Search result for sequence:
TACGGAGGGTGCAAGCGTTGCTCGGAATTATTGGGCGTAAAGGGTAGGTAGGTGGTCTCATTTGTCTGGGGTGAAAGCCTTGAGCTTAACTCAAGAAGTGCCCCAGAAACGGTGAGACTGGAGTCCTGGAGAGGGTCGTGGAATTCCCGG
common ontology terms
term enrichment score
TermScore
rhizosphere0.363047
soil0.346407
cultivated environment0.200000
citrus0.173913
depth (soil) 0-10cm0.163265
brazil0.156863
topsoil0.150538
minas gerais state0.142857
campos rupestres0.142857
LOWER IN root0.137931
ph 60.133333
north china plain0.121951
root0.117647
silt loam0.114943
depth (soil) 0-20cm0.109589
state of new york0.108108
forest ecosystem0.105820
wheat0.103093
china0.101532
woodland area0.100503
greenhouse0.100000
shaanxi province0.100000
loess plateau0.095238
orchard0.090909
state of florida0.085470
fresh water0.081967
united states of america0.080927
merlot0.076923
grapevine0.076923
tomato0.076923
yellow brown soil0.076923
coarse-loamy soil0.076923
day 820.076923
kellogg biological station0.076923
mesic type hapludalf0.076923
kalamazoo loam0.076923
LOWER IN 10 years0.076923
vitis vinifera0.074074
depth (soil) 0-5cm0.074074
nanjing city prefecture0.071429
agricultural feature0.070423
river0.066667
farm0.065934
solanum lycopersicum0.064516
winter0.059880
state of michigan0.058824
soybean0.053333
non-seleniferous0.052632
rice0.052632
slit loam soil0.052632
fragaria x ananassa0.052632
strawberry0.052632
vellozia epidendroides0.052632
barbacenia macrantha0.052632
lushan mountain0.052632
sediment depth 0-10cm0.052632
xiannv lake0.052632
lu'an city prefecture0.052632
flowerpot0.052632
yunwushan national natural grassland protection zone0.052632
ningxia province0.052632
calci-orthic aridisol0.052632
haplic calcisol0.052632
grazing exclusion0.052632
LOWER IN reforestation0.052632
LOWER IN robinia pseudoacacia0.052632
robinia pseudoacacia0.052632
reforestation0.052632
ph 4.50.051282
reservoir0.051282
oryza sativa0.050633
glycine max0.050633
LOWER IN rhizosphere0.050420
depth (water) 10cm0.050000
greenhouse soil0.050000
heavy metal0.050000
age 1 year0.048780
state of tennessee0.048780
forested area0.048780
jiangxi province0.047619
zea mays0.043478
triticum aestivum0.042553
lake0.041667
agricultural field0.041667
stream0.040816
state of california0.040404
canada0.039216
spring0.038462
sediment0.028571
LOWER IN seleniferous0.027027
vero beach, fl0.027027
quincy, fl0.027027
ft. pierce, fl0.027027
gainesville, fl0.027027
central park0.027027
slit loam0.027027
low turbidity0.027027
LOWER IN high turbidity0.027027
turbidity0.027027
arachis hypogaea0.027027
Fraction of dbbact annotations with this term covered by the query
TermScore
soybean0.666667
non-seleniferous0.500000
LOWER IN seleniferous0.500000
vero beach, fl0.500000
quincy, fl0.500000
ft. pierce, fl0.500000
gainesville, fl0.500000
central park0.500000
merlot0.500000
grapevine0.500000
rice0.500000
tomato0.500000
slit loam soil0.500000
slit loam0.500000
low turbidity0.500000
LOWER IN high turbidity0.500000
turbidity0.500000
arachis hypogaea0.500000
peanut0.500000
north china plain0.500000
ph>80.500000
ph>6, ph<70.500000
ph>5, ph<60.500000
ph>4, ph<50.500000
ph 5.40.500000
moist tropical forest0.500000
temperate woodland biome0.500000
temperate deciduos forest0.500000
montane forest0.500000
savanna0.500000
guanajuato0.500000
agave0.500000
cultivated environment0.500000
reunion island0.500000
LOWER IN mediterranean0.500000
fragaria x ananassa0.500000
strawberry0.500000
yellow brown soil0.500000
LOWER IN age 10 years0.500000
LOWER IN continuous cropping0.500000
LOWER IN detph 30-75cm0.500000
LOWER IN silt clay loam0.500000
populus0.500000
southern united states0.500000
aquatic snake0.500000
LOWER IN terrestrial snake0.500000
minas gerais state0.500000
campos rupestres0.500000
ph 3.50.500000
vellozia epidendroides0.500000
