Search result for sequence:
TACGGAGGGTGCAAGCGTTATTCGGAATCACTGGGCGTAAAGAGCGCGTAGGCGGTTTCTAAAGTCAGATGTGAAAGCCCGGGGCTCAACCCCGGAAGTGCATTTGAAACTTAGGGACTTGAGTATGGGAGAGGGAAGTGGAATTCCTGG
common ontology terms
term enrichment score
TermScore
marine sediment0.595745
mangrove swamp0.580645
sediment0.401114
mangrove0.320000
ocean0.300546
spartina alterniflora0.288660
north east pacific ocean0.208333
kandelia candel0.208333
depth 0-20cm0.205882
hainan autonomous prefecture0.188679
oil seep0.188679
guangdong province0.160000
zhejiang province0.147059
danzhou xinyinggang nature reserve0.136364
saline marsh0.136364
nan'ao island0.136364
depth 1000-2000m0.136364
mudflat0.136364
futian national nature reserve0.136364
pacific ocean0.134831
depth 500-1000m0.097561
atlantic ocean0.096774
rhizophora stylosa0.095238
east china sea0.095238
dongzhaigang national nature reserve0.095238
leizhou nature reserve0.095238
brackish water0.095238
caspian sea0.095238
shenzhen futian national nature reserve0.095238
ximendao national marine reserve0.095238
bodega bay0.095238
zostera marina0.090909
marine eelgrass0.090909
rhizosphere0.089552
china0.071487
soil0.059642
state of california0.052632
LOWER IN topsoil0.050000
20 cm depth0.050000
avicennia germinans0.050000
rhizophora mangle0.050000
juan de fuca nehalem0.050000
yushan islands0.050000
LOWER IN other regions0.050000
barkley canyon0.050000
shore0.050000
hecceta sw0.050000
depth 150-600m0.050000
sample depth 0-12cm0.050000
sample depth 12-35cm0.050000
carbonate0.050000
lithified carbonate blocks0.050000
hydrate ridge0.050000
low activity methane seep0.050000
LOWER IN oil seep0.050000
LOWER IN active methane seep0.050000
LOWER IN depth 2000-3000m0.050000
LOWER IN depth 500-1000m0.050000
10 cm depth0.048780
coral reef0.048780
high salinity0.048780
LOWER IN low salinity0.048780
depth 150m0.047619
hawaii0.047619
depth 200m0.047619
state of oregon0.046512
LOWER IN sea water0.044444
LOWER IN water0.040816
LOWER IN root0.040816
state of florida0.037736
sea water0.029851
water0.022727
united states of america0.018349
Fraction of dbbact annotations with this term covered by the query
TermScore
mangrove swamp0.750000
mangrove0.666667
spartina alterniflora0.666667
depth 500-1000m0.666667
marine sediment0.500000
danzhou xinyinggang nature reserve0.500000
rhizophora stylosa0.500000
LOWER IN topsoil0.500000
20 cm depth0.500000
saline marsh0.500000
avicennia germinans0.500000
rhizophora mangle0.500000
nan'ao island0.500000
north east pacific ocean0.500000
juan de fuca nehalem0.500000
east china sea0.500000
yushan islands0.500000
LOWER IN other regions0.500000
barkley canyon0.500000
shore0.500000
hecceta sw0.500000
depth 1000-2000m0.500000
kandelia candel0.500000
dongzhaigang national nature reserve0.500000
mudflat0.500000
futian national nature reserve0.500000
leizhou nature reserve0.500000
brackish water0.500000
caspian sea0.500000
depth 150-600m0.500000
sample depth 0-12cm0.500000
shenzhen futian national nature reserve0.500000
ximendao national marine reserve0.500000
sample depth 12-35cm0.500000
carbonate0.500000
lithified carbonate blocks0.500000
hydrate ridge0.500000
low activity methane seep0.500000
LOWER IN oil seep0.500000
LOWER IN active methane seep0.500000
bodega bay0.500000
LOWER IN depth 2000-3000m0.500000
LOWER IN depth 500-1000m0.500000
sediment0.347826
hainan autonomous prefecture0.333333
10 cm depth0.333333
coral reef0.333333
high salinity0.333333
LOWER IN low salinity0.333333
oil seep0.333333
guangdong province0.333333
zostera marina0.333333
marine eelgrass0.333333
ocean0.312500
depth 150m0.250000
hawaii0.250000
depth 200m0.250000
state of oregon0.200000
zhejiang province0.166667
depth 0-20cm0.142857
LOWER IN sea water0.142857
atlantic ocean0.125000
pacific ocean0.117647
LOWER IN water0.090909
LOWER IN root0.090909
state of florida0.066667
rhizosphere0.062500
