Search result for sequence:
TACGGAGGGTGCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGTCCGTAGGCGGACTTATAAGTCAGTGGTGAAAGCCTGTCGCTTAACGATAGAACTGCCATTGATACTGTAAGTCTTGAGTATATTTGAGGTAGCTGGAATAAGTAG
common ontology terms
term enrichment score
TermScore
fresh water0.268097
water0.240095
river0.236686
united states of america0.168709
costa rica0.156658
air0.124224
nectar0.118343
flower0.105820
desert0.104575
leaf0.097826
homo sapiens0.086245
free floating0.080537
mexico0.080537
state of florida0.080402
china0.079772
mississippi river0.079470
LOWER IN feces0.077419
bird0.073620
japan0.069767
spring water0.067114
duodenum0.066556
state of california0.061224
kingdom of spain0.058309
skin0.057887
wastewater treatment plant0.055427
filtered 0.2um0.055172
poland0.054422
herbivorous beetle0.054422
koshi river0.054422
agave0.054422
sea water0.053381
butterfly0.052980
mountain0.052980
beetle0.052980
nepal0.052980
hawaii0.051613
snow field0.051613
depth 10 cm0.051613
leaf surface0.051613
larval stage0.051173
united kingdom0.050955
whole body0.049080
city0.049080
infant0.048682
intestine0.048290
digestive system0.047847
research facility0.042683
filtered 2.7um0.041812
coastal water0.041379
biopsy site0.041379
sea urchin0.041379
nida basin0.041379
bon portage island0.041379
oceanodroma leucorhoa0.041379
seabird0.041379
centrocercus urophasianus0.041379
greater sage-grouse0.041379
state of wyoming0.041379
estuary0.041379
estuary water0.041379
bilbao0.041379
guanajuato0.041379
jiulong river0.041379
fujian province0.041379
depth 1m0.041379
lower mississippi river0.041379
effluent0.041379
aquatic biome0.041379
soil0.040984
foodon product type0.040956
zebra fish0.040956
whole plant0.040541
danio rerio0.040541
biopsy0.040541
lytechinus variegatus0.040541
canada0.040541
hunan province0.040541
wet season0.040541
depth 0.5m0.040541
pair of nares0.040000
downstream0.039735
rhizosphere0.039024
commonwealth of massachusetts0.038961
LOWER IN caecum0.038217
atlantic ocean0.036810
surface water0.036810
plant0.036810
summer0.036145
farm0.033149
feces0.029084
megaptera novaeangliae0.028169
humpback whale0.028169
particle0.028169
organic material0.027972
forest biome0.027972
psychotria suerrensis0.027972
psiguria triphylla0.027972
ruellia terminalis0.027972
outdoor0.027972
indoor0.027972
Fraction of dbbact annotations with this term covered by the query
TermScore
wastewater treatment plant0.750000
megaptera novaeangliae0.666667
humpback whale0.666667
river0.666667
filtered 0.2um0.666667
filtered 2.7um0.666667
particle0.666667
free floating0.600000
mexico0.600000
desert0.571429
fresh water0.526316
eurema albula0.500000
ghost yellow butterfly0.500000
organic material0.500000
forest biome0.500000
psychotria suerrensis0.500000
sample blanks0.500000
mock community0.500000
psiguria triphylla0.500000
gobi desert0.500000
ruellia terminalis0.500000
outdoor0.500000
indoor0.500000
office0.500000
coastal water0.500000
stachytarpheta frantzii0.500000
purple porterweed0.500000
chlosyne gaudialis0.500000
biopsy site0.500000
hamelia patens0.500000
firebush0.500000
turtle farm0.500000
sea urchin0.500000
eagle harbor0.500000
depth 6-7m0.500000
arawacus togarna0.500000
poland0.500000
nida basin0.500000
herbivorous beetle0.500000
argoptochus quadrisignatus0.500000
tooth0.500000
aphthona venustula0.500000
bon portage island0.500000
oceanodroma leucorhoa0.500000
seabird0.500000
brood patch0.500000
nectar feeding0.500000
LOWER IN fruit feeding0.500000
centrocercus urophasianus0.500000
greater sage-grouse0.500000
state of wyoming0.500000
terrestrial biome0.500000
achatinella mustelina0.500000
environmental system determined by an organism0.500000
LOWER IN acute respiratory illness0.500000
koshi river0.500000
tributary0.500000
middle timepoint0.500000
two weeks0.500000
LOWER IN fresh0.500000
LOWER IN food spoilage0.500000
drosophila0.500000
drosophila nigrospiracula0.500000
fly0.500000
hypopharynx0.500000
LOWER IN age 1 week0.500000
kitchen0.500000
sink0.500000
LOWER IN estonia0.500000
hong kong0.500000
low income0.500000
sewer0.500000
river nile0.500000
depth 50cm0.500000
cairo0.500000
crioceris duodecimpunctata0.500000
estuary0.500000
estuary water0.500000
salinity >20 ppt0.500000
bilbao0.500000