barbacenia macrantha0.500000
coarse-loamy soil0.500000
day 820.500000
stover ammendment 0.500000
campinas0.500000
greenhouse0.500000
cannabis sativa0.500000
elevation 500-600m0.500000
lushan mountain0.500000
elevation 800-900m0.500000
sediment depth 0-10cm0.500000
xiannv lake0.500000
dendrobium moniliforme0.500000
lu'an city prefecture0.500000
flowerpot0.500000
dendrobium huoshanense0.500000
kellogg biological station0.500000
mesic type hapludalf0.500000
kalamazoo loam0.500000
continuous corn0.500000
miscanthus0.500000
restored prairie0.500000
panicum virgatum0.500000
0-9 years of grazing exclusion0.500000
yunwushan national natural grassland protection zone0.500000
ningxia province0.500000
calci-orthic aridisol0.500000
haplic calcisol0.500000
grazing exclusion0.500000
LOWER IN 10 years0.500000
LOWER IN reforestation0.500000
LOWER IN robinia pseudoacacia0.500000
shaanxi province0.500000
LOWER IN 30 years0.500000
20 years0.500000
robinia pseudoacacia0.500000
reforestation0.500000
30 years0.500000
raphanus sativus0.500000
citrus0.400000
LOWER IN root0.400000
rhizosphere0.340426
LOWER IN selenium0.333333
park0.333333
vitis vinifera0.333333
LOWER IN particles0.333333
ph 5.60.333333
ph 60.333333
brassica oleracea0.333333
province of quebec0.333333
Fraction of annotations for the query sequences containing the term
TermScore
soil0.638889
rhizosphere0.388889
china0.347222
united states of america0.319444
depth (soil) 0-20cm0.125000
brazil0.125000
cultivated environment0.125000
citrus0.111111
depth (soil) 0-10cm0.111111
topsoil0.097222
root0.083333
state of new york0.083333
LOWER IN root0.083333
ph 60.083333
minas gerais state0.083333
campos rupestres0.083333
woodland area0.069444
state of florida0.069444
fresh water0.069444
north china plain0.069444
agricultural feature0.069444
wheat0.069444
winter0.069444
forest ecosystem0.069444
silt loam0.069444
orchard0.055556
farm0.055556
greenhouse0.055556
loess plateau0.055556
shaanxi province0.055556
vitis vinifera0.041667
merlot0.041667
grapevine0.041667
river0.041667
solanum lycopersicum0.041667
tomato0.041667
LOWER IN rhizosphere0.041667
yellow brown soil0.041667
nanjing city prefecture0.041667
depth (soil) 0-5cm0.041667
coarse-loamy soil0.041667
day 820.041667
research facility0.041667
state of michigan0.041667
kellogg biological station0.041667
mesic type hapludalf0.041667
kalamazoo loam0.041667
LOWER IN 10 years0.041667
non-seleniferous0.027778
oryza sativa0.027778
rice0.027778
slit loam soil0.027778
water0.027778
depth (water) 10cm0.027778
stream0.027778
state of california0.027778
canada0.027778
glycine max0.027778
soybean0.027778
fragaria x ananassa0.027778
strawberry0.027778
greenhouse soil0.027778
age 1 year0.027778
state of tennessee0.027778
vellozia epidendroides0.027778
barbacenia macrantha0.027778
ph 4.50.027778
jiangxi province0.027778
lushan mountain0.027778
forested area0.027778
spring0.027778
reservoir0.027778
sediment depth 0-10cm0.027778
heavy metal0.027778
xiannv lake0.027778
lake0.027778
sediment0.027778
lu'an city prefecture0.027778
flowerpot0.027778
yunwushan national natural grassland protection zone0.027778
ningxia province0.027778
calci-orthic aridisol0.027778
haplic calcisol0.027778
grazing exclusion0.027778
LOWER IN reforestation0.027778
LOWER IN robinia pseudoacacia0.027778
triticum aestivum0.027778
zea mays0.027778
agricultural field0.027778
robinia pseudoacacia0.027778
reforestation0.027778
LOWER IN selenium0.013889
LOWER IN seleniferous0.013889
vero beach, fl0.013889
quincy, fl0.013889
ft. pierce, fl0.013889
gainesville, fl0.013889
urban biome0.013889
park0.013889
new york city0.013889
Exp. ID User ID Description Date Region Flag Sequences
357amnoncommon in moist tropical forest topsoil around the world (common soil, topsoil, depth (soil) 0-10cm, moist tropical forest, woodland area, forest ecosystem)2018-08-18v4No1 / 171
