Search result for sequence:
TACGGAGGGTGCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGTCCGTAGGCGGATCTGTAAGTCAGTGGTGAAATCTCGCAGCTTAACTGCGAAACTGCCATTGATACTGCAGGTCTTGAGTGTTGTTGAAGTAGCTGGAATAAGTAG
common ontology terms
term enrichment score
TermScore
southern united states0.666667
snake0.500000
pantherophis obsoletus0.500000
black rat snake0.500000
arboreal snake0.500000
terrestrial snake0.500000
LOWER IN aquatic snake0.500000
skin0.071429
united states of america0.009950
Fraction of dbbact annotations with this term covered by the query
TermScore
southern united states0.500000
pantherophis obsoletus0.500000
black rat snake0.500000
arboreal snake0.500000
terrestrial snake0.500000
LOWER IN aquatic snake0.500000
snake0.333333
skin0.037037
united states of america0.005000
Fraction of annotations for the query sequences containing the term
TermScore
snake1.000000
skin1.000000
united states of america1.000000
southern united states1.000000
pantherophis obsoletus0.500000
black rat snake0.500000
arboreal snake0.500000
terrestrial snake0.500000
LOWER IN aquatic snake0.500000

Problems / suggestions? Please email info AT dbbact DOT org