chitin beads0.500000
subway0.500000
ant0.500000
pseudomyrmex spinicola0.500000
england0.500000
common carp0.500000
cyprinus carpio0.500000
LOWER IN rainbow trout0.500000
LOWER IN oncorhynchus mykiss0.500000
LOWER IN detritivorous beetle0.500000
LOWER IN bulgaria0.500000
agave0.500000
guanajuato0.500000
agave tequiliana0.500000
lapland0.500000
LOWER IN cactus0.500000
LOWER IN decaying0.500000
theropithecus gelada0.500000
hirundo rustica0.500000
colorado0.500000
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.316547
water0.223022
fresh water0.179856
river0.143885
costa rica0.107914
homo sapiens0.107914
china0.100719
flower0.071942
nectar0.071942
air0.071942
leaf0.064748
desert0.057554
state of florida0.057554
research facility0.050360
japan0.043165
state of california0.043165
LOWER IN feces0.043165
feces0.043165
bird0.043165
free floating0.043165
mexico0.043165
mississippi river0.043165
digestive system0.035971
sea water0.035971
skin0.035971
duodenum0.035971
soil0.035971
kingdom of spain0.035971
spring water0.035971
butterfly0.028777
hawaii0.028777
larval stage0.028777
intestine0.028777
snow field0.028777
mountain0.028777
poland0.028777
whole body0.028777
beetle0.028777
herbivorous beetle0.028777
rhizosphere0.028777
infant0.028777
depth 10 cm0.028777
koshi river0.028777
nepal0.028777
filtered 0.2um0.028777
city0.028777
wastewater treatment plant0.028777
agave0.028777
leaf surface0.028777
united kingdom0.028777
whole plant0.021583
foodon product type0.021583
zebra fish0.021583
danio rerio0.021583
atlantic ocean0.021583
surface water0.021583
coastal water0.021583
commonwealth of massachusetts0.021583
biopsy site0.021583
biopsy0.021583
farm0.021583
sea urchin0.021583
lytechinus variegatus0.021583
plant0.021583
nida basin0.021583
canada0.021583
bon portage island0.021583
oceanodroma leucorhoa0.021583
seabird0.021583
centrocercus urophasianus0.021583
greater sage-grouse0.021583
state of wyoming0.021583
LOWER IN caecum0.021583
hunan province0.021583
pair of nares0.021583
summer0.021583
wet season0.021583
estuary0.021583
estuary water0.021583
bilbao0.021583
filtered 2.7um0.021583
guanajuato0.021583
depth 0.5m0.021583
jiulong river0.021583
fujian province0.021583
downstream0.021583
depth 1m0.021583
lower mississippi river0.021583
effluent0.021583
aquatic biome0.021583
organic material0.014388
forest biome0.014388
forest ecosystem0.014388
psychotria suerrensis0.014388
contamination0.014388
capsicum annuum0.014388
psiguria triphylla0.014388
ruellia terminalis0.014388
outdoor0.014388
indoor0.014388
Exp. ID User ID Description Date Region Flag Sequences
501amnoncommon costa rica, butterfly, digestive system, eurema albula, ghost yellow butterfly2019-03-09v4No1 / 6
28amnonhigh freq. in leaves in hawaii (dominant hawaii, organic material, forest biome, whole plant, leaf, forest ecosystem)2016-12-05v4No1 / 7
501amnondominant costa rica, flower, nectar, psychotria suerrensis2019-03-08v4No1 / 7
148amnonhigher in sample blanks compared to other samples (contamination)2017-04-20v4No1 / 8
92amnoncommon air, japan2017-03-09v4No1 / 9
74amnondominant capsicum annuum, united states of america, foodon product type2017-02-27v4No1 / 10
92amnondominant air, japan2017-03-09v4No1 / 10
117amnondominant zebra fish, danio rerio, research facility, larval stage, united states of america, intestine2017-04-10v4No1 / 10
501amnondominant costa rica, psiguria triphylla, flower, nectar2019-03-08v4No1 / 10
152amnonhigh in blanks compares to dust/nose samples (contamination)2017-05-04v4No1 / 10
370amnondominant desert, air, gobi desert2018-09-06v4No1 / 11
501amnoncommon costa rica, flower, nectar, ruellia terminalis2019-03-08v4No1 / 11
460amnonhigh freq. in outdoor air (dominant air, united states of america, state of california, outdoor)2019-01-12v4No1 / 12
460amnonhigh freq. in occupied office air (dominant air, united states of america, state of california, indoor, office)2019-01-12v4No1 / 13
461amnondominant water, atlantic ocean, surface water, coastal water, united states of america, commonwealth of massachusetts, sea water2019-01-12v4No1 / 13
501amnondominant costa rica, flower, nectar, ruellia terminalis2019-03-08v4No1 / 13
