Search result for sequence:
TACGGAGGGTGCAAGCGTTGTTCGGAATTACTGGGCGTAAAGAGCGTGTAGGCGGTTTGGCAAGTCAGATGTGAAAGCCCTGGGCTCAACTCAGGAAGTGCATTTGAAACTGCCATTCTAGAGTATGGGAGAGGAGAGTGGAATTCCCAG
common ontology terms
Fraction of dbbact annotations with this term covered by the query
TermScore
mangrove swamp0.500000
danzhou xinyinggang nature reserve0.500000
rhizophora stylosa0.500000
dongzhaigang national nature reserve0.500000
mudflat0.500000
leizhou nature reserve0.500000
kandelia candel0.500000
futian national nature reserve0.500000
ximendao national marine reserve0.500000
spartina alterniflora0.333333
hainan autonomous prefecture0.333333
mangrove0.333333
guangdong province0.333333
zhejiang province0.166667
depth 0-20cm0.142857
marine sediment0.071429
rhizosphere0.030303
china0.018868
soil0.015873
Fraction of annotations for the query sequences containing the term
TermScore
china1.000000
mangrove swamp1.000000
soil0.900000
marine sediment0.900000
depth 0-20cm0.900000
spartina alterniflora0.400000
zhejiang province0.400000
hainan autonomous prefecture0.300000
mangrove0.300000
danzhou xinyinggang nature reserve0.200000
mudflat0.200000
guangdong province0.200000
leizhou nature reserve0.200000
kandelia candel0.200000
futian national nature reserve0.200000
ximendao national marine reserve0.200000
rhizophora stylosa0.100000
dongzhaigang national nature reserve0.100000
rhizosphere0.100000
Exp. ID User ID Description Date Region Flag Sequences
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, spartina alterniflora, hainan autonomous prefecture, danzhou xinyinggang nature reserve2019-12-16v4No1 / 1169
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, hainan autonomous prefecture, danzhou xinyinggang nature reserve, mangrove, rhizophora stylosa2019-12-16v4No1 / 1210
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, hainan autonomous prefecture, dongzhaigang national nature reserve, mudflat2019-12-16v4No1 / 1422
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, guangdong province, leizhou nature reserve, spartina alterniflora2019-12-16v4No1 / 1437
34amnoncommon in mangrove rhizosphere (common mangrove swamp, rhizosphere, china)2016-12-06v4No1 / 1473
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, guangdong province, leizhou nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 1523
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, zhejiang province, futian national nature reserve, mudflat2019-12-16v4No1 / 1587
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, mangrove, kandelia candel, ximendao national marine reserve, zhejiang province2019-12-16v4No1 / 1636
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, ximendao national marine reserve, zhejiang province, spartina alterniflora2019-12-16v4No1 / 1668
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, zhejiang province, spartina alterniflora, futian national nature reserve2019-12-16v4No1 / 1747

Problems / suggestions? Please email info AT dbbact DOT org