170amnoncommon river, water, fresh water, depth (water) 10cm, united states of america, stream2017-07-24v4No1 / 194
548amnon high in rhizosphere compared to root in minas gerais state campos rupestres brazil vellozia epidendroides 2019-08-15v4No1 / 197
170amnonhigher in low turbidity river water ( high in low turbidity turbidity compared to high turbidity in river water fresh water depth (water) 10cm united states of america stream )2017-07-24v4No1 / 395
415amnonhigher in citrus from humid subtropical compared to mediterranean and semi-arid climate ( high in subtropical compared to mediterranean semi-arid in rhizosphere soil citrus orchard cultivated environment )2018-11-27v4No1 / 458
615amnon high in endosphere root compared to rhizosphere in saccharum sugarcane campinas brazil greenhouse 2020-04-27v4No1 / 529
98amnoncommon citrus, rhizosphere, vero beach, fl, root, state of florida2017-04-01v4No1 / 544
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, root endosphere, root2019-08-17v4No1 / 575
667amnoncommon depth (soil) 0-20cm, ph 4.5, elevation 500-600m, jiangxi province, lushan mountain, china, forested area, topsoil, soil2020-09-25v4No1 / 575
893amnon high in sandy loam compared to silty clay loam in raphanus sativus greenhouse radish commonwealth of virginia rhizosphere fertilized soil research facility united states of america 2022-04-11v4No1 / 582
357amnoncommon soil, topsoil, depth (soil) 0-10cm, montane forest, woodland area, forest ecosystem2018-08-19v4No1 / 592
357amnoncommon soil, topsoil, depth (soil) 0-10cm, savanna, forest ecosystem, woodland area2018-08-19v4No1 / 614
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, rhizosphere2019-08-17v4No1 / 651
103amnonlower in particle bound fraction compared to free floating bacteria in mississippi river ( high in free floating compared to particles in river united states of america mississippi river fresh water aquatic biome )2017-04-05v4No1 / 653
100amnoncommon soil, urban biome, park, new york city, central park2017-04-03v4No1 / 685
667amnoncommon depth (soil) 0-20cm, elevation 800-900m, ph 4.5, jiangxi province, lushan mountain, china, forested area, topsoil, soil2020-09-25v4No1 / 694
415amnoncommon rhizosphere, soil, citrus, orchard, reunion island, cultivated environment2018-11-27v4No1 / 721
415amnoncommon rhizosphere, soil, citrus, orchard, china, cultivated environment2018-11-27v4No1 / 830
356amnoncommon in deciduous broad leaved forest top soil in japan (common soil, depth (soil) 0-10cm, hokkaido, topsoil, ph 5.4, japan, forest ecosystem)2018-08-15v4No1 / 834
146amnoncommon united states of america, solanum lycopersicum, tomato, slit loam soil, ph 6, rhizosphere2017-04-20v4No1 / 894
548amnoncommon minas gerais state, campos rupestres, brazil, rock2019-08-17v4No1 / 924
444amnoncommon in uncultivated soil plot (common yellow brown soil, nanjing city prefecture, soil, china)2019-01-07v4No1 / 946
98amnoncommon citrus, rhizosphere, quincy, fl, root, state of florida2017-04-01v4No1 / 950
474amnoncommon soil, farm, glycine max, soybean, ph 4-6, brazil, cultivated environment2019-01-16v4No1 / 974
809amnoncommon dendrobium moniliforme, lu'an city prefecture, flowerpot, research facility, greenhouse, rhizosphere, china2021-06-20v4No1 / 1002
824sheryoHigher at 10-20cm depth compared to 20-40cm depth in soil after grazing exclusion, Ningxia china ( high in depth 10-20cm compared to depth 20-40cm in yunwushan national natural grassland protection zone ningxia province calci-orthic aridisol haplic calcisol grazing exclusion china soil )2021-08-08v4No1 / 1038
548amnoncommon minas gerais state, campos rupestres, brazil, rhizosphere, vellozia epidendroides2019-08-15v4No1 / 1040
