Search result for sequence:
TACGGAGGGTGCAAGCGTTGTCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGATTATTAAGTCAGTGGTGAAAGTCTGCGGCTCAACCGCAGGAGTGCCATTGATACTGGTAGTCTTGAGTACAGTAGAGGTAGGCGGAATTTATGG
common ontology terms
Fraction of dbbact annotations with this term covered by the query
TermScore
spartina alterniflora0.666667
east china sea0.500000
other regions0.500000
LOWER IN yushan islands0.500000
saline marsh0.500000
danzhou xinyinggang nature reserve0.500000
mangrove biome0.500000
rhizophora stylosa0.500000
dongzhaigang national nature reserve0.500000
kandelia candel0.500000
mudflat0.500000
futian national nature reserve0.500000
leizhou nature reserve0.500000
low salinity0.333333
LOWER IN high salinity0.333333
hainan autonomous prefecture0.333333
mangrove0.333333
guangdong province0.333333
mangrove swamp0.250000
depth 0-20cm0.200000
zhejiang province0.200000
marine sediment0.142857
atlantic ocean0.125000
sediment0.086957
ocean0.062500
rhizosphere0.037037
china0.020833
soil0.018519
united states of america0.005208
Fraction of annotations for the query sequences containing the term
TermScore
marine sediment0.909091
china0.909091
mangrove biome0.727273
depth 0-20cm0.727273
mangrove swamp0.727273
soil0.727273
spartina alterniflora0.363636
hainan autonomous prefecture0.363636
mangrove0.363636
sediment0.272727
kandelia candel0.272727
ocean0.181818
east china sea0.181818
danzhou xinyinggang nature reserve0.181818
dongzhaigang national nature reserve0.181818
futian national nature reserve0.181818
zhejiang province0.181818
leizhou nature reserve0.181818
guangdong province0.181818
other regions0.090909
LOWER IN yushan islands0.090909
rhizosphere0.090909
saline marsh0.090909
united states of america0.090909
atlantic ocean0.090909
low salinity0.090909
LOWER IN high salinity0.090909
rhizophora stylosa0.090909
mudflat0.090909
Exp. ID User ID Description Date Region Flag Sequences
223amnon high in other regions compared to yushan islands in sediment marine sediment ocean east china sea china 2017-10-26v4No1 / 302
376amnonhigher in salt marsh with low salinity (11) compared to higher salinity (25-30) ( high in low salinity compared to high salinity in rhizosphere saline marsh united states of america atlantic ocean sediment spartina alterniflora )2018-09-11v4No1 / 1038
571amnoncommon danzhou xinyinggang nature reserve, hainan autonomous prefecture, spartina alterniflora, mangrove biome, depth 0-20cm, marine sediment, mangrove swamp, soil, china2019-12-16v4No1 / 1169
571amnoncommon rhizophora stylosa, mangrove, danzhou xinyinggang nature reserve, hainan autonomous prefecture, mangrove biome, depth 0-20cm, marine sediment, mangrove swamp, soil, china2019-12-16v4No1 / 1210
223amnoncommon ocean, sediment, east china sea, marine sediment, china2017-10-26v4No1 / 1311
571amnoncommon dongzhaigang national nature reserve, hainan autonomous prefecture, kandelia candel, mangrove, mangrove biome, depth 0-20cm, marine sediment, mangrove swamp, soil, china2019-12-16v4No1 / 1351
571amnoncommon mudflat, dongzhaigang national nature reserve, hainan autonomous prefecture, mangrove biome, depth 0-20cm, marine sediment, mangrove swamp, soil, china2019-12-16v4No1 / 1422
571amnoncommon kandelia candel, mangrove, futian national nature reserve, zhejiang province, mangrove biome, depth 0-20cm, marine sediment, mangrove swamp, soil, china2019-12-16v4No1 / 1435
571amnoncommon spartina alterniflora, leizhou nature reserve, guangdong province, mangrove biome, depth 0-20cm, marine sediment, mangrove swamp, soil, china2019-12-16v4No1 / 1437
571amnoncommon kandelia candel, mangrove, leizhou nature reserve, guangdong province, mangrove biome, depth 0-20cm, marine sediment, mangrove swamp, soil, china2019-12-16v4No1 / 1523
571amnoncommon futian national nature reserve, spartina alterniflora, zhejiang province, mangrove biome, depth 0-20cm, marine sediment, mangrove swamp, soil, china2019-12-16v4No1 / 1747

Problems / suggestions? Please email info AT dbbact DOT org