501amnondominant costa rica, flower, nectar, stachytarpheta frantzii, purple porterweed2019-03-08v4No1 / 13
501amnoncommon costa rica, butterfly, digestive system, chlosyne gaudialis2019-03-09v4No1 / 13
51amnonlower in stool compared to biopsies ( high in biopsy site biopsy compared to feces in homo sapiens united states of america )2017-01-19v4No1 / 14
501amnondominant costa rica, hamelia patens, firebush, flower, nectar2019-03-08v4No1 / 15
501amnoncommon costa rica, flower, nectar, psychotria suerrensis2019-03-08v4No1 / 16
590amnoncommon in turtle pond water (dominant china, turtle farm, farm, hainan autonomous prefecture, pond water, water)2020-02-10v4No1 / 16
287amnondominant snow field, mountain, depth 1-2m, japan2018-01-29v4No1 / 17
351amnondominant sea urchin, lytechinus variegatus, coelomic fluid, research facility, eagle harbor, state of florida, united states of america2018-07-30v4No1 / 17
460amnoncommon in occupied office air (common air, united states of america, state of california, indoor, office)2019-01-12v4No1 / 17
287amnondominant snow field, mountain, depth 6-7m, japan2018-01-29v4No1 / 18
501amnoncommon costa rica, hamelia patens, firebush, flower, nectar2019-03-08v4No1 / 20
460amnoncommon in outdoor air (common air, united states of america, state of california, outdoor)2019-01-12v4No1 / 21
501amnoncommon costa rica, psiguria triphylla, flower, nectar2019-03-08v4No1 / 21
501amnoncommon costa rica, butterfly, digestive system, arawacus togarna2019-03-09v4No1 / 21
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, argoptochus quadrisignatus2019-04-18v4No1 / 22
74amnoncommon capsicum annuum, united states of america, foodon product type2017-02-27v4No1 / 23
275amnoncommon megaptera novaeangliae, humpback whale, antarctica, antarctic peninsula, skin2018-01-16v4No1 / 26
287amnoncommon snow field, mountain, depth 1-2m, japan2018-01-29v4No1 / 35
51amnoncommon homo sapiens, biopsy site, biopsy, united states of america2017-01-19v4No1 / 38
33amnoncommon homo sapiens, sputum, lung, bronchial epithelium, vancouver2016-12-06v4No1 / 40
501amnoncommon costa rica, flower, nectar, stachytarpheta frantzii, purple porterweed2019-03-08v4No1 / 40
28amnoncommon in various trees in hawaii (common hawaii, organic material, forest biome, whole plant, leaf, forest ecosystem)2016-12-05v4No1 / 41
117amnoncommon zebra fish, danio rerio, research facility, larval stage, united states of america, intestine2017-04-10v4No1 / 41
95amnoncommon in root canal (common homo sapiens, brazil, tooth, root canal)2017-03-12v4No1 / 42
287amnoncommon snow field, mountain, depth 6-7m, japan2018-01-29v4No1 / 47
321amnonhigher in mice treated with ampicillin compared to untreated mice ( high in ampicillin antibiotic compared to control in mus musculus mouse c57bl/6j feces united states of america research facility )2018-04-22v4No1 / 52
515amnoncommon poland, whole body, beetle, aphthona venustula, plant, nida basin, herbivorous beetle2019-04-18v4No1 / 54
237amnoncommon canada, bon portage island, bird, oceanodroma leucorhoa, seabird, brood patch2017-11-07v4No1 / 57
237amnoncommon bird, oceanodroma leucorhoa, seabird, canada, bon portage island, uropygial gland2017-11-07v4No1 / 58
501amnonhigher in nectar feeding butterflies compared to fruit feeding ( high in nectar feeding compared to fruit feeding in costa rica butterfly digestive system )2019-03-09v4No1 / 64
558amnon high in duodenum compared to caecum in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 64
373amnonlower in soil of mature plants compared to seedlings ( high in early timepoints seedling compared to late timepoints in soil rhizosphere oryza sativa rice hunan province rice field china )2018-09-08v4No1 / 66
28amnoncommon hawaii, feces, terrestrial biome, achatinella mustelina, environmental system determined by an organism2016-12-05v4No1 / 71
133amnonhigher in healthy babies (<1yr) compared to acute respiratory illness ( high in control compared to acute respiratory illness respiratory system disease in homo sapiens infant nasopharynx australia )2017-04-16v4No1 / 80
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, tributary, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 80
