Search result for sequence:
TACGGAGGGTGCAAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCGTGTAGGCGGCCTGGTAAGTCAGATGTGAAAGCCCTCGGCTTAACCGGGGAAGTGCATCTGAAACTGCCTGGCTTGAGTACGGGAGAGGGAGGCGGAATTCCCAG
common ontology terms
Fraction of dbbact annotations with this term covered by the query
TermScore
spartina alterniflora0.666667
futian national nature reserve0.500000
kandelia candel0.500000
dongzhaigang national nature reserve0.500000
mudflat0.500000
east china sea0.500000
hangzhou bay0.500000
LOWER IN other regions0.500000
saline marsh0.500000
danzhou xinyinggang nature reserve0.500000
rhizophora stylosa0.500000
leizhou nature reserve0.500000
brackish water0.500000
caspian sea0.500000
depth 150-600m0.500000
sample depth 0-12cm0.500000
sample depth 12-35cm0.500000
mangrove0.333333
hainan autonomous prefecture0.333333
low salinity0.333333
LOWER IN high salinity0.333333
guangdong province0.333333
mangrove swamp0.250000
depth 200m0.250000
marine sediment0.214286
zhejiang province0.166667
depth 0-20cm0.142857
sediment0.130435
atlantic ocean0.125000
ocean0.062500
rhizosphere0.031250
china0.019048
soil0.016129
united states of america0.005025
Fraction of annotations for the query sequences containing the term
TermScore
marine sediment0.923077
china0.769231
soil0.692308
mangrove swamp0.692308
depth 0-20cm0.692308
mangrove0.461538
kandelia candel0.384615
hainan autonomous prefecture0.384615
dongzhaigang national nature reserve0.307692
sediment0.307692
zhejiang province0.153846
futian national nature reserve0.153846
mudflat0.153846
spartina alterniflora0.153846
guangdong province0.153846
leizhou nature reserve0.153846
brackish water0.153846
caspian sea0.153846
ocean0.076923
east china sea0.076923
hangzhou bay0.076923
LOWER IN other regions0.076923
rhizosphere0.076923
saline marsh0.076923
united states of america0.076923
atlantic ocean0.076923
low salinity0.076923
LOWER IN high salinity0.076923
danzhou xinyinggang nature reserve0.076923
rhizophora stylosa0.076923
depth 150-600m0.076923
sample depth 0-12cm0.076923
depth 200m0.076923
sample depth 12-35cm0.076923
Exp. ID User ID Description Date Region Flag Sequences
571amnondominant china, soil, mangrove swamp, marine sediment, depth 0-20cm, zhejiang province, futian national nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 4
571amnondominant china, soil, mangrove swamp, marine sediment, depth 0-20cm, mangrove, kandelia candel, hainan autonomous prefecture, dongzhaigang national nature reserve2019-12-16v4No1 / 4
571amnondominant china, soil, mangrove swamp, marine sediment, depth 0-20cm, hainan autonomous prefecture, dongzhaigang national nature reserve, mudflat2019-12-16v4No1 / 5
223amnon high in hangzhou bay compared to other regions in sediment marine sediment ocean east china sea china 2017-10-26v4No1 / 90
376amnonhigher in salt marsh with low salinity (11) compared to higher salinity (25-30) ( high in low salinity compared to high salinity in rhizosphere saline marsh united states of america atlantic ocean sediment spartina alterniflora )2018-09-11v4No1 / 1038
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, hainan autonomous prefecture, danzhou xinyinggang nature reserve, mangrove, rhizophora stylosa2019-12-16v4No1 / 1210
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, mangrove, kandelia candel, hainan autonomous prefecture, dongzhaigang national nature reserve2019-12-16v4No1 / 1351
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, hainan autonomous prefecture, dongzhaigang national nature reserve, mudflat2019-12-16v4No1 / 1422
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, zhejiang province, futian national nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 1435
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, guangdong province, leizhou nature reserve, spartina alterniflora2019-12-16v4No1 / 1437
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, guangdong province, leizhou nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 1523
141amnoncommon marine sediment, brackish water, sediment, caspian sea, depth 150-600m, sample depth 0-12cm2017-04-18v4No1 / 1549
141amnoncommon marine sediment, brackish water, sediment, caspian sea, depth 200m, sample depth 12-35cm2017-04-18v4No1 / 1659

Problems / suggestions? Please email info AT dbbact DOT org