state of california0.052632
china0.038095
sea water0.034483
soil0.032258
water0.020000
united states of america0.010050
Fraction of annotations for the query sequences containing the term
TermScore
marine sediment0.736842
china0.578947
mangrove swamp0.473684
sediment0.473684
soil0.394737
depth 0-20cm0.368421
ocean0.289474
mangrove0.210526
spartina alterniflora0.184211
rhizosphere0.157895
pacific ocean0.157895
hainan autonomous prefecture0.131579
north east pacific ocean0.131579
oil seep0.131579
kandelia candel0.131579
zhejiang province0.131579
united states of america0.105263
guangdong province0.105263
danzhou xinyinggang nature reserve0.078947
saline marsh0.078947
atlantic ocean0.078947
nan'ao island0.078947
depth 1000-2000m0.078947
mudflat0.078947
futian national nature reserve0.078947
rhizophora stylosa0.052632
east china sea0.052632
depth 500-1000m0.052632
dongzhaigang national nature reserve0.052632
leizhou nature reserve0.052632
brackish water0.052632
caspian sea0.052632
shenzhen futian national nature reserve0.052632
ximendao national marine reserve0.052632
state of california0.052632
bodega bay0.052632
zostera marina0.052632
marine eelgrass0.052632
LOWER IN topsoil0.026316
10 cm depth0.026316
20 cm depth0.026316
coral reef0.026316
state of florida0.026316
avicennia germinans0.026316
rhizophora mangle0.026316
LOWER IN water0.026316
LOWER IN sea water0.026316
water0.026316
sea water0.026316
high salinity0.026316
LOWER IN low salinity0.026316
depth 150m0.026316
juan de fuca nehalem0.026316
yushan islands0.026316
LOWER IN other regions0.026316
barkley canyon0.026316
hawaii0.026316
shore0.026316
hecceta sw0.026316
depth 150-600m0.026316
sample depth 0-12cm0.026316
depth 200m0.026316
sample depth 12-35cm0.026316
carbonate0.026316
lithified carbonate blocks0.026316
hydrate ridge0.026316
state of oregon0.026316
low activity methane seep0.026316
LOWER IN oil seep0.026316
LOWER IN active methane seep0.026316
LOWER IN depth 2000-3000m0.026316
LOWER IN root0.026316
LOWER IN depth 500-1000m0.026316
Exp. ID User ID Description Date Region Flag Sequences
571amnondominant china, soil, mangrove swamp, marine sediment, depth 0-20cm, hainan autonomous prefecture, danzhou xinyinggang nature reserve, mangrove, rhizophora stylosa2019-12-16v4No1 / 3
34amnonhigh freq. in mangrove rhizosphere (dominant mangrove swamp, rhizosphere, china)2016-12-06v4No1 / 6
34amnonhigher in 10cm, 20cm depth compared to 0cm ( high in 10 cm depth 20 cm depth compared to topsoil in mangrove swamp rhizosphere china )2016-12-06v4No1 / 75
376amnoncommon rhizosphere, saline marsh, united states of america, atlantic ocean, sediment, spartina alterniflora2018-09-11v4No1 / 161
418amnoncommon ocean, sediment, coral reef2018-12-02v4No1 / 216
282amnoncommon soil, mangrove swamp, mangrove, united states of america, state of florida, avicennia germinans, rhizophora mangle2018-01-25v4No1 / 259
504amnon high in sediment marine sediment compared to water sea water in nan'ao island china 2019-03-14v4No1 / 395
504amnoncommon nan'ao island, sediment, marine sediment, china2019-03-14v4No1 / 437
504amnoncommon nan'ao island, water, sea water, china2019-03-14v4No1 / 452
376amnondisappear when transferred from high salinity to low salinity (other rhizosphere, saline marsh, united states of america, atlantic ocean, sediment, spartina alterniflora)2018-09-11v4No1 / 494
376amnonlower in salt marsh with low salinity (11) compared to higher salinity (25-30) ( high in high salinity compared to low salinity in rhizosphere saline marsh united states of america atlantic ocean sediment spartina alterniflora )2018-09-11v4No1 / 533
472amnoncommon ocean, sediment, marine sediment, pacific ocean, north east pacific ocean, oil seep, depth 150m, juan de fuca nehalem2019-01-16v4No1 / 535
