Search result for sequence:
TACGGAGGGTGCAAGCGTTGTCCGGAATCATTGGGCGTAAAGAGTTCGTAGGTGGTATGTTAAGTCTGGTGTCAAAGCCCGAAGCTCAACTTCGGTTCGGCACTGGATACTGGCAAACTAGAATGCGGTAGAGGTAAAGGGAATTCCTGG
common ontology terms
term enrichment score
TermScore
LOWER IN republic of congo0.500000
LOWER IN nouabale-ndoki national park0.500000
gorilla gorilla gorilla0.500000
belgium0.200000
crohn's disease0.142857
zoological garden0.117647
LOWER IN wild0.076923
feces0.012658
LOWER IN control0.010695
united states of america0.008032
homo sapiens0.007326
Fraction of dbbact annotations with this term covered by the query
TermScore
LOWER IN republic of congo0.500000
LOWER IN nouabale-ndoki national park0.500000
gorilla gorilla gorilla0.500000
belgium0.125000
crohn's disease0.083333
zoological garden0.066667
LOWER IN wild0.041667
feces0.006369
LOWER IN control0.005405
united states of america0.004049
homo sapiens0.003690
Fraction of annotations for the query sequences containing the term
TermScore
feces1.000000
crohn's disease0.500000
LOWER IN control0.500000
homo sapiens0.500000
belgium0.500000
united states of america0.500000
zoological garden0.500000
LOWER IN wild0.500000
LOWER IN republic of congo0.500000
LOWER IN nouabale-ndoki national park0.500000
gorilla gorilla gorilla0.500000

Problems / suggestions? Please email info AT dbbact DOT org