269amnonpeaks at 2 weeks in refrigeration of yao meat ( high in middle timepoint two weeks compared to fresh food spoilage late timepoint in china foodon product type )2018-01-09v4No1 / 83
26amnon high in pair of nares mucus compared to saliva mouth in united states of america felis catus 2016-12-05v4No1 / 86
558amnon high in colon compared to caecum in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 97
201amnoncommon in cactus fly whole body (common drosophila, drosophila nigrospiracula, fly, mexico, desert, body proper)2017-10-01v4No1 / 101
168amnoncommon in mud from chinese liquor fermentation pit (common mud, ph 5, fermentation pit mud, china)2017-07-18v4No1 / 104
48amnonhigher in 3 months compared to 1 week in infant hypopharynx ( high in age age 3 months compared to age 1 week in homo sapiens kingdom of denmark hypopharynx infant )2017-01-19v4No1 / 117
410amnonlower in feces compared to rectal biopsies in children with treatment naive uc ( high in rectum biopsy biopsy site compared to feces in homo sapiens child united states of america ulcerative colitis )2018-11-22v4No1 / 118
590amnoncommon in turtle pond water (common china, turtle farm, farm, hainan autonomous prefecture, pond water, water)2020-02-10v4No1 / 127
113amnon high in larval stage compared to adult in danio rerio zebra fish research facility united states of america intestine 2017-04-10v4No1 / 128
199amnoncommon in kitchen sink (common building, urban biome, united states of america, kitchen, sink)2017-10-01v4No1 / 130
291amnoncommon canis lupus familiaris, dog, pair of nares, nasal cavity, germany2018-02-01v4No1 / 144
241amnonhigher in babies from russia compared to estonia ( high in russia compared to estonia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 146
475amnoncommon in air next to subway stations in hong kong (common air, hong kong, city)2019-01-20v4No1 / 147
53amnonhigher in sewer and wastewater influent comapred to feces in low income south america ( high in sewer wastewater treatment plant compared to feces in south america city low income )2017-01-21v4No1 / 148
366amnon high in summer wet season compared to winter dry season in river nile water river fresh water depth 50cm cairo egypt 2018-08-31v4No1 / 148
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, crioceris duodecimpunctata2019-04-18v4No1 / 157
510amnoncommon kingdom of spain, water, estuary, estuary water, saline water, salinity >20 ppt, bilbao2019-03-20v4No1 / 158
461amnonhigher in early compared to late timepoints in chitin beads incubated in ocean water ( high in early timepoints compared to late timepoints in water atlantic ocean surface water coastal water united states of america commonwealth of massachusetts chitin beads sea water )2019-01-12v4No1 / 160
475amnoncommon in air in subway train in hong kong (common air, hong kong, city, subway)2019-01-20v4No1 / 161
408amnon high in larval stage compared to stomach in ant costa rica united states of america pseudomyrmex spinicola 2018-11-22v4No1 / 165
106amnoncommon homo sapiens, dentition, germany, subgingival plaque, mouth2017-04-05v4No1 / 167
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 172
396amnon high in common carp cyprinus carpio compared to rainbow trout oncorhynchus mykiss in fish england intestine digestive system 2018-11-14v4No1 / 184
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, tributary, nepal, particle bound, filtered 2.7um2019-07-22v4No1 / 193
6amnoncommon urine, female, homo sapiens, pregnancy, state of tennessee2016-10-13v4No1 / 201
515amnon high in herbivorous beetle poland compared to detritivorous beetle bulgaria in whole body beetle 2019-04-19v4No1 / 205
360amnoncommon agave, desert, leaf, leaf surface, mexico, guanajuato, agave tequiliana, cultivated environment2018-08-21v4No1 / 210
511amnoncommon snow, depth 0-5cm, lapland, finland, sweden, kingdom of norway2019-03-20v4No1 / 213
201amnonhigher in cactus fly compared to decaying cactus ( high in drosophila fly drosophila nigrospiracula compared to cactus decaying in mexico desert )2017-10-01v4No1 / 215
331amnon high in dry season compared to wet season in feces monkey theropithecus gelada ethiopia 2018-05-13v4No1 / 232
161amnoncommon in barn swallows in colorado (common hirundo rustica, feces, united states of america, colorado, barn swallow)2017-07-12v4No1 / 245