265amnoncommon canada, province of quebec, soil2017-12-11v4No1 / 1090
415amnoncommon rhizosphere, soil, citrus, orchard, brazil, cultivated environment2018-11-27v4No1 / 1091
357amnon high in ph<5 compared to ph>5 in soil topsoil depth (soil) 0-10cm temperate woodland biome temperate deciduos forest woodland area forest ecosystem 2018-08-18v4No1 / 1104
360amnonlower in leaf surface compared to soil in agave plants ( high in soil compared to leaf leaf surface in desert state of california mexico guanajuato agave )2018-08-21v4No1 / 1108
146amnon high in soil compared to rhizosphere in united states of america solanum lycopersicum tomato slit loam ph 6 2017-04-20v4No1 / 1135
146amnoncommon united states of america, solanum lycopersicum, tomato, soil, slit loam soil, ph 62017-04-20v4No1 / 1144
444amnonlower in continuously cropped strawberry soil ( high in age 1 year compared to age 5 years age 10 years continuous cropping in rhizosphere fragaria x ananassa strawberry greenhouse soil farm yellow brown soil nanjing city prefecture china cultivated environment )2019-01-07v4No1 / 1221
800amnoncommon 7-18 days following heavy metal contamination (common spring, reservoir, sediment depth 0-10cm, heavy metal, china, xiannv lake, lake, fresh water, sediment)2021-06-15v4No1 / 1248
101amnon high in rhizosphere compared to root in state of new york vitis vinifera united states of america merlot grapevine 2017-04-03v4No1 / 1315
600sheryoCommon in biochar ammended soil after 82 days (common depth (soil) 0-5cm, state of new york, soil, biochar, united states of america, coarse-loamy soil, ph 6, day 82)2020-03-27v4No1 / 1326
600sheryoCommon in stover ammended soil after 82 days (common depth (soil) 0-5cm, state of new york, soil, united states of america, coarse-loamy soil, ph 6, day 82, stover ammendment )2020-03-27v4No1 / 1327
259amnoncommon in soil and rhizpsphere of peanut plants (common soil, rhizosphere, ph 5, arachis hypogaea, peanut, china)2017-12-02v4No1 / 1334
98amnoncommon citrus, rhizosphere, ft. pierce, fl, root, state of florida2017-04-01v4No1 / 1340
809amnoncommon dendrobium huoshanense, lu'an city prefecture, flowerpot, research facility, greenhouse, rhizosphere, china2021-06-20v4No1 / 1356
98amnoncommon citrus, rhizosphere, gainesville, fl, root, state of florida2017-04-01v4No1 / 1371
821sheryoCommon in soil of miscanthus field at 10-25cm depth, Michigan USA (common depth (soil) 10-25cm, miscanthus, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-08-02v4No1 / 1377
821sheryoCommon in soil of continuous corn field at 0-10cm depth, Michigan USA (common united states of america, state of michigan, kellogg biological station, ph 5.9, mesic type hapludalf, kalamazoo loam, depth (soil) 0-10cm, continuous corn, corn, soil)2021-07-28v4No1 / 1380
600sheryoCommon in unammended soil after 82 days (common depth (soil) 0-5cm, state of new york, soil, united states of america, coarse-loamy soil, ph 6, day 82)2020-03-27v4No1 / 1395
76amnoncommon in non-seleniferous soil (common soil, rhizosphere, united states of america, non-seleniferous, state of florida)2017-02-28v4No1 / 1414
444amnoncommon rhizosphere, fragaria x ananassa, strawberry, greenhouse soil, farm, yellow brown soil, nanjing city prefecture, age 1 year, china, cultivated environment2019-01-07v4No1 / 1439
548amnoncommon in phosphorus impoverished soil (common soil, minas gerais state, campos rupestres, brazil, ph 3.5)2019-08-15v4No1 / 1483
145amnoncommon soil, rhizosphere, oryza sativa, rice, united states of america, ph 5.62017-04-19v4No1 / 1515
76amnonhigher in non-seleniferous soil compared to seleniferous soil ( high in non-seleniferous compared to selenium seleniferous in soil united states of america rhizosphere woodland area )2017-02-28v4No1 / 1621
