462
surface water0.038462
plant0.038462
summer0.037736
state of florida0.035088
feces0.031348
megaptera novaeangliae0.029630
humpback whale0.029630
particle0.029630
organic material0.029412
forest biome0.029412
psychotria suerrensis0.029412
psiguria triphylla0.029412
ruellia terminalis0.029412
outdoor0.029412
indoor0.029412
office0.029412
stachytarpheta frantzii0.029412
Fraction of dbbact annotations with this term covered by the query
TermScore
wastewater treatment plant0.750000
megaptera novaeangliae0.666667
humpback whale0.666667
river0.666667
filtered 0.2um0.666667
filtered 2.7um0.666667
particle0.666667
free floating0.600000
mexico0.600000
desert0.571429
eurema albula0.500000
ghost yellow butterfly0.500000
organic material0.500000
forest biome0.500000
psychotria suerrensis0.500000
sample blanks0.500000
mock community0.500000
psiguria triphylla0.500000
gobi desert0.500000
ruellia terminalis0.500000
outdoor0.500000
indoor0.500000
office0.500000
coastal water0.500000
stachytarpheta frantzii0.500000
purple porterweed0.500000
chlosyne gaudialis0.500000
biopsy site0.500000
hamelia patens0.500000
firebush0.500000
mountain0.500000
sea urchin0.500000
eagle harbor0.500000
depth 6-7m0.500000
arawacus togarna0.500000
nida basin0.500000
herbivorous beetle0.500000
argoptochus quadrisignatus0.500000
tooth0.500000
aphthona venustula0.500000
canada0.500000
bon portage island0.500000
oceanodroma leucorhoa0.500000
seabird0.500000
brood patch0.500000
nectar feeding0.500000
LOWER IN fruit feeding0.500000
centrocercus urophasianus0.500000
greater sage-grouse0.500000
state of wyoming0.500000
rice field0.500000
terrestrial biome0.500000
achatinella mustelina0.500000
environmental system determined by an organism0.500000
LOWER IN acute respiratory illness0.500000
fresh water0.500000
koshi river0.500000
tributary0.500000
middle timepoint0.500000
two weeks0.500000
LOWER IN fresh0.500000
LOWER IN food spoilage0.500000
drosophila0.500000
drosophila nigrospiracula0.500000
fly0.500000
mud0.500000
fermentation pit mud0.500000
hypopharynx0.500000
LOWER IN age 1 week0.500000
kitchen0.500000
sink0.500000
LOWER IN estonia0.500000
hong kong0.500000
low income0.500000
sewer0.500000
river nile0.500000
depth 50cm0.500000
cairo0.500000
crioceris duodecimpunctata0.500000
estuary0.500000
estuary water0.500000
salinity >20 ppt0.500000
bilbao0.500000
chitin beads0.500000
subway0.500000
ant0.500000
pseudomyrmex spinicola0.500000
england0.500000
common carp0.500000
cyprinus carpio0.500000
LOWER IN rainbow trout0.500000
LOWER IN oncorhynchus mykiss0.500000
LOWER IN detritivorous beetle0.500000
LOWER IN bulgaria0.500000
agave0.500000
guanajuato0.500000
agave tequiliana0.500000
lapland0.500000
LOWER IN cactus0.500000
LOWER IN decaying0.500000
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.295455
water0.181818
river0.151515
fresh water0.151515
costa rica0.113636
homo sapiens0.113636
china0.090909
flower0.075758
nectar0.075758
air0.075758
leaf0.068182
desert0.060606
research facility0.053030
japan0.045455
state of california0.045455
LOWER IN feces0.045455
feces0.045455
bird0.045455
free floating0.045455
mexico0.045455
mississippi river0.045455
digestive system0.037879
sea water0.037879
skin0.037879
duodenum0.037879
soil0.037879
kingdom of spain0.037879
butterfly0.030303
hawaii0.030303
larval stage0.030303
intestine0.030303
snow field0.030303
mountain0.030303
poland0.030303
whole body0.030303
beetle0.030303
herbivorous beetle0.030303
rhizosphere0.030303
infant0.030303
depth 10 cm0.030303
koshi river0.030303
nepal0.030303
filtered 0.2um0.030303
city0.030303
wastewater treatment plant0.030303
agave0.030303
leaf surface0.030303
united kingdom0.030303
whole plant0.022727
foodon product type0.022727
zebra fish0.022727