351amnoncommon sea urchin, lytechinus variegatus, coelomic fluid, research facility, eagle harbor, state of florida, united states of america2018-07-30v4No1 / 249
160amnoncommon in river water upstream of WTP effluent in spring in china (common river, water, spring, china)2017-07-12v4No1 / 278
237amnonlower in burrow soil compared to bird ( high in oceanodroma leucorhoa bird seabird compared to soil burrow in canada bon portage island )2017-11-07v4No1 / 298
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 306
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, nepal, particle bound, filtered 2.7um2019-07-22v4No1 / 315
510amnoncommon kingdom of spain, water, estuary, estuary water, fresh water, salinity <5 ppt, bilbao2019-03-20v4No1 / 317
461amnoncommon water, atlantic ocean, surface water, coastal water, united states of america, commonwealth of massachusetts, sea water2019-01-12v4No1 / 322
351amnoncommon in artificial sea water where sea urchins were grown (common sea urchin, lytechinus variegatus, research facility, state of florida, united states of america, artificial seawater, sea water)2018-07-30v4No1 / 338
254amnoncommon river, water, fresh water, depth 0.5m, jiulong river, fujian province, china2017-11-23v4No1 / 347
443amnoncommon united states of america, river, water, fresh water, mississippi river, free floating, downstream, depth 1m, filtered 0.2um, lower mississippi river2019-01-07v4No1 / 349
254amnonhigher in river when close to populated region compared to downstream ( high in city populated place upstream compared to downstream in river water fresh water depth 0.5m jiulong river fujian province china )2017-11-23v4No1 / 356
209amnonhigher in whale blow condensate compared to ocean water ( high in whale blow exhaled air condensate respiratory airway megaptera novaeangliae humpback whale compared to sea water ocean depth 25cm in north america )2017-10-15v4No1 / 359
341amnonhigher in fresh drinking water compared to week old water ( high in fresh water compared to stagnant water in water drinking water united states of america tap water state of illinois )2018-05-28v4No1 / 365
160amnoncommon in river water upstream of WTP effluent in autumn in china (common river, water, autumn, china)2017-07-12v4No1 / 376
29amnon high in seed compared to seedling in brassica oleracea french republic 2016-12-05v4No1 / 379
256amnoncommon sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 380
612amnoncommon state of florida, united states of america, spring water, water, fresh water, location 52020-04-22v4No1 / 383
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
342amnoncommon water, pacific ocean, philippine sea, depth 150m, sea water2018-05-28v4No1 / 397
558amnon high in gizzard compared to crop in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 408
612amnoncommon state of florida, united states of america, spring water, water, fresh water, location 32020-04-22v4No1 / 420
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, pseudacris crucifer, peeper2017-04-02v4No1 / 438
160amnoncommon in wastewater treatment plant effluent in autumn in china (common autumn, wastewater treatment plant, effluent, china)2017-07-12v4No1 / 469
28amnon high in whole plant leaf compared to feces achatinella mustelina in hawaii 2016-12-05v4No1 / 471
366amnoncommon river nile, water, river, fresh water, depth 50cm, cairo, egypt, summer, wet season2018-08-31v4No1 / 474
375amnoncommon in oil contaminated desert soil (common soil, kuwait, desert, oil contaminated soil)2018-09-09v4No1 / 490
360amnoncommon agave, desert, leaf, leaf surface, agave salmiana, mexico, guanajuato2018-08-21v4No1 / 492
373amnoncommon soil, rhizosphere, oryza sativa, rice, hunan province, rice field, china2018-09-08v4No1 / 501
315amnonhigher in frog pond water compared to frog gut ( high in water fresh water compared to digestive system colon frog quasipaa spinosa giant spiny frog in jiangxi province hunan province china )2018-04-10v4No1 / 505
612amnoncommon state of florida, united states of america, spring water, water, fresh water, location 12020-04-22v4No1 / 518
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
