Search result for sequence:
TACGGAGGGTGCAAGCGTTGTCCGGAATCATTGGGCGTAAAGAGTTCGTAGGTGGTATGTTAAGTCTGGTGTCAAAGCCCGAAGCTCAACTTCGGTTCGGCACTGGATACTGGCAAACTAGAATGCGGTAGAGGTAAAGGGAATTCCTGG
common ontology terms
term enrichment score
TermScore
LOWER IN nouabale-ndoki national park0.500000
LOWER IN republic of congo0.500000
gorilla gorilla gorilla0.500000
belgium0.200000
crohn's disease0.125000
zoological garden0.117647
LOWER IN wild0.071429
feces0.011527
LOWER IN control0.010417
united states of america0.007663
homo sapiens0.006873
Fraction of dbbact annotations with this term covered by the query
TermScore
LOWER IN nouabale-ndoki national park0.500000
LOWER IN republic of congo0.500000
gorilla gorilla gorilla0.500000
belgium0.125000
crohn's disease0.071429
zoological garden0.066667
LOWER IN wild0.038462
feces0.005797
LOWER IN control0.005263
united states of america0.003861
homo sapiens0.003460
Fraction of annotations for the query sequences containing the term
TermScore
feces1.000000
homo sapiens0.500000
belgium0.500000
LOWER IN control0.500000
crohn's disease0.500000
LOWER IN nouabale-ndoki national park0.500000
LOWER IN wild0.500000
LOWER IN republic of congo0.500000
united states of america0.500000
zoological garden0.500000
gorilla gorilla gorilla0.500000

Problems / suggestions? Please email info AT dbbact DOT org