danio rerio0.022727
atlantic ocean0.022727
surface water0.022727
coastal water0.022727
commonwealth of massachusetts0.022727
biopsy site0.022727
biopsy0.022727
sea urchin0.022727
lytechinus variegatus0.022727
state of florida0.022727
plant0.022727
nida basin0.022727
canada0.022727
bon portage island0.022727
oceanodroma leucorhoa0.022727
seabird0.022727
centrocercus urophasianus0.022727
greater sage-grouse0.022727
state of wyoming0.022727
LOWER IN caecum0.022727
hunan province0.022727
pair of nares0.022727
summer0.022727
wet season0.022727
estuary0.022727
estuary water0.022727
bilbao0.022727
filtered 2.7um0.022727
guanajuato0.022727
depth 0.5m0.022727
jiulong river0.022727
fujian province0.022727
downstream0.022727
depth 1m0.022727
lower mississippi river0.022727
effluent0.022727
aquatic biome0.022727
organic material0.015152
forest biome0.015152
forest ecosystem0.015152
psychotria suerrensis0.015152
contamination0.015152
capsicum annuum0.015152
psiguria triphylla0.015152
ruellia terminalis0.015152
outdoor0.015152
indoor0.015152
office0.015152
stachytarpheta frantzii0.015152
Exp. ID User ID Description Date Region Flag Sequences
501amnoncommon costa rica, butterfly, digestive system, eurema albula, ghost yellow butterfly2019-03-09v4No1 / 6
28amnonhigh freq. in leaves in hawaii (highfreq hawaii, organic material, forest biome, whole plant, leaf, forest ecosystem)2016-12-05v4No1 / 7
501amnonhighfreq costa rica, flower, nectar, psychotria suerrensis2019-03-08v4No1 / 7
148amnonhigher in sample blanks compared to other samples (contamination)2017-04-20v4No1 / 8
92amnoncommon air, japan2017-03-09v4No1 / 9
74amnonhighfreq capsicum annuum, united states of america, foodon product type2017-02-27v4No1 / 10
92amnonhighfreq air, japan2017-03-09v4No1 / 10
117amnonhighfreq zebra fish, danio rerio, research facility, larval stage, united states of america, intestine2017-04-10v4No1 / 10
501amnonhighfreq costa rica, psiguria triphylla, flower, nectar2019-03-08v4No1 / 10
152amnonhigh in blanks compares to dust/nose samples (contamination)2017-05-04v4No1 / 10
370amnonhighfreq desert, air, gobi desert2018-09-06v4No1 / 11
501amnoncommon costa rica, flower, nectar, ruellia terminalis2019-03-08v4No1 / 11
460amnonhigh freq. in outdoor air (highfreq air, united states of america, state of california, outdoor)2019-01-12v4No1 / 12
460amnonhigh freq. in occupied office air (highfreq air, united states of america, state of california, indoor, office)2019-01-12v4No1 / 13
461amnonhighfreq water, atlantic ocean, surface water, coastal water, united states of america, commonwealth of massachusetts, sea water2019-01-12v4No1 / 13
501amnonhighfreq costa rica, flower, nectar, ruellia terminalis2019-03-08v4No1 / 13
501amnonhighfreq costa rica, flower, nectar, stachytarpheta frantzii, purple porterweed2019-03-08v4No1 / 13
501amnoncommon costa rica, butterfly, digestive system, chlosyne gaudialis2019-03-09v4No1 / 13
51amnonlower in stool compared to biopsies ( high in biopsy site biopsy compared to feces in homo sapiens united states of america )2017-01-19v4No1 / 14
501amnonhighfreq costa rica, hamelia patens, firebush, flower, nectar2019-03-08v4No1 / 15
501amnoncommon costa rica, flower, nectar, psychotria suerrensis2019-03-08v4No1 / 16
287amnonhighfreq snow field, mountain, depth 1-2m, japan2018-01-29v4No1 / 17
351amnonhighfreq sea urchin, lytechinus variegatus, coelomic fluid, research facility, eagle harbor, state of florida, united states of america2018-07-30v4No1 / 17
460amnoncommon in occupied office air (common air, united states of america, state of california, indoor, office)2019-01-12v4No1 / 17
287amnonhighfreq snow field, mountain, depth 6-7m, japan2018-01-29v4No1 / 18
501amnoncommon costa rica, hamelia patens, firebush, flower, nectar2019-03-08v4No1 / 20