129amnoncommon mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, leaf2017-04-15v4No1 / 562
160amnoncommon in wastewater treatment plant effluent in spring in china (common wastewater treatment plant, effluent, spring, china)2017-07-12v4No1 / 573
254amnon high in summer wet season compared to winter dry season autumn in river water fresh water depth 0.5m jiulong river fujian province china 2017-11-23v4No1 / 581
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in kingdom of spain water estuary estuary water bilbao 2019-03-20v4No1 / 592
612amnoncommon state of florida, united states of america, spring water, water, fresh water, location 22020-04-22v4No1 / 596
425amnon high in duodenum compared to feces in homo sapiens africa child 2018-12-08v4No1 / 622
360amnonhigher in leaf surface compared to soil in agave plants ( high in leaf leaf surface compared to soil in desert state of california mexico guanajuato agave )2018-08-21v4No1 / 645
360amnoncommon agave, desert, state of california, agave deserti, leaf, leaf surface2018-08-21v4No1 / 649
443amnonhigher in lower mississippi river (downstream) compared to upper mississippi river ( high in downstream lower mississippi river compared to upstream higher mississippi river in mississippi river water river fresh water depth 1m united states of america free floating filtered 0.2um )2019-01-07v4No1 / 652
103amnonlower in particle bound fraction compared to free floating bacteria in mississippi river ( high in free floating compared to particle in river united states of america mississippi river fresh water aquatic biome )2017-04-05v4No1 / 653
200amnoncommon in river downstream of wastewater treatment plant (common river, fresh water, water, united states of america, wastewater treatment plant, effluent)2017-10-01v4No1 / 655
612amnoncommon state of florida, united states of america, spring water, water, fresh water, location 42020-04-22v4No1 / 655
206amnoncommon in air from israel particles <10um size (common air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 765
371amnonhigher in skin of amerindians compared to western visitors ( high in venezuela hunter gatherer amerindian compared to city united states of america in homo sapiens skin )2018-09-06v4No1 / 854
103amnoncommon river, united states of america, mississippi river, fresh water, aquatic biome, particle2017-04-05v4No1 / 909
103amnoncommon river, united states of america, mississippi river, fresh water, aquatic biome, free floating2017-04-05v4No1 / 909
37amnonlower in tomato plant leaves compared to plastic control ( high in control compared to solanum lycopersicum in maryland county leaf )2016-12-09v4No1 / 950
193amnonhigher in nares of people working in dairy farms ( high in bos taurus farm compared to control in homo sapiens united states of america pair of nares )2017-09-05v4No1 / 992
252amnoncommon in river rock biofilm (common kingdom of spain, biofilm, river, rock, epilithic)2017-11-22v4No1 / 1081
252amnoncommon in river sand biofilm (common river, biofilm, kingdom of spain, sand)2017-11-22v4No1 / 1181
443amnonhigher in lower mississippi river (downstream) compared to upper mississippi river ( high in lower mississippi river downstream compared to upper mississippi river upstream in mississippi river water river fresh water depth 1m united states of america particle filtered 2.7um )2019-01-07v4No1 / 1418
76amnoncommon in seleniferous soil (common soil, rhizosphere, united states of america, selenium, seleniferous, woodland area)2017-02-28v4No1 / 1438
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in newt adult skin cambridgeshire triturus cristatus united kingdom )2018-07-30v4No1 / 1834
101amnon high in root compared to rhizosphere in vitis vinifera united states of america merlot grapevine new york 2017-04-03v4No1 / 2075
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in newt adult skin cambridgeshire lissotriton vulgaris united kingdom )2018-07-30v4No1 / 2162
76amnonhigher in seleniferous soil compared to non-seleniferous soil ( high in selenium seleniferous compared to non-seleniferous in soil rhizosphere united states of america woodland area )2017-02-28v4No1 / 2259

Problems / suggestions? Please email info AT dbbact DOT org