223amnon high in yushan islands compared to other regions in sediment marine sediment ocean east china sea china 2017-10-26v4No1 / 619
472amnoncommon ocean, sediment, oil seep, marine sediment, north east pacific ocean, pacific ocean, depth 500-1000m, barkley canyon2019-01-16v4No1 / 990
93amnoncommon in marine sediment near the shore in hawaii (common hawaii, shore, marine sediment)2017-03-12v4No1 / 1151
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, spartina alterniflora, hainan autonomous prefecture, danzhou xinyinggang nature reserve2019-12-16v4No1 / 1169
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, hainan autonomous prefecture, danzhou xinyinggang nature reserve, mangrove, rhizophora stylosa2019-12-16v4No1 / 1210
472amnoncommon ocean, sediment, oil seep, marine sediment, north east pacific ocean, pacific ocean, hecceta sw, depth 1000-2000m2019-01-16v4No1 / 1275
223amnoncommon ocean, sediment, east china sea, marine sediment, china2017-10-26v4No1 / 1311
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, mangrove, kandelia candel, hainan autonomous prefecture, dongzhaigang national nature reserve2019-12-16v4No1 / 1351
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, hainan autonomous prefecture, dongzhaigang national nature reserve, mudflat2019-12-16v4No1 / 1422
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, zhejiang province, futian national nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 1435
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, guangdong province, leizhou nature reserve, spartina alterniflora2019-12-16v4No1 / 1437
34amnoncommon in mangrove rhizosphere (common mangrove swamp, rhizosphere, china)2016-12-06v4No1 / 1473
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, guangdong province, leizhou nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 1523
141amnoncommon marine sediment, brackish water, sediment, caspian sea, depth 150-600m, sample depth 0-12cm2017-04-18v4No1 / 1549
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, zhejiang province, futian national nature reserve, mudflat2019-12-16v4No1 / 1587
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, guangdong province, shenzhen futian national nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 1593
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, mangrove, kandelia candel, ximendao national marine reserve, zhejiang province2019-12-16v4No1 / 1636
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, mudflat, guangdong province, shenzhen futian national nature reserve2019-12-16v4No1 / 1649
141amnoncommon marine sediment, brackish water, sediment, caspian sea, depth 200m, sample depth 12-35cm2017-04-18v4No1 / 1659
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, ximendao national marine reserve, zhejiang province, spartina alterniflora2019-12-16v4No1 / 1668
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, zhejiang province, spartina alterniflora, futian national nature reserve2019-12-16v4No1 / 1747
486amnon high in low activity methane seep compared to oil seep active methane seep in pacific ocean ocean sediment carbonate lithified carbonate blocks depth 500-1000m hydrate ridge state of oregon 2019-02-19v4No1 / 1791
236amnoncommon state of california, bodega bay, ocean, zostera marina, marine eelgrass, sediment, marine sediment2017-11-07v4No1 / 1904
472amnon high in depth 1000-2000m compared to depth 2000-3000m in ocean sediment oil seep marine sediment north east pacific ocean pacific ocean 2019-01-16v4No1 / 2593
236amnon high in sediment marine sediment compared to root in state of california bodega bay ocean zostera marina marine eelgrass 2017-11-07v4No1 / 2745
472amnon high in depth 1000-2000m compared to depth 500-1000m in ocean sediment oil seep marine sediment north east pacific ocean pacific ocean 2019-01-16v4No1 / 3000

Problems / suggestions? Please email info AT dbbact DOT org