460amnoncommon in outdoor air (common air, united states of america, state of california, outdoor)2019-01-12v4No1 / 21
501amnoncommon costa rica, psiguria triphylla, flower, nectar2019-03-08v4No1 / 21
501amnoncommon costa rica, butterfly, digestive system, arawacus togarna2019-03-09v4No1 / 21
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, argoptochus quadrisignatus2019-04-18v4No1 / 22
74amnoncommon capsicum annuum, united states of america, foodon product type2017-02-27v4No1 / 23
275amnoncommon megaptera novaeangliae, humpback whale, antarctica, antarctic peninsula, skin2018-01-16v4No1 / 26
287amnoncommon snow field, mountain, depth 1-2m, japan2018-01-29v4No1 / 35
51amnoncommon homo sapiens, biopsy site, biopsy, united states of america2017-01-19v4No1 / 38
33amnoncommon homo sapiens, sputum, lung, bronchial epithelium, vancouver2016-12-06v4No1 / 40
501amnoncommon costa rica, flower, nectar, stachytarpheta frantzii, purple porterweed2019-03-08v4No1 / 40
28amnoncommon in various trees in hawaii (common hawaii, organic material, forest biome, whole plant, leaf, forest ecosystem)2016-12-05v4No1 / 41
117amnoncommon zebra fish, danio rerio, research facility, larval stage, united states of america, intestine2017-04-10v4No1 / 41
95amnoncommon in root canal (common homo sapiens, brazil, tooth, root canal)2017-03-12v4No1 / 42
287amnoncommon snow field, mountain, depth 6-7m, japan2018-01-29v4No1 / 47
321amnonhigher in mice treated with ampicillin compared to untreated mice ( high in ampicillin antibiotic compared to control in mus musculus mouse c57bl/6j feces united states of america research facility )2018-04-22v4No1 / 52
515amnoncommon poland, whole body, beetle, aphthona venustula, plant, nida basin, herbivorous beetle2019-04-18v4No1 / 54
237amnoncommon canada, bon portage island, bird, oceanodroma leucorhoa, seabird, brood patch2017-11-07v4No1 / 57
237amnoncommon bird, oceanodroma leucorhoa, seabird, canada, bon portage island, uropygial gland2017-11-07v4No1 / 58
501amnonhigher in nectar feeding butterflies compared to fruit feeding ( high in nectar feeding compared to fruit feeding in costa rica butterfly digestive system )2019-03-09v4No1 / 64
558amnon high in duodenum compared to caecum in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 64
373amnonlower in soil of mature plants compared to seedlings ( high in early timepoints seedling compared to late timepoints in soil rhizosphere oryza sativa rice hunan province rice field china )2018-09-08v4No1 / 66
28amnoncommon hawaii, feces, terrestrial biome, achatinella mustelina, environmental system determined by an organism2016-12-05v4No1 / 71
133amnonhigher in healthy babies (<1yr) compared to acute respiratory illness ( high in control compared to acute respiratory illness respiratory system disease in homo sapiens infant nasopharynx australia )2017-04-16v4No1 / 80
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, tributary, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 80
269amnonpeaks at 2 weeks in refrigeration of yao meat ( high in middle timepoint two weeks compared to fresh food spoilage late timepoint in china foodon product type )2018-01-09v4No1 / 83
26amnon high in pair of nares mucus compared to saliva mouth in united states of america felis catus 2016-12-05v4No1 / 86
558amnon high in colon compared to caecum in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 97
201amnoncommon in cactus fly whole body (common drosophila, drosophila nigrospiracula, fly, mexico, desert, body proper)2017-10-01v4No1 / 101
168amnoncommon in mud from chinese liquor fermentation pit (common mud, ph 5, fermentation pit mud, china)2017-07-18v4No1 / 104