462amnon high in depth (soil) 0-30 cm depth (soil) 0-20cm silt loam compared to detph 30-75cm silt clay loam in soil united states of america state of tennessee cultivated environment 2019-01-12v4No1 / 1648
536amnon high in aquatic snake compared to terrestrial snake in snake skin united states of america southern united states 2019-07-28v4No1 / 1772
156amnoncommon soil, rhizosphere, brassica, brassica oleracea, china2017-07-27v4No1 / 1885
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>4, ph<5, china2018-02-11v4No1 / 1886
824sheryoCommon in soil after 0-9 years of grazing exclusion at 0-10cm depth, Ningxia china (common depth (soil) 0-10cm, 0-9 years of grazing exclusion, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, china, soil)2021-08-08v4No1 / 1903
800amnonlower at 100-250 days compared to 7-28 days following heavy metal contamination ( high in spring compared to autumn summer in reservoir sediment depth 0-10cm heavy metal china xiannv lake lake fresh water sediment )2021-06-15v4No1 / 1962
101amnoncommon state of new york, vitis vinifera, united states of america, merlot, grapevine, rhizosphere2017-04-03v4No1 / 1980
821sheryoCommon in soil of switchgrass field at 0-10cm depth, Michigan USA (common kellogg biological station, mesic type hapludalf, kalamazoo loam, panicum virgatum, depth (soil) 0-10cm, state of michigan, soil, united states of america)2021-08-02v4No1 / 2067
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>6, ph<7, china2018-02-11v4No1 / 2223
296amnoncommon in wheat field soil (common soil, north china plain, depth 5cm, agricultural feature, wheat, winter, china)2018-02-11v4No1 / 2341
101amnoncommon state of new york, vitis vinifera, united states of america, merlot, grapevine, soil2017-04-03v4No1 / 2537
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>8, china2018-02-11v4No1 / 2646
837sheryoHigher in soil of agricultural feild compared to after 30 years reforestation with Black locust trees , shaanxi, China ( high in triticum aestivum zea mays agricultural field compared to robinia pseudoacacia 30 years reforestation in silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 2927
837sheryoHigher in soil in agricultural feild compared after 10 years reforestation with Black locust trees, shaanxi, China ( high in triticum aestivum zea mays agricultural field compared to 10 years reforestation robinia pseudoacacia in silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 2994
618amnon high in rhizosphere compared to root endosphere root in canada farm cannabis sativa 2020-05-04v4No1 / 3134
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>5, ph<6, china2018-02-11v4No1 / 3508
462amnon high in rhizosphere compared to root in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 4630
271amnon high in soil compared to rhizosphere glycine max soybean in depth (soil) 0-20cm china 2018-01-09v4No1 / 4853
837sheryoHigher in soil after 30 years compared to 10 years of reforestation with Black locust trees, shaanxi, China ( high in 30 years compared to 10 years in robinia pseudoacacia reforestation silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 5245
837sheryoHigher in soil after 20 years compared to 10 years of reforestation with Black locust trees, shaanxi, China ( high in 20 years compared to 10 years in robinia pseudoacacia reforestation silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 5270
171amnonlower in roots compared to rhizosphere soil in rice ( high in rhizosphere soil compared to root in united states of america state of california oryza sativa rice )2017-07-25v4No1 / 7628
271amnon high in soil rhizosphere compared to root structure root in depth (soil) 0-20cm glycine max soybean china 2018-01-09v4No1 / 7954

Problems / suggestions? Please email info AT dbbact DOT org