48amnonhigher in 3 months compared to 1 week in infant hypopharynx ( high in age age 3 months compared to age 1 week in homo sapiens kingdom of denmark hypopharynx infant )2017-01-19v4No1 / 117
410amnonlower in feces compared to rectal biopsies in children with treatment naive uc ( high in rectum biopsy biopsy site compared to feces in homo sapiens child united states of america ulcerative colitis )2018-11-22v4No1 / 118
113amnon high in larval stage compared to adult in danio rerio zebra fish research facility united states of america intestine 2017-04-10v4No1 / 128
199amnoncommon in kitchen sink (common building, urban biome, united states of america, kitchen, sink)2017-10-01v4No1 / 130
291amnoncommon canis lupus familiaris, dog, pair of nares, nasal cavity, germany2018-02-01v4No1 / 144
241amnonhigher in babies from russia compared to estonia ( high in russia compared to estonia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 146
475amnoncommon in air next to subway stations in hong kong (common air, hong kong, city)2019-01-20v4No1 / 147
53amnonhigher in sewer and wastewater influent comapred to feces in low income south america ( high in sewer wastewater treatment plant compared to feces in south america city low income )2017-01-21v4No1 / 148
366amnon high in summer wet season compared to winter dry season in river nile water river fresh water depth 50cm cairo egypt 2018-08-31v4No1 / 148
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, crioceris duodecimpunctata2019-04-18v4No1 / 157
510amnoncommon kingdom of spain, water, estuary, estuary water, saline water, salinity >20 ppt, bilbao2019-03-20v4No1 / 158
461amnonhigher in early compared to late timepoints in chitin beads incubated in ocean water ( high in early timepoints compared to late timepoints in water atlantic ocean surface water coastal water united states of america commonwealth of massachusetts chitin beads sea water )2019-01-12v4No1 / 160
475amnoncommon in air in subway train in hong kong (common air, hong kong, city, subway)2019-01-20v4No1 / 161
408amnon high in larval stage compared to stomach in ant costa rica united states of america pseudomyrmex spinicola 2018-11-22v4No1 / 165
106amnoncommon homo sapiens, dentition, germany, subgingival plaque, mouth2017-04-05v4No1 / 167
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 172
396amnon high in common carp cyprinus carpio compared to rainbow trout oncorhynchus mykiss in fish england intestine digestive system 2018-11-14v4No1 / 184
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, tributary, nepal, particle bound, filtered 2.7um2019-07-22v4No1 / 193
6amnoncommon urine, female, homo sapiens, pregnancy, state of tennessee2016-10-13v4No1 / 201
515amnon high in herbivorous beetle poland compared to detritivorous beetle bulgaria in whole body beetle 2019-04-19v4No1 / 205
360amnoncommon agave, desert, leaf, leaf surface, mexico, guanajuato, agave tequiliana, cultivated environment2018-08-21v4No1 / 210
511amnoncommon snow, depth 0-5cm, lapland, finland, sweden, kingdom of norway2019-03-20v4No1 / 213
201amnonhigher in cactus fly compared to decaying cactus ( high in drosophila fly drosophila nigrospiracula compared to cactus decaying in mexico desert )2017-10-01v4No1 / 215
331amnon high in dry season compared to wet season in feces monkey theropithecus gelada ethiopia 2018-05-13v4No1 / 232
161amnoncommon in barn swallows in colorado (common hirundo rustica, feces, united states of america, colorado, barn swallow)2017-07-12v4No1 / 245
351amnoncommon sea urchin, lytechinus variegatus, coelomic fluid, research facility, eagle harbor, state of florida, united states of america2018-07-30v4No1 / 249
160amnoncommon in river water upstream of WTP effluent in spring in china (common river, water, spring, china)2017-07-12v4No1 / 278
237amnonlower in burrow soil compared to bird ( high in oceanodroma leucorhoa bird seabird compared to soil burrow in canada bon portage island )2017-11-07v4No1 / 298
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 306
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, nepal, particle bound, filtered 2.7um2019-07-22v4No1 / 315
510amnoncommon kingdom of spain, water, estuary, estuary water, fresh water, salinity <5 ppt, bilbao2019-03-20v4No1 / 317
461amnoncommon water, atlantic ocean, surface water, coastal water, united states of america, commonwealth of massachusetts, sea water2019-01-12v4No1 / 322
351amnoncommon in artificial sea water where sea urchins were grown (common sea urchin, lytechinus variegatus, research facility, state of florida, united states of america, artificial seawater, sea water)2018-07-30v4No1 / 338
254amnoncommon river, water, fresh water, depth 0.5m, jiulong river, fujian province, china2017-11-23v4No1 / 347
443amnoncommon united states of america, river, water, fresh water, mississippi river, free floating, downstream, depth 1m, filtered 0.2um, lower mississippi river2019-01-07v4No1 / 349
254amnonhigher in river when close to populated region compared to downstream ( high in city populated place upstream compared to downstream in river water fresh water depth 0.5m jiulong river fujian province china )2017-11-23v4No1 / 356
209amnonhigher in whale blow condensate compared to ocean water ( high in whale blow exhaled air condensate respiratory airway megaptera novaeangliae humpback whale compared to sea water ocean depth 25cm in north america )2017-10-15v4No1 / 359
341amnonhigher in fresh drinking water compared to week old water ( high in fresh water compared to stagnant water in water drinking water united states of america tap water state of illinois )2018-05-28v4No1 / 365
160amnoncommon in river water upstream of WTP effluent in autumn in china (common river, water, autumn, china)2017-07-12v4No1 / 376
29amnon high in seed compared to seedling in brassica oleracea french republic 2016-12-05v4No1 / 379
256amnoncommon sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 380
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
342amnoncommon water, pacific ocean, philippine sea, depth 150m, sea water2018-05-28v4No1 / 397
558amnon high in gizzard compared to crop in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 408
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, pseudacris crucifer, peeper2017-04-02v4No1 / 438
160amnoncommon in wastewater treatment plant effluent in autumn in china (common autumn, wastewater treatment plant, effluent, china)2017-07-12v4No1 / 469
28amnon high in whole plant leaf compared to feces achatinella mustelina in hawaii 2016-12-05v4No1 / 471
366amnoncommon river nile, water, river, fresh water, depth 50cm, cairo, egypt, summer, wet season2018-08-31v4No1 / 474
375amnoncommon in oil contaminated desert soil (common soil, kuwait, desert, oil contaminated soil)2018-09-09v4No1 / 490
360amnoncommon agave, desert, leaf, leaf surface, agave salmiana, mexico, guanajuato2018-08-21v4No1 / 492
373amnoncommon soil, rhizosphere, oryza sativa, rice, hunan province, rice field, china2018-09-08v4No1 / 501
315amnonhigher in frog pond water compared to frog gut ( high in water fresh water compared to digestive system colon frog quasipaa spinosa giant spiny frog in jiangxi province hunan province china )2018-04-10v4No1 / 505
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
129amnoncommon mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, leaf2017-04-15v4No1 / 562
160amnoncommon in wastewater treatment plant effluent in spring in china (common wastewater treatment plant, effluent, spring, china)2017-07-12v4No1 / 573
254amnon high in summer wet season compared to winter dry season autumn in river water fresh water depth 0.5m jiulong river fujian province china 2017-11-23v4No1 / 581
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in kingdom of spain water estuary estuary water bilbao 2019-03-20v4No1 / 592
425amnon high in duodenum compared to feces in homo sapiens africa child 2018-12-08v4No1 / 622
360amnonhigher in leaf surface compared to soil in agave plants ( high in leaf leaf surface compared to soil in desert state of california mexico guanajuato agave )2018-08-21v4No1 / 645
360amnoncommon agave, desert, state of california, agave deserti, leaf, leaf surface2018-08-21v4No1 / 649
443amnonhigher in lower mississippi river (downstream) compared to upper mississippi river ( high in downstream lower mississippi river compared to upstream higher mississippi river in mississippi river water river fresh water depth 1m united states of america free floating filtered 0.2um )2019-01-07v4No1 / 652
103amnonlower in particle bound fraction compared to free floating bacteria in mississippi river ( high in free floating compared to particle in river united states of america mississippi river fresh water aquatic biome )2017-04-05v4No1 / 653
200amnoncommon in river downstream of wastewater treatment plant (common river, fresh water, water, united states of america, wastewater treatment plant, effluent)2017-10-01v4No1 / 655
206amnoncommon in air from israel particles <10um size (common air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 765
371amnonhigher in skin of amerindians compared to western visitors ( high in venezuela hunter gatherer amerindian compared to city united states of america in homo sapiens skin )2018-09-06v4No1 / 854
103amnoncommon river, united states of america, mississippi river, fresh water, aquatic biome, particle2017-04-05v4No1 / 909
103amnoncommon river, united states of america, mississippi river, fresh water, aquatic biome, free floating2017-04-05v4No1 / 909
37amnonlower in tomato plant leaves compared to plastic control ( high in control compared to solanum lycopersicum in maryland county leaf )2016-12-09v4No1 / 950
193amnonhigher in nares of people working in dairy farms ( high in bos taurus farm compared to control in homo sapiens united states of america pair of nares )2017-09-05v4No1 / 992
252amnoncommon in river rock biofilm (common kingdom of spain, biofilm, river, rock, epilithic)2017-11-22v4No1 / 1081
252amnoncommon in river sand biofilm (common river, biofilm, kingdom of spain, sand)2017-11-22v4No1 / 1181
443amnonhigher in lower mississippi river (downstream) compared to upper mississippi river ( high in lower mississippi river downstream compared to upper mississippi river upstream in mississippi river water river fresh water depth 1m united states of america particle filtered 2.7um )2019-01-07v4No1 / 1418
76amnoncommon in seleniferous soil (common soil, rhizosphere, united states of america, selenium, seleniferous, woodland area)2017-02-28v4No1 / 1438
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in newt adult skin cambridgeshire triturus cristatus united kingdom )2018-07-30v4No1 / 1834
101amnon high in root compared to rhizosphere in vitis vinifera united states of america merlot grapevine new york 2017-04-03v4No1 / 2075
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in newt adult skin cambridgeshire lissotriton vulgaris united kingdom )2018-07-30v4No1 / 2162
76amnonhigher in seleniferous soil compared to non-seleniferous soil ( high in selenium seleniferous compared to non-seleniferous in soil rhizosphere united states of america woodland area )2017-02-28v4No1 / 2259

Problems / suggestions? Please email info AT dbbact DOT org